ID: 1141482835

View in Genome Browser
Species Human (GRCh38)
Location 16:84318321-84318343
Sequence CTGGCTCCTGGATGGCCCTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 548
Summary {0: 1, 1: 0, 2: 6, 3: 71, 4: 470}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141482828_1141482835 6 Left 1141482828 16:84318292-84318314 CCGAAACCTCGATGGCTTGGTGG 0: 1
1: 0
2: 0
3: 7
4: 47
Right 1141482835 16:84318321-84318343 CTGGCTCCTGGATGGCCCTGAGG 0: 1
1: 0
2: 6
3: 71
4: 470
1141482830_1141482835 0 Left 1141482830 16:84318298-84318320 CCTCGATGGCTTGGTGGCAATGG 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1141482835 16:84318321-84318343 CTGGCTCCTGGATGGCCCTGAGG 0: 1
1: 0
2: 6
3: 71
4: 470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141482835 Original CRISPR CTGGCTCCTGGATGGCCCTG AGG Exonic
900109026 1:997929-997951 CTGTGTCCTGGAGGGCCCAGGGG + Intergenic
900250328 1:1665453-1665475 CTGGCTCCCGGTGGACCCTGGGG + Exonic
900302892 1:1986748-1986770 CTGGGGCCTGGAGGGCACTGGGG - Intronic
900404957 1:2488771-2488793 CTGTCCTCTGAATGGCCCTGGGG - Intronic
900783334 1:4631971-4631993 CTGGCTCCTGGAGGGTCCAGAGG + Intergenic
900999867 1:6143535-6143557 CTGGCCCTGGGTTGGCCCTGAGG - Intronic
901210749 1:7524775-7524797 CAGGATCCTGGAGGGCCCGGTGG + Intronic
901319376 1:8330260-8330282 CGGGCTTCGGGAGGGCCCTGGGG + Exonic
901473316 1:9472627-9472649 CTGGTTCCAGGATGGGCCTGAGG - Intergenic
902221244 1:14967264-14967286 GTGGCTCCTGGATGTGCCTATGG + Intronic
902626799 1:17681401-17681423 CTGGATCCTGGATGGCATTTGGG - Intronic
902722976 1:18316361-18316383 GTGGTTTCTGGAAGGCCCTGAGG - Intronic
902796904 1:18806084-18806106 CTCACTCCTGGATGACCCCGGGG - Intergenic
902873731 1:19328840-19328862 CTGTCTCCTGAGAGGCCCTGGGG - Exonic
903673151 1:25048177-25048199 CTGGCCCCTGCCTGTCCCTGAGG - Intergenic
903846592 1:26282783-26282805 CTGGCTCCTGCACAGCCCAGAGG + Exonic
904300682 1:29551416-29551438 CTGGTCCCTGCATGGCCCTTTGG + Intergenic
904689575 1:32283660-32283682 CTGGGTCATGGAGGGGCCTGGGG + Intronic
904771711 1:32884716-32884738 CTTGCCACTGGAGGGCCCTGGGG + Intergenic
905497489 1:38404037-38404059 CTGGCTCCAGGCTGGTACTGGGG - Intergenic
906063506 1:42963333-42963355 CTGCCTCCAGGATGTCCCTCTGG + Intergenic
907451174 1:54546871-54546893 ATGGCCCATGGATGGCCCTGAGG - Intronic
908175048 1:61547301-61547323 CTGGCTCCAGGCTGGTACTGGGG + Intergenic
909081451 1:71117490-71117512 CTCTCTCTTGGTTGGCCCTGGGG - Intergenic
911146219 1:94554894-94554916 CAGGCTCCGGGATGGCCATGGGG - Intergenic
911678844 1:100691342-100691364 CTGGCTCCAGGCTGGTACTGGGG + Intergenic
912497009 1:110098297-110098319 CTGGCTCCTCTAGGCCCCTGGGG + Intergenic
912569869 1:110613559-110613581 ATAGCCCCTGGCTGGCCCTGTGG - Intronic
912744211 1:112231658-112231680 CTGGCTCCTGCATGGCCTTTGGG + Intergenic
913143192 1:115962256-115962278 CTGGCTCCGGGCTGGTACTGGGG - Intergenic
915005434 1:152630661-152630683 CTGGCTCCTGCATGGCATTCTGG + Intergenic
915163658 1:153936291-153936313 CTGGCCCCTGGCAGGTCCTGGGG + Intronic
916690211 1:167183054-167183076 CTGAGTCAGGGATGGCCCTGTGG - Intergenic
917647724 1:177045482-177045504 CTGGCTCCTAGATAGCTCTGAGG + Intronic
917840118 1:178970561-178970583 CTTGCTCCTGGAAGGCCAGGTGG + Intergenic
918010236 1:180580154-180580176 CTGGAGCTTGGATGACCCTGTGG + Intergenic
919796048 1:201322209-201322231 CAGGCTCCAGGAGGGCCCAGAGG - Intronic
919922997 1:202177409-202177431 CTGACCCCTGCAGGGCCCTGGGG - Intergenic
920032880 1:203048131-203048153 CTGGTGCCAGGGTGGCCCTGGGG - Intronic
920074171 1:203324945-203324967 CTGCCTTCGGGTTGGCCCTGAGG + Intergenic
920177929 1:204114720-204114742 CTGGCTCCTGCCTGGCCTTAGGG + Intronic
920501799 1:206490288-206490310 CTGCCTCCTGAAGGGCCCTAAGG - Intronic
921075210 1:211695110-211695132 GTGGCTTCTGGATGGTCCAGAGG - Intergenic
921358079 1:214305321-214305343 CTGGCTCCAGGAGGGCGCTGAGG - Intronic
921546681 1:216482319-216482341 CATCCTCCTGGGTGGCCCTGAGG - Intergenic
922702157 1:227768122-227768144 CTGGATACTGGATGGTGCTGAGG - Intronic
922769911 1:228176154-228176176 CACGCTCCTGGAGGGCTCTGAGG - Exonic
