ID: 1141482830

View in Genome Browser
Species Human (GRCh38)
Location 16:84318298-84318320
Sequence CCATTGCCACCAAGCCATCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 85}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141482830_1141482835 0 Left 1141482830 16:84318298-84318320 CCTCGATGGCTTGGTGGCAATGG 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1141482835 16:84318321-84318343 CTGGCTCCTGGATGGCCCTGAGG 0: 1
1: 0
2: 6
3: 71
4: 470
1141482830_1141482842 24 Left 1141482830 16:84318298-84318320 CCTCGATGGCTTGGTGGCAATGG 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1141482842 16:84318345-84318367 GGTGTTACAAGGTACCTGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 55
1141482830_1141482836 3 Left 1141482830 16:84318298-84318320 CCTCGATGGCTTGGTGGCAATGG 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1141482836 16:84318324-84318346 GCTCCTGGATGGCCCTGAGGAGG 0: 1
1: 1
2: 1
3: 26
4: 246
1141482830_1141482841 23 Left 1141482830 16:84318298-84318320 CCTCGATGGCTTGGTGGCAATGG 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1141482841 16:84318344-84318366 AGGTGTTACAAGGTACCTGCCGG 0: 1
1: 0
2: 2
3: 3
4: 78
1141482830_1141482834 -8 Left 1141482830 16:84318298-84318320 CCTCGATGGCTTGGTGGCAATGG 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1141482834 16:84318313-84318335 GGCAATGGCTGGCTCCTGGATGG 0: 1
1: 0
2: 2
3: 23
4: 275
1141482830_1141482838 13 Left 1141482830 16:84318298-84318320 CCTCGATGGCTTGGTGGCAATGG 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1141482838 16:84318334-84318356 GGCCCTGAGGAGGTGTTACAAGG 0: 1
1: 0
2: 2
3: 19
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141482830 Original CRISPR CCATTGCCACCAAGCCATCG AGG (reversed) Exonic
900100867 1:961410-961432 TCATGGCCACGAAGGCATCGTGG - Exonic
900611606 1:3546762-3546784 CCATTGCCACCCCGCCATGGTGG - Intronic
902141793 1:14362942-14362964 CCTTTGCCATCATGCCATTGGGG - Intergenic
905891741 1:41522322-41522344 CCATTGCCACCATCCCAACCTGG + Intronic
909929313 1:81477090-81477112 CCATTGCCACTAACCCACCCTGG + Intronic
914929813 1:151921032-151921054 CCATTACCTGCAAGCCATCAGGG - Intergenic
923868390 1:237964325-237964347 CCATTGCTTGCCAGCCATCGGGG - Intergenic
1069769376 10:70887978-70888000 CCAGCGCCACCAAGCCCCCGTGG + Intronic
1070094102 10:73319588-73319610 TCATTGCCTGCAAGCCATCAGGG + Intronic
1074154872 10:110789304-110789326 CCACTGCCACCAAGCCCTTCTGG + Intronic
1078363563 11:10688712-10688734 CGATTTCCACCAAGCCGTGGTGG + Intronic
1083110267 11:60399668-60399690 CCATTGCCACCAAGCTAGTTCGG - Intronic
1084462692 11:69304733-69304755 CCATGGCCAGGAAGCCATCCTGG + Intronic
1085224494 11:74907325-74907347 CCATTCCCAGGAAGCCATGGAGG + Intronic
1085296951 11:75436688-75436710 GCACTGACACCAAGCCATGGTGG + Intronic
1085532739 11:77201607-77201629 CCACTGTCACCATGCCACCGCGG + Exonic
1089975766 11:122730233-122730255 CCACAGCCACCAAGCCATCTCGG - Intronic
1090502116 11:127271229-127271251 ACATTCCCCCCAAGCCATCTGGG - Intergenic
1097277134 12:57821327-57821349 ACACTCCCACCAAGCCATCCTGG + Exonic
1098690260 12:73479124-73479146 CCTCTCCCACCAAGCCATCAAGG + Intergenic
1103852383 12:123941464-123941486 CCATTTCCACCAAGCCTTAGTGG - Intronic
1104640915 12:130466437-130466459 CCATTGCCACCAAAACCTCCTGG + Intronic
1112698795 13:101980686-101980708 CAAGTGCCAACAAGCCATCAGGG + Intronic
1118935382 14:70283311-70283333 CCATTGCCACTCAGGCATCACGG - Intergenic
1121692207 14:95886022-95886044 CAATTGCTGCCCAGCCATCGTGG + Intergenic
1132106532 15:99066798-99066820 CCATTCCCACCAAGCCACTCAGG - Intergenic
1132177830 15:99729221-99729243 CCATTGCCATCGAGCCATTGGGG + Exonic
1132422548 15:101684812-101684834 CCATTGCCTCTAAGCCACCGTGG + Intronic
1137344622 16:47644780-47644802 CCAGTGCCAAAAAGCCATTGAGG + Intronic
1139355707 16:66366151-66366173 CCATTCCCACAAAGACATCATGG + Intergenic
1140773805 16:78230933-78230955 CCATTGCCTCAAAGCAATCATGG - Intronic
1140922659 16:79553264-79553286 CCATTGCCACCTCTCCATCATGG + Intergenic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1145239499 17:21231873-21231895 CCTTTGGCACCAAGCCAGCTGGG + Intergenic
