ID: 1141482834

View in Genome Browser
Species Human (GRCh38)
Location 16:84318313-84318335
Sequence GGCAATGGCTGGCTCCTGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 275}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141482828_1141482834 -2 Left 1141482828 16:84318292-84318314 CCGAAACCTCGATGGCTTGGTGG 0: 1
1: 0
2: 0
3: 7
4: 47
Right 1141482834 16:84318313-84318335 GGCAATGGCTGGCTCCTGGATGG 0: 1
1: 0
2: 2
3: 23
4: 275
1141482830_1141482834 -8 Left 1141482830 16:84318298-84318320 CCTCGATGGCTTGGTGGCAATGG 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1141482834 16:84318313-84318335 GGCAATGGCTGGCTCCTGGATGG 0: 1
1: 0
2: 2
3: 23
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141482834 Original CRISPR GGCAATGGCTGGCTCCTGGA TGG Exonic
900138756 1:1130095-1130117 GACAATCGCTTGCACCTGGAAGG + Intergenic
900420880 1:2555476-2555498 GGCCAGGGCTGGACCCTGGAGGG + Intergenic
901769328 1:11522543-11522565 GGCTCTGGCTGGGTCCTGGCTGG - Intronic
901769342 1:11522587-11522609 GGCTCTGGCTGGGTCCTGGCTGG - Intronic
901769349 1:11522609-11522631 GGCTCTGGCTGGGTCCTGGCTGG - Intronic
901769367 1:11522664-11522686 GGCTCTGGCTGGGTCCTGGCTGG - Intronic
901769381 1:11522697-11522719 GGCCCTGGCTGGGTCCTGGCTGG - Intronic
901769408 1:11522763-11522785 GGCCCTGGCTGGGTCCTGGCTGG - Intronic
901769422 1:11522807-11522829 GGCTCTGGCTGGGTCCTGGCTGG - Intronic
901769429 1:11522829-11522851 GGCTCTGGCTGGGTCCTGGCTGG - Intronic
901769436 1:11522851-11522873 GGCTCTGGCTGGGTCCTGGCTGG - Intronic
901769446 1:11522884-11522906 GGCTCTGGCTGGGTCCTGGCTGG - Intronic
901769460 1:11522928-11522950 GGCTCTGGCTGGGTCCTGGCTGG - Intronic
902350287 1:15848597-15848619 GGCAATGTCTGACTTCGGGAGGG + Intronic
902408299 1:16198538-16198560 CTCCATGCCTGGCTCCTGGATGG - Exonic
903176809 1:21586390-21586412 GGCTCTGGCTGGATCCTGGTGGG - Intergenic
903577939 1:24350803-24350825 GGCACTGCCTGCCCCCTGGAGGG - Intronic
904247185 1:29196085-29196107 GGCAATGCCCCGTTCCTGGAGGG - Intronic
906790515 1:48654999-48655021 AGCACAGGCTGGCTCCTTGATGG - Intronic
912254693 1:108046977-108046999 GGCATTGGTTGGAGCCTGGATGG - Intergenic
912496871 1:110097511-110097533 GGGAATGGAGGGCTCCGGGAAGG + Intergenic
913378767 1:118185567-118185589 GGCATGGGCTGCCTCCTGAAGGG - Intergenic
915434509 1:155893739-155893761 GGCAATAACTAGCTCCAGGAAGG + Intergenic
915638372 1:157202516-157202538 GGAAATGCCTGACTTCTGGAAGG + Intergenic
915658465 1:157381194-157381216 GGAAATGCCTGGCTTCTGGAAGG + Intergenic
916442083 1:164837042-164837064 GGTAATTGCTGTCTCTTGGATGG + Intronic
917790705 1:178496956-178496978 GGCGATGGCTGGGTGCTGGCTGG + Intergenic
920175340 1:204097797-204097819 GTCAATGGCCACCTCCTGGATGG + Intronic