923661687 1:235962592-235962614 CTGGCTCCAGGCTGGTACTGGGG - Intergenic
923874759 1:238035104-238035126 CTGGCTCCGGGCTGGTACTGGGG - Intergenic
924441367 1:244087996-244088018 CTGTCTCCTGGAGGCCCCAGGGG + Intergenic
924715282 1:246566937-246566959 CCGGCTCCTGGAGGAGCCTGCGG + Intronic
1064119278 10:12605225-12605247 CTGGCTCCATGAAGGCCATGAGG + Intronic
1064577828 10:16763685-16763707 CTGGCTCCTGGTCACCCCTGAGG - Intronic
1064720872 10:18227305-18227327 CTGGTTGCTGGATGGCCAGGGGG + Intronic
1065288828 10:24210092-24210114 CTGGCCCCTGCATGAACCTGAGG - Intronic
1065740878 10:28795989-28796011 CTGTTTCCAAGATGGCCCTGGGG + Intergenic
1067087287 10:43249659-43249681 CTGGACCCTGGCTGGCCCTGGGG + Intronic
1067306529 10:45069773-45069795 ATGGAGCCTGGATGGCCCTCGGG - Intergenic
1067414158 10:46091262-46091284 GTGGCTCCTGGAGGGCCTGGGGG + Intergenic
1067764440 10:49074624-49074646 CTGGCTCCTGGAGGTGCATGGGG + Intronic
1067804053 10:49381247-49381269 TGGGCGCCTGGATGGCCCTCGGG - Intronic
1068577263 10:58698331-58698353 CTGGTACCTGCAAGGCCCTGAGG - Intronic
1069592701 10:69651820-69651842 CTGGCTCCTGGGTGGACATGTGG + Intergenic
1070890865 10:79941472-79941494 CTGGCACCTGGACTTCCCTGGGG + Exonic
1070983792 10:80670997-80671019 GTAGCTCCAGCATGGCCCTGGGG - Intergenic
1075546470 10:123358819-123358841 CTTCTTCCTGGATGGCCCGGGGG - Intergenic
1075580732 10:123616183-123616205 CTGGTTCATGGATGGCACTCTGG - Intergenic
1075785148 10:125044223-125044245 CAGGCTCCTGGATGAGCCTGTGG - Intronic
1075926322 10:126254410-126254432 CTGGCTCCAGGAAGAACCTGCGG + Intronic
1076170853 10:128318692-128318714 CTGGCTCCTGACTGCCCCTCTGG + Intergenic
1076211279 10:128646970-128646992 TTGGAACCTGGAGGGCCCTGCGG + Intergenic
1076591157 10:131584555-131584577 CTGGCTGCGGGCTGTCCCTGGGG - Intergenic
1076643971 10:131938759-131938781 GTGGTCCCTGCATGGCCCTGTGG + Intronic
1076757389 10:132579607-132579629 CTGGCTCCAGCCTTGCCCTGCGG + Intronic
1076800616 10:132826360-132826382 CTGGCTCCTGCCTGGCTCCGTGG - Intronic
1076800640 10:132826474-132826496 CCGGCTCCTGCCTGGCTCTGTGG - Intronic
1077015296 11:396602-396624 CTGCCCCCTGGATGTGCCTGTGG - Exonic
1077050793 11:565893-565915 CTGGCTTCTGGGGAGCCCTGTGG - Intergenic
1077380882 11:2236844-2236866 CTGGCTTCTGCTGGGCCCTGTGG - Intergenic
1077401086 11:2357818-2357840 CTGGCTTCTGCTGGGCCCTGTGG - Intergenic
1077497221 11:2892161-2892183 TTGGCTTCTGGCTGCCCCTGCGG - Intronic
1077914101 11:6600033-6600055 CTGGTTCCTGGTGGACCCTGAGG - Exonic
1078085915 11:8232983-8233005 CTGGCACCTAGAGGACCCTGTGG + Intronic
1078288662 11:9983770-9983792 CTGGCTCCAGGCTGGTACTGAGG - Intronic
1078730355 11:13968301-13968323 CTGGTTCCTGGATGGCCTTATGG - Intronic
1078801202 11:14644839-14644861 CTGGCTGCCTGCTGGCCCTGGGG + Exonic
1079110563 11:17602865-17602887 CTGTCTCCTCGATGGGACTGTGG - Intronic
1079124964 11:17712566-17712588 CTGGCTTCTGGAAAGACCTGAGG - Intergenic
1080554388 11:33402710-33402732 CTGGCTCCTGAATTCCCCCGTGG + Intergenic
1080750254 11:35144194-35144216 CTGCCTCCTGGCTGGGGCTGGGG + Intronic
1081400757 11:42640013-42640035 CTGGCTAGGGGATGGCACTGGGG - Intergenic
1081681444 11:45008275-45008297 CTGGCTCCAAGATGACCCAGTGG + Intergenic
1082652018 11:55805810-55805832 CTGGATTCTGGATGTTCCTGGGG - Intergenic
1082706864 11:56503060-56503082 CTGTCTCCTGCCTGCCCCTGGGG - Intergenic
1082789149 11:57335496-57335518 CGGGCTCCTGGCAGACCCTGGGG - Intronic
1082803732 11:57433091-57433113 CTGCCTCCCTGATGCCCCTGAGG - Intergenic
1082996048 11:59256425-59256447 CTGGCTGGTGGGTGGGCCTGCGG - Intergenic
1083089946 11:60189513-60189535 ATGGCAGCTGGATGGCCCTCGGG - Intergenic
1083119997 11:60502349-60502371 CTGGCTCCTGGATTCTCCTTTGG - Intronic
1083269224 11:61562904-61562926 CTGGCTGCTGGGATGCCCTGGGG + Intronic
1084177891 11:67433047-67433069 GTGGCACCTGGCTGGCCCAGGGG + Intronic
1084703734 11:70804033-70804055 CGGGCCCCAGGGTGGCCCTGGGG - Intronic
1084962070 11:72721988-72722010 CTGGCCCCTGGGTGGGTCTGAGG + Intronic
1085255168 11:75168601-75168623 CTGGATTGTGGAGGGCCCTGGGG - Intronic
1085777162 11:79377347-79377369 CTGGCTAGTGGATGGTTCTGAGG + Intronic