1146661548 17:34668160-34668182 CCATTCCCACCAAGGCCTCTGGG - Intergenic
1148214274 17:45825874-45825896 TCATTGCCACCAACCCAGAGAGG + Intronic
1148779298 17:50112551-50112573 CCATTGCCCTCAGGCCATCGTGG - Intronic
1152237489 17:79146182-79146204 CAGTTCCCACCAAGCCATGGAGG + Intronic
1152351396 17:79785764-79785786 CCATAGCCCACAAGCCAGCGTGG + Exonic
1153773332 18:8432799-8432821 CCCTTGCCCGCAAGCCATCGGGG - Intergenic
1161118568 19:2512786-2512808 CCCTTTCCAACAAGCCATCTTGG - Exonic
1162391165 19:10391015-10391037 CCTTTGCCCACCAGCCATCGTGG - Intergenic
1162551215 19:11359512-11359534 CGACTGCCACCAAGCCAGGGCGG - Intronic
1163469028 19:17486302-17486324 CCAGGGCCACCAAGCCAGCTGGG + Intronic
1164345474 19:27250299-27250321 CCATTTCCACCAAGGCTTCAAGG - Intergenic
1165708135 19:37990837-37990859 CCAATGCCACTAAGTCATCATGG - Intronic
925054016 2:841884-841906 CCATTACCACCAAGCCACTTAGG - Intergenic
925411628 2:3643054-3643076 GCAGTGCCCCCAAGCCATGGAGG + Intronic
926128684 2:10286865-10286887 CCATTGCCCTGAAGCCACCGTGG - Intergenic
926153753 2:10439193-10439215 CCACTGCCACTAAGCGATCTCGG + Intergenic
935632370 2:105222705-105222727 CCATAGCCACCCTGCCATCCTGG + Intergenic
943033875 2:182716471-182716493 CCATGCCCACCTTGCCATCGCGG - Exonic
1169017467 20:2303642-2303664 CCATGGCCACCGAGCCAGAGTGG + Intronic
1170861056 20:20104138-20104160 CCCTTGTCACCAAGTCATCCAGG + Intronic
1176072137 20:63232807-63232829 CCAAAGCCACCCAGCCATCCGGG - Intergenic
1182098672 22:27642639-27642661 CCATGGATACCAAGCCAGCGTGG + Intergenic
1183710442 22:39500301-39500323 CCATTGCCACGGAAGCATCGGGG + Intronic
1183789042 22:40050158-40050180 CCTTTGCTACCAAGCCAGCCCGG + Intronic
952689479 3:36187795-36187817 CCATTGTCACCAAAACAGCGTGG - Intergenic
952979560 3:38723734-38723756 CCATTGCCAGCACTCCATCAGGG - Intronic
953795978 3:45986356-45986378 CCACTGCCACCTTGCCCTCGTGG + Intronic
959249677 3:103926108-103926130 ACAATGCCTCCAAGCCACCGTGG + Intergenic
959596284 3:108132380-108132402 CCATTTCCACCATGCCATGTGGG + Intergenic
972360371 4:38320749-38320771 CTATTGCCAGCCAGCCCTCGGGG - Intergenic
976672186 4:87665920-87665942 CTATTGCCCCCAAGCCTTCCTGG + Intergenic
978111014 4:104964041-104964063 CTACTGCCACCAAGGCATGGGGG - Intergenic
982107311 4:152022261-152022283 AGATTGCCACCAAGCCTTTGGGG + Intergenic
984213103 4:176875176-176875198 CTATTGTCAACAAGCCACCGTGG - Intergenic
985971389 5:3381213-3381235 CCATGGCCTCCAAGCCAGCTAGG - Intergenic
988728158 5:33944099-33944121 CCCTTGCCACCGAGGCATAGAGG + Intergenic
990253094 5:53937130-53937152 CCATTGACACCGAGCCTCCGGGG - Intronic
990530394 5:56667747-56667769 CCATTGTCACCAAGGGATGGGGG - Intergenic
1000388731 5:160701038-160701060 CCATTGCCACACACCCATCCAGG + Intronic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1005650180 6:27878801-27878823 ACACTCCCACCAAGCCATCCTGG + Intergenic
1010644800 6:78373747-78373769 CCACTACCACCAACCCATGGAGG - Intergenic
1012780090 6:103546801-103546823 CCAATACCACCAAGCCACCAAGG + Intergenic
1022521580 7:31011351-31011373 CCATTGCCTCCAAGACACAGTGG - Intergenic
1024153707 7:46599171-46599193 CCAGTGTCCCCAAGCCCTCGTGG - Intergenic
1027423183 7:78037089-78037111 CCAGTGCCCCCAAGGCATCCAGG + Intronic
1029813087 7:103068946-103068968 CCACGGCCACCACGCCATCTGGG + Intronic
1030461209 7:109839205-109839227 ACACTCCCACCAAGCCATCCTGG - Intergenic
1033660690 7:143399804-143399826 CCACTTCCACCAACCCAGCGGGG + Exonic
1037400792 8:18493541-18493563 CCAATGCCACCAAAGCATGGTGG - Intergenic
1041144790 8:54862601-54862623 CCATTCCCAGCCAGCCATCAGGG + Intergenic
1044839984 8:96329240-96329262 CCATTCACATCAAGCCATCCTGG - Intronic
1046764694 8:118056940-118056962 CCATTACCAAAAAGCCATGGAGG + Intronic
1049258675 8:141627257-141627279 CCATGGACACCCTGCCATCGGGG - Intergenic
1057489486 9:95510395-95510417 CCAGTGTCACCAAGGCATCCCGG + Intronic
1060849594 9:126862694-126862716 CGAGTGCCACAAAGCCATGGGGG - Intronic
1061485973 9:130920705-130920727 CCAGTAGCACCAAGCCACCGTGG + Intronic
1196665180 X:118308735-118308757 CCATTGCCACGAGGACATCTTGG - Intergenic
1198022313 X:132671094-132671116 CCTTTGCCAGGAAGTCATCGAGG - Intronic
1198392049 X:136186116-136186138 CCATTGCCACTAATCCATCATGG + Intronic