920501801 1:206490296-206490318 GGCCTTGGCTGCCTCCTGAAGGG - Intronic
920517069 1:206593010-206593032 GGGAATGACTGGAACCTGGAAGG + Intronic
921121209 1:212139293-212139315 GGCAATTGCTGGCAGCTGAAGGG + Intergenic
923035509 1:230282438-230282460 GCCAAGGGCTGGCTCCAGGCAGG - Intergenic
924193756 1:241583352-241583374 GGCAATGACTGAGTCCTGGCAGG - Intronic
1063925245 10:10971177-10971199 GTCAAAGGCTGCCTCTTGGAAGG + Intergenic
1064703100 10:18042339-18042361 TGCAATGGCACGCACCTGGAAGG + Intronic
1065099507 10:22320573-22320595 GGCGACGGCTGGCTCCGGGCAGG - Intronic
1066492619 10:35908021-35908043 GGTCCTGGCTGGCTCATGGAGGG + Intergenic
1066760114 10:38741584-38741606 GGCAAGGGCTGGGCCCTGGCTGG - Intergenic
1069960286 10:72075313-72075335 GGAAATGGCTGGGTTCTGGGAGG + Intronic
1070135353 10:73689346-73689368 GGCCAAGGCAGGCTGCTGGAAGG - Intronic
1070766936 10:79062148-79062170 GGCATTGAGTGGGTCCTGGAAGG - Intergenic
1071487591 10:86112993-86113015 GGCAAAGGCTGGGTCATTGAGGG - Intronic
1071574990 10:86718647-86718669 GGCAGTGGCTGGAGCCTGGTGGG + Intronic
1072911205 10:99503065-99503087 GGAAAAGGCTTGGTCCTGGAGGG - Intergenic
1074157882 10:110813864-110813886 GGCAATGGCTGGCACCTTCATGG + Intronic
1074578564 10:114694341-114694363 CACAGTTGCTGGCTCCTGGAAGG + Intergenic
1075092950 10:119453647-119453669 AGCAATGTCTGGCTCCTTTATGG - Intronic
1075180550 10:120207169-120207191 GGCAAGGGCTGGCTGCTCCAAGG - Intergenic
1075544311 10:123342954-123342976 GTCAATGGCTGGGTGCGGGATGG + Intergenic
1075726871 10:124615165-124615187 GCAGATGGCTGGCTCCTTGATGG + Intronic
1076257597 10:129040589-129040611 GGCTATGGTTGGATCATGGAAGG - Intergenic
1076277513 10:129215489-129215511 GGCAATGCATGACTTCTGGAAGG + Intergenic
1076505285 10:130968675-130968697 GGCTGTTGCTGGCCCCTGGAAGG + Intergenic
1076644846 10:131946043-131946065 GGCAACGGGTGGCTCTTGGCGGG - Intronic
1076909848 10:133381555-133381577 GGGAAAGGCTGCCTCCTGGAAGG - Exonic
1077495877 11:2886210-2886232 GGCAGGGGCCGGCTCCTGGCGGG + Intergenic
1077670418 11:4152112-4152134 GGCAGGGGCTGGCTCCTCCAGGG + Intergenic
1079975264 11:27083376-27083398 GGCAAGGGCTGGCTCAGGCAAGG - Intronic
1082775431 11:57241001-57241023 GGCTACAGCTGGCTCCTGGTTGG - Intergenic
1083139843 11:60712904-60712926 GGTAATGGGAGTCTCCTGGATGG + Intronic
1084147816 11:67274399-67274421 GACAATGCCCGGCTCCTGGTGGG + Intronic
1084746737 11:71175247-71175269 AGCAGTGGCAGGTTCCTGGATGG + Intronic
1084987087 11:72884692-72884714 GGCAGAGGCTTGATCCTGGAAGG - Intronic
1085644412 11:78213842-78213864 GGCCCTACCTGGCTCCTGGAGGG - Exonic
1085876789 11:80417232-80417254 GGCAGGGACTGGATCCTGGAGGG - Intergenic
1086848254 11:91778506-91778528 TGCAATGACTGGTTCCTAGAAGG - Intergenic
1086956984 11:92943377-92943399 GGCAGTGGATGGAACCTGGAAGG + Intergenic