1086455427 11:86955358-86955380 CTGGCTGCTGGCTGGCCTCGCGG - Exonic
1086824195 11:91475362-91475384 CTGTCTGCTGGATTTCCCTGAGG + Intergenic
1088626839 11:111735700-111735722 ATGGCTCCCTGAGGGCCCTGAGG + Intronic
1088850117 11:113697335-113697357 CTGGCTCCTGGTCTGCCATGAGG - Exonic
1089337459 11:117734925-117734947 CTGGCTGCTGGTTGGGCCTGTGG + Intronic
1091306273 11:134538221-134538243 CTGGGTCCTTGAGGGCCATGAGG + Intergenic
1091596230 12:1880905-1880927 CAGGCTCTTGGAGGCCCCTGTGG + Intronic
1093488668 12:19680977-19680999 CTGGCTCTGGGTTGGTCCTGGGG + Intronic
1094644041 12:32303704-32303726 CTGGCTCCTGGATGACCTCATGG + Intronic
1094807409 12:34106861-34106883 CTGTGTCCTGGAGGGACCTGCGG + Intergenic
1096078821 12:48820453-48820475 CTGGCTCCTTGCTCTCCCTGAGG + Intronic
1096503803 12:52080801-52080823 CAGGGGCCTGGGTGGCCCTGGGG + Intergenic
1096627235 12:52903521-52903543 CTGGCTCCTGGGAGGCATTGTGG - Intronic
1096881944 12:54680426-54680448 CTGGCTCCTGGCTGAACGTGGGG + Intergenic
1098529204 12:71521378-71521400 CAGGCTGCTGGATGACCCTGTGG - Intronic
1099369782 12:81814835-81814857 CTTGCTCCTGGATGACTCTTGGG + Intergenic
1102033683 12:109759102-109759124 CTACCTCCTGGATCCCCCTGCGG - Intronic
1102916681 12:116759661-116759683 CTGGCTCCAGGCTGGTACTGGGG + Intronic
1104504445 12:129318443-129318465 CTGGCTCCGGGCTGGTACTGGGG + Intronic
1104784953 12:131443438-131443460 CGGCCACCTGGAGGGCCCTGGGG - Intergenic
1104906535 12:132216456-132216478 CTGGCTCCTCGCTGGGCCTGCGG - Intronic
1104980683 12:132571978-132572000 CTGGCTGCTGGGTCGCGCTGGGG - Intronic
1105308961 13:19189516-19189538 CTGGCTCCTGGTGGCCCCTGGGG + Intergenic
1105528639 13:21198635-21198657 CTGGCTCCTGGTGGCCCCTGGGG - Intergenic
1105990361 13:25614802-25614824 CTGGCTCCAGGCTGCCACTGGGG + Intronic
1106562300 13:30857226-30857248 ATGGGTCCTGCATGGCTCTGTGG - Intergenic
1107276846 13:38688053-38688075 CTGGCTCCTCCAGGGACCTGCGG - Exonic
1108701397 13:52947522-52947544 TTGGCTCCTGGATGCCAGTGGGG + Intergenic
1109826337 13:67727258-67727280 CTGACTCCTGGAAGGCACTCTGG - Intergenic
1113784777 13:112996728-112996750 CAGGCTCCTGGTGAGCCCTGTGG + Intronic
1113991729 14:16033020-16033042 CTGTCTCCTGGCTGGCCCCTGGG + Intergenic
1114663534 14:24366144-24366166 CTAGCATCTGGAAGGCCCTGAGG - Intronic
1115520695 14:34230514-34230536 CTGCCTGCTGGATGGCCAAGGGG - Intronic
1116056881 14:39874860-39874882 CTGGCTCATAGATGGCACTTTGG - Intergenic
1118835629 14:69475833-69475855 CTCTCTCCTGGGTTGCCCTGGGG + Intergenic
1119108466 14:71947194-71947216 CTGACTCCTGGGTCTCCCTGTGG + Intronic
1119328254 14:73775035-73775057 GTGACTCCTGGCTGGCCCTGTGG + Intronic
1120764030 14:88311979-88312001 CTGGCTCCTGAATGTGACTGGGG + Intronic
1121041389 14:90751888-90751910 CTGACTCCTGCATGGACCTTGGG - Intronic
1121491150 14:94361985-94362007 CTGGATCTTGGATGGCCATGGGG - Intergenic
1121492545 14:94370466-94370488 CTGGATCTTGGATGGCCACGGGG - Intergenic
1121789024 14:96685014-96685036 CTGGGAACTGCATGGCCCTGTGG + Intergenic
1121817469 14:96939727-96939749 CTGACTCCTCTCTGGCCCTGGGG - Intergenic
1121820011 14:96958669-96958691 CTGGCTCCTGGATTTGCCTTGGG + Intergenic
1121908492 14:97768537-97768559 CTGGCTGAAGGATGGCCATGTGG + Intergenic
1122132452 14:99612766-99612788 CTGGCCCCCGGGTTGCCCTGGGG + Intergenic
1122205761 14:100147183-100147205 CTGGCTGCTGGAGGGCCTGGTGG + Intronic
1122297328 14:100712836-100712858 CTCCCTGCTGGGTGGCCCTGGGG - Intergenic
1122411876 14:101529700-101529722 CTGGCTCCTAGAAGGCACAGGGG + Intergenic
1122412522 14:101533168-101533190 CTGGCTCCTAGAAGGCCCAGGGG + Intergenic
1122786412 14:104166200-104166222 GTGGCTCCAGGATGGCTCTAGGG + Intronic
1122804681 14:104250429-104250451 TTGGGTCCTGCATGGTCCTGCGG + Intergenic
1122829978 14:104391140-104391162 CCGGCTCCAGGGAGGCCCTGAGG + Intergenic
1125384096 15:39118029-39118051 CTTGCTCCTGAATGACTCTGGGG + Intergenic
1125578442 15:40770039-40770061 CTGGCTCCTATATGTCTCTGGGG - Intronic
1126709893 15:51443769-51443791 CAGGCTCCAGGATGGCCCCAAGG - Intergenic
1127538904 15:59917915-59917937 CAGGGTCATGGAGGGCCCTGGGG + Intergenic
1128255245 15:66191420-66191442 CTGGCACCAGGATGCCTCTGGGG + Intronic
1128506609 15:68277568-68277590 CTGGCCCCTAAACGGCCCTGAGG - Intergenic
1128555763 15:68630734-68630756 CTGGGTCCTTGATGGCACTGTGG - Intronic
1128617775 15:69123627-69123649 CTGGCTCATGGACCGTCCTGAGG + Intergenic
1128728547 15:70005614-70005636 CTGGGTCCTCGATGGCATTGTGG - Intergenic
1129054574 15:72809836-72809858 GTGGCTTCTGGAAGGCCTTGTGG + Intergenic
1129522197 15:76192948-76192970 GTGGCTCCTGGATGAAGCTGGGG - Intronic
1129718733 15:77866325-77866347 CTGTCTCCGAGAGGGCCCTGAGG - Intergenic
1129935063 15:79440431-79440453 TTGGCTTCTGCATGTCCCTGGGG + Intronic
1130298385 15:82662988-82663010 CCAGCTGCTGGATGGCCCTAGGG - Intronic
1130651555 15:85764879-85764901 CTGGCTACTTGATTCCCCTGAGG - Intronic
1130901098 15:88207246-88207268 CTGCCTCCAGGATGGCACTGCGG + Intronic
1131131614 15:89904035-89904057 CTGGCTCCTGAGAGGCCCTCCGG - Intronic
1132397028 15:101481621-101481643 CTGTCTCCTGAATGGCTCTCAGG - Intronic
1132702866 16:1229495-1229517 CTGGCTCCCGGGTGCTCCTGGGG - Intronic
1132705460 16:1241373-1241395 CTGGCTCCCGGGTGCTCCTGGGG + Intronic
1132708588 16:1256736-1256758 CTGGCTCCCGGGTGCTCCTGGGG + Intronic
1132761438 16:1510380-1510402 GTGGCTCCTGGATGGGCTCGTGG + Exonic
1132810215 16:1793641-1793663 CTGCATGCAGGATGGCCCTGAGG - Exonic
1132850306 16:2021965-2021987 CTGGCTCCAGGATGCCTCTGTGG + Intergenic
1132976156 16:2712121-2712143 ACAGCTCCTGCATGGCCCTGAGG + Intergenic
1133479374 16:6155224-6155246 TTGTCTCCTGGATGCCCCAGAGG - Intronic
1133542227 16:6767235-6767257 CTGGCTCCTAGATGACCAAGTGG + Intronic
1134407019 16:13969725-13969747 TTGGCTCTTGGATGGCACTTTGG - Intergenic
1134835350 16:17356416-17356438 CTGGCGCCTGGTCAGCCCTGGGG + Intronic
1135668238 16:24353506-24353528 CTGGATCATGGAAGGCCCTAAGG - Intronic
1136403802 16:30031807-30031829 CAGGATCGTTGATGGCCCTGTGG - Intronic
1137553933 16:49458429-49458451 TTGGCTCATGGATGCCCATGTGG - Intergenic
1138539992 16:57682286-57682308 CTGCCTCCTGGGGGTCCCTGGGG + Intronic
1139112198 16:63904911-63904933 CAGGCTCCAGGCTGGCCCTCAGG - Intergenic
1139613629 16:68075995-68076017 CTGGCTCCTGTCTGGTCCTGGGG - Intronic
1139775651 16:69315563-69315585 CTGGCTCTTCTCTGGCCCTGAGG + Intronic
1139852683 16:69960476-69960498 CTGGCTCTTTGGGGGCCCTGGGG - Intronic
1139881654 16:70183384-70183406 CTGGCTCTTTGGGGGCCCTGGGG - Intronic
1140370854 16:74412121-74412143 CTGGCTCTTTGGGGGCCCTGGGG + Intronic
1141482835 16:84318321-84318343 CTGGCTCCTGGATGGCCCTGAGG + Exonic
1141677464 16:85525154-85525176 CTGGCCCCTGGCCGGCCCAGTGG + Intergenic
1142129978 16:88428010-88428032 GTGGCTCCTGGAAGCACCTGTGG - Exonic
1142270711 16:89088075-89088097 TGGCCTCCAGGATGGCCCTGGGG - Intergenic
1142283757 16:89162598-89162620 CCGGCTCCTGAAGGGCCTTGAGG - Intergenic
1142363598 16:89638488-89638510 ATGGCTCCTGGTTGGACGTGGGG + Intergenic
1143078685 17:4366083-4366105 CCGGCTCTTGGAGGGCACTGGGG - Intronic
1143484486 17:7246030-7246052 ATGGCTCCTGTAAGCCCCTGGGG + Exonic
1144495954 17:15744991-15745013 CAGGCCCATGGAGGGCCCTGGGG + Intronic
1144904194 17:18626621-18626643 CTGGGTGCTGCATGTCCCTGTGG - Intergenic
1145034891 17:19534053-19534075 CTTGGTCCTGGCTGGCCCCGCGG + Exonic
1145749703 17:27346524-27346546 CTGGCTCCTGAATGACCGTGTGG + Intergenic
1146058935 17:29594389-29594411 CTGGCTGCTGGAAGGACTTGAGG + Intronic
1146481400 17:33207841-33207863 CTGGCTCCTGGAGATCCCAGTGG + Intronic
1146706409 17:35003744-35003766 CTTACTCCTGGATGGCGGTGGGG - Intronic
1147663659 17:42131116-42131138 CTGGTCCCTGAATGGCCATGAGG - Intronic
1148437468 17:47694858-47694880 CTGGCACTTAGATGGGCCTGTGG + Intronic
1148759681 17:49993305-49993327 CTGGCCACTGAAGGGCCCTGCGG - Intronic
1149664769 17:58357909-58357931 CTGGCTCAGGGAGGGCCCTGGGG + Exonic
1150539017 17:66076894-66076916 CTGGCTCCGGGCTGGTACTGGGG - Intronic
1151052606 17:70995614-70995636 CTGCCTCCTGACTGACCCTGGGG + Intergenic
1152186118 17:78857314-78857336 CTGGTCCCTGGAGAGCCCTGAGG - Intronic
1152337524 17:79706995-79707017 CTGGCTCCTCCAGGGCCCTCAGG + Intergenic
1152710351 17:81868109-81868131 CAGCCTCCTGGATGGTACTGAGG + Exonic