1087203343 11:95367936-95367958 GACACTGGCTAGCTCCTGGGTGG + Intergenic
1087574607 11:99975053-99975075 GGCAATGGCCGACTTGTGGAAGG - Intronic
1088626786 11:111735477-111735499 GGCAGCGGCTCACTCCTGGACGG - Intronic
1088740783 11:112765246-112765268 GGGAATGGCTTCTTCCTGGAGGG + Intergenic
1089756229 11:120689435-120689457 GGGTATGGCTGGATCATGGAAGG - Intronic
1090051399 11:123382919-123382941 GGCACTGGCTGGATACAGGAGGG - Intergenic
1090962271 11:131567395-131567417 GGCAATGGCTTGAACCTGGGAGG + Intronic
1091224530 11:133949716-133949738 GGGAGGGGCTGGCTCCTGAAGGG + Intronic
1093021737 12:14210243-14210265 GGAAATAGCTGGCACCAGGAGGG - Intergenic
1094106196 12:26814050-26814072 TGCAATGGCTGGCTCGATGATGG - Intronic
1096807388 12:54148939-54148961 GGCAGGGGCCGGGTCCTGGAGGG - Intergenic
1100604364 12:96139251-96139273 GGCATTTGCAGGATCCTGGATGG - Intergenic
1102426862 12:112850592-112850614 AGCAAGGGCTGGCTGCAGGAAGG - Intronic
1102569524 12:113819021-113819043 GGCACTAGCGGGCGCCTGGAAGG - Intronic
1102766430 12:115437450-115437472 CACAATGGCAGGTTCCTGGAGGG - Intergenic
1102923365 12:116809112-116809134 GGCACTGGATGGCTCCAGCAAGG - Intronic
1104570863 12:129924591-129924613 TGCAGTGCCGGGCTCCTGGAAGG + Intergenic
1104737092 12:131142001-131142023 GGGAATGGCTTGATCCTGGGAGG - Intergenic
1104793503 12:131499283-131499305 TGCAATGACTGGATCCTGGCTGG + Intergenic
1107376719 13:39811777-39811799 GGCATTGGAGGGCTCCTGCAGGG + Intergenic
1107597743 13:41980632-41980654 AGCAATGACTGGCTCCTGCAAGG + Intergenic
1110260475 13:73479150-73479172 GGCCATGGCAGGCACCTGTAAGG - Intergenic
1110497659 13:76188448-76188470 GGCAATAGCTAGCTTCTTGAAGG + Intergenic
1110764431 13:79266581-79266603 GGCATTGCCTGGAACCTGGAAGG + Intergenic
1111926148 13:94464975-94464997 GGCAGTGGGTGGGTCCTTGATGG - Intronic
1113683265 13:112260152-112260174 GGCACTGGCTGGCGGCAGGAGGG + Intergenic
1117328706 14:54691693-54691715 AGCATTGGCTGGCGGCTGGAGGG + Intronic
1117610593 14:57479213-57479235 GGCAATGACTAGATCCTGAATGG + Intronic
1118615129 14:67569811-67569833 GTCACTGGCCTGCTCCTGGAGGG + Intronic
1119761735 14:77156540-77156562 GGCAATGGTTGTCTCTGGGAAGG - Intronic
1119913540 14:78373573-78373595 GGCTGTGGGTGTCTCCTGGATGG + Intronic
1121180684 14:91926286-91926308 GCCCAGGGCTGGCTGCTGGAGGG + Intronic
1121227421 14:92331371-92331393 GGCGATGGCTTGAGCCTGGAAGG - Intronic
1121716291 14:96078476-96078498 GGCAACAGCTGGCTCGGGGAAGG - Intronic
1122373359 14:101241923-101241945 GGCAGGGGCTGGCTCTTGGCAGG - Intergenic
1122646253 14:103196378-103196400 GGCAGTGTCTGGCTCCTGGCTGG + Intergenic
1122825611 14:104369045-104369067 GCCCAGGGCTGGCACCTGGAGGG + Intergenic
1126173871 15:45717280-45717302 GGCAATGGATGCCTCCTGTTTGG + Intergenic