1152787219 17:82254901-82254923 CTGGCTTCTGGAGGCCCCGGCGG - Intronic
1153079838 18:1210051-1210073 CAGGCTCCAGGATGGTACTGGGG + Intergenic
1155357390 18:24966439-24966461 CTGGATCCTTGATGGCATTGTGG + Intergenic
1157329505 18:46693049-46693071 CTGCCTCCTGACCGGCCCTGGGG + Intronic
1157592396 18:48843519-48843541 CCAGCCCCTAGATGGCCCTGAGG + Intronic
1157606908 18:48931750-48931772 ATGGCTCCTGCAAGGCCATGTGG + Intronic
1157716814 18:49893689-49893711 CTGGCCCCTGGAGATCCCTGGGG + Intronic
1158002679 18:52637009-52637031 CTGGCTCCAGGCTGGTACTGGGG - Intronic
1158692051 18:59669571-59669593 GTGGCTCCAGGCTGTCCCTGTGG + Intronic
1160680597 19:410247-410269 CCGGCTCCGGGTTGGTCCTGGGG - Intergenic
1160723191 19:605923-605945 CTGGCCCCTTAATGTCCCTGGGG + Intronic
1161007909 19:1945454-1945476 CGTGCTCCTGGGTGGCCCAGCGG + Intronic
1161282735 19:3454534-3454556 GTGGCTGCTGGATGGCCCCTCGG + Intronic
1161992159 19:7690215-7690237 CCGGCTCCTGGATTGGCCTTCGG - Exonic
1162115843 19:8428966-8428988 CTGGCTCCTAGGTGGGCCAGGGG - Intronic
1162273261 19:9633399-9633421 CTGGGAGCTGGATGGCCCTTGGG - Intronic
1162830585 19:13282021-13282043 CTGGCTCCTGGAGGCCCCTGGGG + Intronic
1163271716 19:16258554-16258576 CTGTCCCCTGGGTGTCCCTGAGG + Intergenic
1163450998 19:17377399-17377421 CTGGCTCCTTCCTGGCCCGGAGG + Intergenic
1163510645 19:17733187-17733209 CCGGCTGCTGGCTGACCCTGCGG - Exonic
1163551426 19:17967988-17968010 CTGGCTCCTGGGCGGCCCATGGG + Intronic
1163699416 19:18779871-18779893 CTGGCTCCTGGCTGGGCCCCGGG - Exonic
1164513860 19:28917965-28917987 CAGGCTCCTCTCTGGCCCTGGGG + Intergenic
1164941550 19:32255184-32255206 CTGGCTCCTGGATGGACCATTGG + Intergenic
1165108721 19:33489016-33489038 CTGGCTGGTGACTGGCCCTGGGG - Intronic
1165158989 19:33804897-33804919 CTGTCTCGTGGATGGGCATGGGG - Intronic
1166706753 19:44912343-44912365 CAGGCTCCAGGATGTCTCTGTGG - Intergenic
1167299784 19:48671907-48671929 CTGGAACCTGGGTGGCTCTGGGG + Intronic
1168155482 19:54471712-54471734 CTGGCTCCTGAATCTCCCTCCGG - Intronic
925093368 2:1173095-1173117 GTGGTCGCTGGATGGCCCTGGGG - Exonic
925132144 2:1501744-1501766 CTGGCTCCTGGTGGGTCCTGGGG - Intronic
925196253 2:1928533-1928555 GTGCCTCCTGGGAGGCCCTGGGG - Intronic
927182294 2:20455241-20455263 CTGGCTTCTGGCTGGCAATGAGG - Intergenic
927240900 2:20918832-20918854 CTGGCTGCGGACTGGCCCTGTGG + Intergenic
927672682 2:25082270-25082292 CTGGCTCCTGGCTTGGCCTGTGG - Intronic
928181508 2:29071666-29071688 CTGGCTCCTGGGTTTCCTTGGGG + Exonic
929433837 2:41911513-41911535 CTGCCTCCAGGATGGCCACGCGG - Intergenic
929576558 2:43056170-43056192 CTGGCACCTGGCTGGCCCACTGG - Intergenic
929792538 2:45034267-45034289 CTGACTCCTGGCTGGCATTGGGG - Intergenic
930693864 2:54391364-54391386 CTGGCACCAGGGTGACCCTGGGG + Intergenic
930947417 2:57092230-57092252 CTGGCTCCCTGATGGCACTTGGG - Intergenic
931461062 2:62450529-62450551 CAGGCTTCTGGATGGTGCTGAGG + Intergenic
931525154 2:63145056-63145078 CTGGCTCCAGGCTGGTACTGGGG + Intronic
931632063 2:64310661-64310683 CTGGCTCATTGAGTGCCCTGGGG + Intergenic
931979575 2:67680095-67680117 CTGTCTCCAGGAAGGCCCTGTGG - Intergenic
932424254 2:71619301-71619323 AGGGCTGCTGGATGGCCCTGGGG - Intronic
932563370 2:72890971-72890993 CTGGTGCCTGGTTGGCTCTGGGG + Intronic
932813564 2:74844017-74844039 CTGGATTCTGGCTTGCCCTGGGG - Intronic
932948465 2:76265149-76265171 CTGGCCCCTGGCTGCCTCTGCGG - Intergenic
933389368 2:81651407-81651429 ATGGAAGCTGGATGGCCCTGGGG + Intergenic
933524399 2:83416931-83416953 CTGGGCCCTTGAGGGCCCTGGGG + Intergenic
933977178 2:87520863-87520885 CTGACTCCTGATGGGCCCTGAGG - Intergenic
934117853 2:88813031-88813053 CTGGCTCATGGAGGGCCCCAGGG + Intergenic
935105088 2:100035016-100035038 CTGCCTCCTTGGTGGCCTTGAGG - Intronic
936316639 2:111429942-111429964 CTGACTCCTGATGGGCCCTGAGG + Intergenic
936556289 2:113500570-113500592 CTGGCTCTAGGAGGGCCCTGCGG - Exonic
937236046 2:120432481-120432503 CTGCCTCCTGGCTCTCCCTGAGG + Intergenic
937318854 2:120948743-120948765 CTGGCACCAGGGTTGCCCTGTGG - Intronic
937877307 2:126835478-126835500 CAGGTTCCTGGAGGTCCCTGTGG - Intergenic