1128154449 15:65384041-65384063 GGCCTGGGCTGGCTCCTAGAGGG + Exonic
1128344812 15:66846949-66846971 GACAAAGCCTGGCTGCTGGAGGG - Intergenic
1130325324 15:82874992-82875014 AGCAGTGGCTGACACCTGGAGGG + Intronic
1130415439 15:83690310-83690332 GGCATGGGCTGGATCCTGAAGGG - Intronic
1130521724 15:84667014-84667036 GGGAATGGCTTGAACCTGGAAGG - Intergenic
1131225880 15:90624116-90624138 GCCAGTGGCTGGCCCCTGGGAGG + Intronic
1131391957 15:92057031-92057053 GGCAAGGGCTACCTTCTGGAAGG - Intronic
1132350096 15:101134012-101134034 GGCCATTCCTGGCTCCTGGCCGG - Intergenic
1134265916 16:12692470-12692492 GACAGTGTCTGGCTCCTGGTAGG - Intronic
1135063289 16:19288908-19288930 TGCAATGCCAGGCTCTTGGATGG - Intronic
1136511780 16:30742434-30742456 GGCATTGAATGGCTCCTGCAGGG + Intronic
1138750256 16:59410861-59410883 GGCTATTGCTGGATCTTGGATGG + Intergenic
1139549197 16:67664048-67664070 GGCAGGGCCAGGCTCCTGGAGGG + Exonic
1139849640 16:69942996-69943018 AGCGATGGTTGCCTCCTGGAAGG - Intergenic
1140300836 16:73755929-73755951 GACAGTGGCTGGCTCCTGTTGGG + Intergenic
1141482834 16:84318313-84318335 GGCAATGGCTGGCTCCTGGATGG + Exonic
1142007311 16:87695625-87695647 GGGAATGGACGCCTCCTGGACGG - Intronic
1142204246 16:88775181-88775203 GGAGAGGCCTGGCTCCTGGAAGG + Intronic
1142270973 16:89089035-89089057 AGGTATGGCTGGCTCCTGGAAGG + Intronic
1142978142 17:3657196-3657218 GGCCAGGGTGGGCTCCTGGAGGG + Intronic
1143612072 17:8024550-8024572 TGTAATGGCTGCTTCCTGGAAGG - Intergenic
1144852814 17:18252486-18252508 GGAAATGGATGGCTTCTGGGAGG + Exonic
1146055752 17:29580197-29580219 AGCAGTAGCTGGCTCCGGGAAGG + Intronic
1148131968 17:45267473-45267495 GGCAGGGGCTGGCTCCAGGGAGG + Exonic
1148601463 17:48897420-48897442 GTCCATGGCTTGCTCCTGCAAGG - Intergenic
1149347391 17:55751863-55751885 GGCAATGCCTTCCACCTGGATGG - Intronic
1150618616 17:66791533-66791555 GGCAAGCTCTGGTTCCTGGAAGG + Intronic
1150723457 17:67633015-67633037 GGCAAAGGATGGATCCTGGTAGG - Intronic
1151395831 17:73822298-73822320 GGCAAGGGTTGGCTCATGCAGGG - Intergenic
1151935719 17:77259636-77259658 GGCTATGGGTGTCCCCTGGAGGG + Intergenic
1152528548 17:80903396-80903418 GGCACTGCCCGGCTCCTGGGAGG + Intronic
1152639188 17:81442607-81442629 GGCAAGGACCGGCACCTGGAGGG + Exonic
1153514190 18:5890309-5890331 GGCCGTGGGTGGCTCCTGGCTGG + Exonic
1154940304 18:21106422-21106444 TGCAGTGGCTCGCTCCTGGAGGG - Intronic
1155725749 18:29080667-29080689 TGCAATGGCTGGCACATGGTAGG + Intergenic
1156361261 18:36386648-36386670 GCCCATGCCAGGCTCCTGGAGGG + Intronic
1156735476 18:40253366-40253388 AGCAGTGGCTTGCTCCTGGGAGG - Intergenic
1157423903 18:47569029-47569051 GGCCATGGCTAGAGCCTGGAAGG - Intergenic
1157554850 18:48606679-48606701 GGCAAGGGCTGGCACATTGAGGG + Intronic
1158224517 18:55186774-55186796 GGCAATGACTGGCTGGTTGATGG + Intergenic
1158420700 18:57290880-57290902 GCCAATGGCTTCCTCCTGCAAGG - Intergenic
1160385782 18:78495403-78495425 TACCATGGCTGGCTCCTGGGTGG - Intergenic
1162908411 19:13836692-13836714 GCCAGAGGCTGGCACCTGGAGGG + Intergenic
1162941383 19:14011610-14011632 GAGAATGGCTGGAACCTGGAAGG + Intergenic
1165000677 19:32759320-32759342 GGCAGTTGCAGGCTCTTGGAAGG - Intronic
1165480790 19:36062806-36062828 GACAAAGGCTGACTCCTGAATGG - Intronic
1166847613 19:45739026-45739048 GGCCTTGGCTGGTTCCAGGATGG + Intronic
1166945246 19:46392158-46392180 AGAAAAGGCTGGCTCCTGGGAGG - Intronic
925485843 2:4329654-4329676 GGCAAAGGCTGGCACCTGAGAGG + Intergenic
926325824 2:11784586-11784608 GGGCAGGGCTGGCGCCTGGAGGG + Intronic
926345036 2:11937077-11937099 GACTATGGCTGCCTCCTGGTGGG + Intergenic
926782599 2:16487854-16487876 TGCAATGCCTGGCATCTGGAAGG - Intergenic
927720336 2:25378157-25378179 GGCTCTGGCAGGCTCCTGCAGGG + Intronic
927927644 2:27024789-27024811 GGCTTTGTCTGGGTCCTGGAGGG + Intronic
929518217 2:42623778-42623800 GACAATGGCTTGAACCTGGAAGG - Intronic
929666306 2:43836682-43836704 GGCAATGACTGGCTGATGCAGGG + Intronic
931043124 2:58319620-58319642 GGCCATGACTGGCTCCTGGATGG + Intergenic
931330037 2:61271212-61271234 GGGAATCGCTGGAACCTGGAAGG + Intronic
934117851 2:88813023-88813045 GGGACAGGCTGGCTCATGGAGGG + Intergenic
937039710 2:118811377-118811399 GGCAATGGTTGCCTCTGGGAAGG - Intergenic
937065075 2:119011633-119011655 GACACCGGCCGGCTCCTGGAGGG - Intergenic
937675053 2:124580994-124581016 GGGAATGCCTGGCTCCTCAAAGG + Intronic
937851743 2:126642276-126642298 GGGAATTCCTGGCTGCTGGATGG - Intergenic
940135049 2:150426089-150426111 GGCAATGCCTTGCTCCAGGAGGG - Intergenic
944665530 2:201956061-201956083 GTCGCCGGCTGGCTCCTGGAGGG - Intergenic
945784520 2:214216409-214216431 GGGAATCGCTGGATCCTGGCAGG - Intronic
946125084 2:217555597-217555619 GGCTATGACTTGCTGCTGGAGGG + Intronic
947009545 2:225550582-225550604 GGAAATGGGTGGCAGCTGGAAGG + Intronic
947245422 2:228042138-228042160 GGTACTGGCTTACTCCTGGAAGG + Intronic
947253417 2:228134704-228134726 GGCCTTGGCTGGCTCCTAGAAGG - Intronic
948932354 2:241140133-241140155 GGAAAAGGCTGGCTTCTGCATGG - Intronic
1170187478 20:13606863-13606885 GGCAATGCCTGGCACATGGCAGG + Intronic
1171488112 20:25498239-25498261 GGCCAGGGCTGCCTGCTGGACGG + Exonic
1173129977 20:40383048-40383070 GGAAATGCTTGGCTCCTGGAAGG - Intergenic
1173999312 20:47362755-47362777 GGAAATGGCTAGCTGCTGGGTGG - Intergenic
1175373643 20:58509916-58509938 GGCAGGGGCTGGTTCCTGGAGGG - Intronic
1175408268 20:58749317-58749339 GGCAGGAGCTGGGTCCTGGAGGG + Intergenic
1175435955 20:58948390-58948412 TGTAATGGCTGCTTCCTGGAAGG - Intergenic
1179099034 21:38340351-38340373 GCCAATGACTGGCTTCTGCATGG + Intergenic