940738555 2:157480726-157480748 CAGGCTCCAGGAAGGCCCAGAGG - Intronic
940802277 2:158145797-158145819 CAGGCTCCTGGCTGGTACTGGGG - Intergenic
941068854 2:160933326-160933348 CTGGCTTCTGATTGGCTCTGTGG - Intergenic
942143677 2:173003430-173003452 CTGGCTCATATCTGGCCCTGTGG + Intronic
943302801 2:186224168-186224190 GTGGCTCCTGGATGGCATTCTGG + Intergenic
944605058 2:201345277-201345299 CTGGCCCCTGGGTGGCCCTCTGG + Intronic
944605279 2:201346862-201346884 CAGGCTCCTGGGTGTCCCTAGGG + Intronic
945825710 2:214717536-214717558 CTGGCTCCAGGTTGGTACTGGGG - Intergenic
945949940 2:216029558-216029580 CTGCCTCCAGGCTGGCCCTTGGG + Intronic
946114768 2:217451742-217451764 CTGGCTTCTGGGAGGCTCTGAGG - Intronic
947135780 2:226975502-226975524 CTGGCTTCTGGGTGGCCCGAGGG - Intronic
947586219 2:231358520-231358542 CTGGGGCCAGGATGGGCCTGGGG - Intronic
947987791 2:234463709-234463731 CTTGCTCCTGGAAGGAGCTGAGG + Intergenic
948210857 2:236192189-236192211 CTGCCTCCTGAAAGACCCTGGGG - Intergenic
948378371 2:237537027-237537049 CCAGCTCCTTGATGGCCCAGAGG - Intronic
948915957 2:241035184-241035206 CTGCCTCATGGGTGGCCCTGAGG - Intronic
1168822625 20:785847-785869 CTGGAGGCTGGATGGCCCTCCGG + Intergenic
1169077192 20:2768458-2768480 CCAGCTCCAGGAAGGCCCTGGGG - Intergenic
1169971606 20:11274977-11274999 CTGCCTCCTGAAAGGTCCTGTGG - Intergenic
1171383613 20:24752358-24752380 CAGGCTCCAGGGTGGCCCTGGGG - Intergenic
1171389567 20:24792775-24792797 CTGGCTCCCGGTTGGCTCCGGGG - Intergenic
1172025526 20:31945752-31945774 CTGGGTCCTCCATGACCCTGGGG + Exonic
1172121193 20:32599781-32599803 CTTGACCCTGGATGACCCTGAGG + Intronic
1172193296 20:33075202-33075224 CTGGCTTCTGGTTAGCCATGTGG + Intergenic
1173256928 20:41400344-41400366 GTGCCTCCTAGATGGCCTTGGGG - Intergenic
1173758333 20:45538118-45538140 CTGGCTCCTTTAAGGCCTTGAGG - Intronic
1174168911 20:48604307-48604329 CTGGGTCCTGACTTGCCCTGGGG - Intergenic
1174614734 20:51827177-51827199 CTGGCTGCCGGATTGCACTGTGG - Intergenic
1174614754 20:51827292-51827314 CTGGCTGCCGGATTGCACTGTGG - Intergenic
1175733527 20:61370243-61370265 TGAGCTCCTGGCTGGCCCTGGGG + Intronic
1175979879 20:62733241-62733263 GTGCCTCCAGGGTGGCCCTGCGG - Intronic
1176008074 20:62876919-62876941 CTAGCTCCAGTATGCCCCTGGGG - Intergenic
1176233978 20:64045643-64045665 CTGGCTGCTGGGTCGCCCTCTGG + Intronic
1176294754 21:5065506-5065528 CTTGCTCCTGGAGGGGCCAGAGG + Intergenic
1178381772 21:32115751-32115773 TTGGCTCCTGCATGCCACTGTGG - Intergenic
1178921384 21:36740985-36741007 CTGCCTCCTGGAAGGCGGTGAGG + Intronic
1178959105 21:37047703-37047725 CCGGCTCCAGGCTGGCACTGGGG - Intergenic
1179276149 21:39893542-39893564 CTGCCTCCTGGATCCTCCTGTGG + Intronic
1179421012 21:41236808-41236830 CTGGCACCTGCCTGGCCCTCCGG - Intronic
1179497041 21:41778526-41778548 CTGGCTCCAGGCAGGCCCTCCGG + Intergenic
1179862297 21:44196620-44196642 CTTGCTCCTGGAGGGGCCAGAGG - Intergenic
1180007349 21:45028833-45028855 CTGGCTTCTGGAGGTGCCTGGGG + Intergenic
1180122899 21:45765674-45765696 CTGCCTCCTGGATGGTCCCTAGG + Intronic
1180787682 22:18556160-18556182 CAGGCTCCTGGGTGGCCCTGCGG - Intergenic
1180952056 22:19724877-19724899 CTGACTCCTGTCTGCCCCTGAGG - Intergenic
1180984484 22:19896497-19896519 CTGGCTCCTGGATGGCAGAGGGG - Intronic
1181234057 22:21439146-21439168 CAGGCTCCTGGGTGGCCCTGCGG + Intronic
1181244590 22:21495685-21495707 CAGGCTCCTGGGTGGCCCTGCGG - Intergenic
1181282653 22:21730839-21730861 CTGGCTCCTCCATTGCCCAGTGG + Intronic
1182124261 22:27804954-27804976 CTGGCGGGTGGAGGGCCCTGAGG - Intergenic
1182421749 22:30251817-30251839 CTGGCTTCTCCTTGGCCCTGAGG - Intergenic
1183530122 22:38348826-38348848 CTGCCTCCTGGATGGCTCACAGG - Intronic
1184508393 22:44917786-44917808 GTGGCTCCTACAGGGCCCTGTGG + Intronic
1184689715 22:46112023-46112045 CTGGACCCTGGGTGGACCTGAGG + Intronic
1184750487 22:46483590-46483612 CTGCCTCCTGGAGTCCCCTGAGG + Intronic
1184806183 22:46796282-46796304 CTGGCTCCTGGATAGCCTGAGGG + Intronic
1184858722 22:47161063-47161085 CTGCCTCCCAGCTGGCCCTGGGG + Intronic
1185026916 22:48419643-48419665 CAGTCACCTGGATGGCCCTAGGG + Intergenic
1185105295 22:48865920-48865942 CTGGGACCTGCCTGGCCCTGAGG + Intergenic
1185384161 22:50524175-50524197 GTGGGGCCTGGCTGGCCCTGAGG - Exonic
949145195 3:691221-691243 CTCTTTCCTGGTTGGCCCTGAGG - Intergenic
950478568 3:13229744-13229766 TTAGCTCCTGGATGGACCTGGGG - Intergenic
951957496 3:28273350-28273372 CTAGCTCCTGAATGGCTCCGGGG - Intronic
953025459 3:39142402-39142424 CTGGCTCCTAGATGGCTCTGTGG - Exonic
956017430 3:64898434-64898456 CTGGCTCCTGGAGGATCTTGTGG - Intergenic
959279833 3:104323820-104323842 CTGGCTCCAGGCTGGTACTGGGG - Intergenic
959436197 3:106317737-106317759 CTGGCTCCAGGCTGGAACTGGGG - Intergenic
959611322 3:108298119-108298141 CTGGCTCTTGGATAGCCCCTGGG - Intronic
961302483 3:125931054-125931076 CTGGCTCCTGGATGGGATTCAGG - Intronic
961371477 3:126434410-126434432 CTGTGTCCTGGCTGGCCCTGAGG + Intronic
961556037 3:127697202-127697224 AGGGCTCCTGGCTGACCCTGGGG - Intronic
961647554 3:128400599-128400621 CTGGCCCCTTTGTGGCCCTGTGG - Intronic
961653181 3:128427579-128427601 CAGTCTTCTGGATGGCACTGTGG - Intergenic
961820430 3:129572980-129573002 CTGGCTCTAGGGTGGCCGTGGGG - Intronic
962603453 3:137012303-137012325 CTGGCTCCTGGTTTGCCCAGAGG - Intergenic
965984748 3:174737092-174737114 CTGGCTCCTGCCAGGCCATGGGG + Intronic
966378928 3:179323691-179323713 CTGGGTCCTCGCTGGCGCTGCGG + Intronic
967257458 3:187608632-187608654 CTGGCTCCAGGCTGGTACTGGGG + Intergenic
967721609 3:192821798-192821820 CAGGGTCCTGGAAGGTCCTGAGG + Intronic
967961759 3:194931113-194931135 CTGGCTCCTGGATCTCTCTGGGG + Intergenic
968189858 3:196659934-196659956 CTTGCTCCTGGAAGGCGCCGCGG - Exonic
968525694 4:1055550-1055572 CTGGCATCTGGAGGGCCCAGGGG + Intergenic
968561366 4:1284791-1284813 GTGCCTCCTGCATGGCCGTGTGG - Intergenic
968729694 4:2263843-2263865 CTGGGTCCTGCAGGGCTCTGTGG - Intergenic
969439065 4:7206716-7206738 CTGGCTCCTGGCTGACCCAGTGG - Intronic
969460684 4:7327235-7327257 CTGACTCCTGGGAGGCCCAGTGG - Intronic
969518650 4:7662764-7662786 GTGGCTCCTGCATGGCCATGTGG + Intronic
969526281 4:7705781-7705803 CTGGCCCCTGAATGCCCCAGAGG + Intronic
969564940 4:7971914-7971936 GTGGCCCCTTGCTGGCCCTGGGG - Intronic
969659029 4:8515628-8515650 CCGCCTCCTGCATGGCCCTCAGG - Intergenic
969764472 4:9217553-9217575 CTGGTTCCTGAATGGACCTCAGG + Intergenic
969765076 4:9222300-9222322 CTGGTTCCTGAATGGACCTCAGG + Intergenic
969765686 4:9227044-9227066 CTGGTTCCTGAATGGACCTCAGG + Intergenic
969766296 4:9231789-9231811 CTGGTTCCTGAATGGACCTCAGG + Intergenic
969766912 4:9236531-9236553 CTGGTTCCTGAATGGACCTCAGG + Intronic
969767517 4:9241278-9241300 CTGGTTCCTGAATGGACCTCAGG + Intronic
969768126 4:9246027-9246049 CTGGTTCCTGAATGGACCTCAGG + Intronic
969768729 4:9250778-9250800 CTGGTTCCTGAATGGACCTCAGG + Intronic
969769333 4:9255526-9255548 CTGGTTCCTGAATGGACCTCAGG + Intronic
969769949 4:9260272-9260294 CTGGTTCCTGAATGGACCTCAGG + Intronic
969770554 4:9265020-9265042 CTGGTTCCTGAATGGACCTCAGG + Intronic
969771169 4:9269767-9269789 CTGGTTCCTGAATGGACCTCAGG + Intronic
969772150 4:9327313-9327335 CTGGTTCCTGAATGGACCTCAGG + Intronic
969772766 4:9332059-9332081 CTGGTTCCTGAATGGACCTCAGG + Intronic
969773383 4:9336806-9336828 CTGGTTCCTGAATGGACCTCAGG + Intronic
969773998 4:9341551-9341573 CTGGTTCCTGAATGGACCTCAGG + Intronic
969774613 4:9346296-9346318 CTGGTTCCTGAATGGACCTCAGG + Intronic
969775228 4:9351041-9351063 CTGGTTCCTGAATGGACCTCAGG + Intronic
969775843 4:9355786-9355808 CTGGTTCCTGAATGGACCTCAGG + Intronic
969776454 4:9360531-9360553 CTGGTTCCTGAATGGACCTCAGG + Intronic
969777072 4:9365277-9365299 CTGGTTCCTGAATGGACCTCAGG + Intergenic
970378010 4:15478866-15478888 GTGGATTCTGTATGGCCCTGGGG - Intronic
972640058 4:40917112-40917134 CTGTCTTCTGAATGGACCTGGGG + Intronic
973000972 4:44950329-44950351 CTTTTTCCTGGATTGCCCTGAGG - Intergenic
973985538 4:56348651-56348673 CTGTCTCCTGGATCACTCTGAGG + Intronic
975957778 4:79862736-79862758 TTGGCTTCAGGATGGTCCTGGGG - Intergenic
979851170 4:125573012-125573034 CTGACTCCTGGATGGCAATCTGG - Intergenic