1179313344 21:40216753-40216775 GGCACTGGTTGGCTGCGGGAGGG - Intronic
1179976070 21:44867410-44867432 GGCAATGGCTGCCTGGGGGACGG + Intronic
1181493264 22:23273973-23273995 GGTGATGGCTGCCACCTGGAGGG - Intronic
1181928528 22:26379935-26379957 GGCATTGGCTGGTTGATGGATGG + Intronic
1182071219 22:27465075-27465097 GGACAGGGCTGGCTCCTGGGAGG + Intergenic
1182925230 22:34116220-34116242 GGCTGTGGCTGGCAACTGGAAGG - Intergenic
1183638353 22:39078371-39078393 CCCAATGGCTGCCTCCTGCAGGG + Intronic
1183796057 22:40119059-40119081 GGCAAGGGCTGGATCCTGGAGGG + Intronic
1183796513 22:40122972-40122994 GGCAGTGACTGGAACCTGGAGGG - Intronic
1184011181 22:41749813-41749835 GGTAATGCCTGGCTTCTGGCTGG + Intronic
1184462615 22:44647885-44647907 GGCAGGGGCTGGCACCTGGTGGG - Intergenic
1184710204 22:46245294-46245316 GGGAAGGGCTGGCCCCTGGGAGG - Intronic
1184803308 22:46775562-46775584 GGCCACAGCTGCCTCCTGGAAGG + Intronic
949320922 3:2809474-2809496 GGCAGGGGCTGGATCCTGAAGGG + Intronic
950574333 3:13822751-13822773 GGCAATGGGAAGCCCCTGGAAGG + Intronic
950667959 3:14508601-14508623 GGGAATGGTGGGCTCCGGGAGGG + Intronic
951085192 3:18504345-18504367 GACAATGGTTGGCTCTGGGATGG - Intergenic
951519858 3:23601244-23601266 GACCATGGCCGGCTCCTGCAGGG - Intergenic
953458478 3:43062734-43062756 GGCGATGGCTCTCCCCTGGAGGG + Intergenic
953665889 3:44926238-44926260 GGCAGTGGCGGGCTCCCCGATGG - Exonic
953854875 3:46493661-46493683 GGCCAGGGCTGGCACCTGGTAGG - Intergenic
955875924 3:63490306-63490328 GGCAGAGGCTGGATCCTGTAGGG + Intronic
958657515 3:97021331-97021353 GGCAACGGCTAGATCCTGGAAGG - Intronic
961360588 3:126364826-126364848 GGCCCTGGCTGGCTGCTGGCTGG + Intergenic
962604774 3:137024087-137024109 GGCACTGGCTGGCTGGTGGGAGG + Intergenic
962889861 3:139662185-139662207 GGCATTCACTGGCTACTGGAAGG - Intronic
963334360 3:143955886-143955908 GGCAATGGCTGAATTTTGGAAGG + Intergenic
966914660 3:184578122-184578144 AGCAACGGCTGGCCCCAGGAGGG - Intronic
967647173 3:191939273-191939295 GAGAATGGCTGGAACCTGGAAGG + Intergenic
967808389 3:193734857-193734879 GGCACTGGCTGGCTTCCGGGCGG - Intergenic
967990183 3:195124813-195124835 GACAGGGGCTGGCTCCGGGAAGG + Intronic
969047156 4:4344719-4344741 GGCACTGCCTGGATCCTGGATGG - Intergenic
969342102 4:6548722-6548744 GCCAATGACTGCCCCCTGGAGGG - Intronic
969634131 4:8356247-8356269 GTCTAGGGCAGGCTCCTGGATGG - Intergenic
974814036 4:66982466-66982488 AGCACTGGCTGGCTTCTGGTGGG + Intergenic
976692501 4:87883798-87883820 GGGAATTGCTGGAACCTGGAAGG - Intergenic
982175455 4:152701846-152701868 AGAATTGGCTAGCTCCTGGAGGG - Intronic
983607325 4:169603793-169603815 GGGAATCGCTGGAACCTGGAAGG - Intronic
985425722 4:189828498-189828520 GGCCATGTCTGTCTCCTGGAGGG + Intergenic
985542867 5:494897-494919 GTCCCAGGCTGGCTCCTGGAGGG + Intronic
985819500 5:2150048-2150070 GGGAAAGGCTGGCTCCTGGGAGG - Intergenic
994876651 5:105431653-105431675 GGTAATGGCTGGTAGCTGGAAGG + Intergenic
996598813 5:125237132-125237154 TACAATGACTGACTCCTGGATGG + Intergenic
998095786 5:139394893-139394915 GGCCCTGGGTGGCTCCTGGGCGG - Exonic
998159060 5:139802965-139802987 GGCAAGGGCTGGTTCCCTGATGG + Intronic
1001544919 5:172565104-172565126 GGCAGTACCTGGCTCCGGGAGGG + Intergenic
1003031426 6:2604497-2604519 GGCAGTGGCTGGCTATGGGAAGG - Intergenic
1003681639 6:8263439-8263461 GGAAATGGCTTGATCCTGGGAGG - Intergenic
1005210510 6:23455033-23455055 GGGAATGGCTGCCTCCTAGATGG + Intergenic
1006795135 6:36727328-36727350 GGGACTGGGTGGCTCCAGGATGG + Intronic
1006919070 6:37615656-37615678 GGCAGTGGCCAGCTCATGGATGG - Intergenic
1008584767 6:52938558-52938580 GGCAATGGCTTGCTCAGGGTGGG + Intergenic
1010026337 6:71221933-71221955 AGAAATGGCTGGTTCCAGGAAGG + Intergenic
1011411277 6:87069214-87069236 TGTAATGGCTGCCTCCTGGAAGG - Intergenic
1011744860 6:90399672-90399694 GACACTGTCTGGTTCCTGGAAGG - Intergenic
1013219654 6:108066982-108067004 GGAAATGGCTGGCTTCAAGATGG - Intronic
1015720285 6:136234578-136234600 AGTGAGGGCTGGCTCCTGGAGGG + Intronic
1017907352 6:158765876-158765898 GGCCTTGGCAGGCTGCTGGAAGG - Exonic
1018924102 6:168194634-168194656 GGCAACGCCTGGGTCTTGGAGGG + Intergenic
1019079697 6:169422008-169422030 GGCCATGGTGGGCTGCTGGAAGG - Intergenic
1019120871 6:169802304-169802326 GGGACTGCCTGGCTTCTGGAGGG - Intergenic
1019358711 7:594193-594215 GGGCTTGGCTGACTCCTGGAAGG - Intronic
1021572026 7:22075662-22075684 TGAAGTGGCTGGCTTCTGGAGGG + Intergenic
1021934210 7:25614220-25614242 GGGCAGGGATGGCTCCTGGAGGG + Intergenic
1023014857 7:35956626-35956648 GACACTGCCTGGTTCCTGGAAGG + Intergenic
1023851264 7:44151723-44151745 GGCCAAGGCCAGCTCCTGGAAGG - Intronic
1024366857 7:48530238-48530260 GGCATTGGCAGCCACCTGGATGG - Intronic
1024676534 7:51642433-51642455 GGCACTGGCTGTGTCATGGAGGG + Intergenic
1024677712 7:51652363-51652385 AGCAATGGCTGGCTGCTGTTTGG + Intergenic
1024873293 7:53991220-53991242 GCCAATGGATGGCTCCTAGAAGG - Intergenic
1025004175 7:55342567-55342589 GGCCATGGCGGGCTCCTTGGCGG - Intergenic
1025212495 7:57028078-57028100 GGCAAGGGCTGGGATCTGGAAGG - Intergenic
1025628212 7:63243204-63243226 GACACTGCCTGGTTCCTGGAAGG - Intergenic
1025659460 7:63548749-63548771 GGCAAGGGCTGGGATCTGGAAGG + Intergenic
1028608748 7:92684452-92684474 GCAAATGACTGGGTCCTGGATGG + Intronic
1028767490 7:94576339-94576361 GCCATTGGCTGGCCCCTGGAAGG + Intergenic
1029493123 7:100883000-100883022 GCCACCGGCTGGCTCCTGGCTGG - Intronic
1029675636 7:102066529-102066551 GGCAAGGGCTGGGATCTGGAAGG - Intronic
1029865682 7:103625554-103625576 GGAAATGGCAGGCTCATGGTAGG + Intronic
1032584308 7:133132246-133132268 GGCAATGGCTGGGTCCTCCCTGG + Intergenic
1035527895 8:328160-328182 GGCAATGGCTAGCTTCTGAAAGG - Intergenic
1037128268 8:15376410-15376432 AGCAATGGCTGATTCCAGGATGG - Intergenic
1040542885 8:48375623-48375645 TGCCATGCCTGCCTCCTGGAAGG - Intergenic
1040544869 8:48391183-48391205 GGTAATCGCTGGAGCCTGGAAGG + Intergenic
1041583888 8:59494518-59494540 AGCTCTGGCTGGCACCTGGAAGG - Intergenic
1043543759 8:81292500-81292522 GGCATTGGCTGTGTCCTGCAAGG + Intergenic
1046734710 8:117764837-117764859 GGCAATGATTGGTTCCTTGATGG - Intergenic
1047802859 8:128328082-128328104 CGCAATGGCTGGCACATAGAAGG + Intergenic
1049193015 8:141299166-141299188 AGCACTGGGTGGCTTCTGGAAGG + Intronic
1049209476 8:141378892-141378914 GGTAAGGGCTGGGTCCTGGCAGG - Intergenic
1049600109 8:143503726-143503748 GGGGATGGCTGGGTGCTGGAGGG - Intronic
1049649849 8:143760859-143760881 GGCGATGACCGGCTCCTGGGAGG - Intergenic
1049746292 8:144264685-144264707 GGCAGGGGCTGGCCCCTGGGCGG - Intronic
1049796990 8:144501396-144501418 GGCAAAAGCTGGCCCCTGCAGGG - Intronic
1051691545 9:19718380-19718402 GACAATGGCTGGAGCCTGGGAGG - Intronic
1052784927 9:32819542-32819564 GCCAAAGGCTGGCTGCTTGAGGG - Intergenic
1054713359 9:68533332-68533354 GGGACTGGCTGACACCTGGAAGG - Intergenic
1054722283 9:68616067-68616089 GGGAATTGCTGGAACCTGGAAGG + Intergenic
1056113713 9:83421688-83421710 GGCAACTGCTGGCTCCAGGGAGG - Intronic
1056501810 9:87217060-87217082 GCCAGTGGCTTGCTCCTGGCTGG + Intergenic
1056598295 9:88025698-88025720 GACAATAGCTGCATCCTGGAGGG - Intergenic
1057909294 9:99005344-99005366 AGGAGTGGCGGGCTCCTGGAGGG + Intronic
1059430695 9:114248545-114248567 GGGCATGGCTGGCTCCTCTAGGG - Intronic
1059897366 9:118881790-118881812 GGCAATGACTGGCTGCTACAAGG - Intergenic
1061117822 9:128625794-128625816 GGCAATGCCTTCCTGCTGGAAGG - Exonic
1062282003 9:135756370-135756392 GTCCCTGGCTGGCTCCTGGGTGG + Intronic
1185854198 X:3519127-3519149 GGCAAAGGCGGGGTTCTGGAAGG + Intergenic
1189192624 X:39123543-39123565 GGCAATGTTTGGCTCCAGGTAGG + Intergenic
1191604328 X:63044697-63044719 TGGAATGGCTCCCTCCTGGAAGG + Intergenic
1191692207 X:63952297-63952319 GGCAATGGATTGCTCCTGCAGGG + Intergenic
1192203436 X:69081468-69081490 GGCAGGGGCTGGCTCCTGGCTGG + Intergenic
1192397864 X:70801473-70801495 TGTAATGGCTGCTTCCTGGAAGG - Intronic
1195438588 X:104874863-104874885 GGCAGATACTGGCTCCTGGAAGG + Intronic
1195543268 X:106087222-106087244 GCTAATCCCTGGCTCCTGGATGG - Intergenic
1199837136 X:151602604-151602626 GACAATGGCTTGAACCTGGAAGG + Intronic
1200364208 X:155644466-155644488 GCCAATACCTGGCTCCTGGATGG - Intronic
1201190847 Y:11440911-11440933 GGCAAGGGCTGGGCCCAGGATGG - Intergenic