981626129 4:146757335-146757357 CTGGCTCCAGGCTGGTACTGGGG + Intronic
981760725 4:148192280-148192302 CTGGCTCCGGGCTGGCATTGGGG + Intronic
982075064 4:151730613-151730635 GTGGCTCCAGGCTGGCACTGGGG - Intronic
982189873 4:152843218-152843240 CTGGCTCCAGGATGGTACTGGGG + Intronic
982312090 4:153996976-153996998 CTGGCTCCAGGCTGGTACTGGGG + Intergenic
982677851 4:158396523-158396545 GTGGCTCCTGGGTGGCTATGAGG + Intronic
984537100 4:180989899-180989921 CTGGCCCTCGGATGGCCCTTTGG - Intergenic
984694687 4:182767779-182767801 CTAGCTCTGGGATGGCCCTGAGG + Intronic
985630761 5:1012793-1012815 CTGGCTCCTGGGTGGCCAGGAGG - Intronic
985773664 5:1828349-1828371 CTGGCTCCGAGGTCGCCCTGAGG + Intergenic
985805443 5:2039520-2039542 CAGCCTCCTGGAGGGCCCTCGGG - Intergenic
986748449 5:10763783-10763805 GTGGCCCCTGGACTGCCCTGAGG + Intergenic
987704327 5:21443955-21443977 CTGGCTCCGGGCTGGTACTGGGG + Intergenic
990039189 5:51358360-51358382 CCGGATGCTGGGTGGCCCTGCGG + Intergenic
990468030 5:56087803-56087825 CTGGCACCTGCAGGGCACTGAGG + Intergenic
991387019 5:66101543-66101565 CTGGCTCCAGGCTGGTACTGGGG - Intergenic
991592030 5:68262025-68262047 CAGGCTGGTGGATGGCCCAGAGG - Intronic
992856501 5:80867038-80867060 CTGGCTGCTGTCTGGGCCTGCGG + Intronic
993502590 5:88679949-88679971 CTGGCTCCTTCCTGGGCCTGGGG + Intergenic
995780701 5:115772344-115772366 CTGGCTTCTGCATGGGCATGGGG + Intergenic
996573148 5:124954339-124954361 CTAACTACTGGATTGCCCTGAGG - Intergenic
997212602 5:132086336-132086358 CTGGCTCCTGGATGGCCCCAAGG - Intergenic
999560642 5:152797776-152797798 CTGTCTCCTGCCTGCCCCTGGGG - Intergenic
1001454692 5:171851782-171851804 CTGGCACTTGGTTGGCCCTCAGG - Intergenic
1002107335 5:176886704-176886726 CTGGTTCCTGCAGGACCCTGAGG + Intronic
1002293145 5:178213192-178213214 CTGGCCCATGGAAGGCTCTGAGG - Intronic
1002450398 5:179315238-179315260 CTGGCTTCTGGAAAGCACTGAGG + Intronic
1002617944 5:180467219-180467241 CTGGCTTCTGGAAAGCCCTGGGG - Intergenic
1003033606 6:2623698-2623720 CTGGCTCCTGGCTGGCAGAGTGG + Exonic
1003063215 6:2878116-2878138 CTGGCTCCGGGCTGGTACTGGGG - Intergenic
1003403311 6:5808729-5808751 CTGGCTCCTGGTCGACCCTGGGG + Intergenic
1005729455 6:28682866-28682888 CTGTCTCCTGCTTGTCCCTGGGG + Intergenic
1005921559 6:30406373-30406395 CTGGCTCATGGATTGTACTGGGG - Intergenic
1006452871 6:34115171-34115193 CTGGCTGGTGGCTGGCCCAGAGG - Intronic
1006519021 6:34560934-34560956 CTGGCAGCTGCATGTCCCTGTGG - Intergenic
1007132344 6:39487386-39487408 TTGGGTGCTGGATGCCCCTGGGG - Intronic
1007163243 6:39809905-39809927 CTGGGTCCCTGATGGCACTGTGG - Intronic
1007398495 6:41590417-41590439 CTGCCTCCAGGAAGGTCCTGGGG + Intronic
1007752971 6:44081241-44081263 CTGCCTCCTGGAGGGCCTTTTGG - Intergenic
1008256197 6:49303187-49303209 CTGGCTCCAGGGTGGTACTGGGG - Intergenic
1008752765 6:54757296-54757318 CTGACTCCTGGAAGGCACTCTGG - Intergenic
1009933716 6:70207182-70207204 CTGGGTCCTGGGGGGCCCTGTGG - Exonic
1010986843 6:82434623-82434645 CAGGCTCATGCCTGGCCCTGTGG - Intergenic
1011263303 6:85490528-85490550 CTGGCTGCTGTATTGCCCTTTGG + Exonic
1011375458 6:86681767-86681789 CAGGCTCCAGGATGGTACTGGGG + Intergenic
1015720287 6:136234586-136234608 CTGGCTCCTGGAGGGGCCTACGG + Intronic
1016027137 6:139299163-139299185 CTGGCCCCTGGCTGCTCCTGGGG + Intergenic
1016745118 6:147571091-147571113 CTGGCCCCTGCAGAGCCCTGGGG - Intronic
1017710584 6:157163772-157163794 CTGTCTGGTGTATGGCCCTGCGG - Intronic
1017978837 6:159380828-159380850 CTGGCTGCTGGTTGGGCCTGAGG - Intergenic
1018576731 6:165267305-165267327 CTGACTCCTGGATGGACAGGAGG - Intergenic
1018661156 6:166088400-166088422 CTAGCTCCTGGAAGGCCACGTGG + Intergenic
1019353060 7:564195-564217 GTGGCTCCTGGACACCCCTGTGG + Intronic
1019593932 7:1849749-1849771 CCGGCTCTGGGAGGGCCCTGAGG + Exonic
1019814444 7:3189406-3189428 GTGGCTCCCGGAAGCCCCTGTGG - Intergenic
1020838474 7:13184677-13184699 CTGCCTCCTGAATGACCCTGGGG - Intergenic
1021230574 7:18082503-18082525 CTGGCACTGGGGTGGCCCTGTGG + Intergenic
1021841379 7:24724347-24724369 TTGGCTCCTGGCTGGACTTGGGG - Intronic
1022411091 7:30138920-30138942 CTGGCTCCTCGATGCTCCTGAGG + Intronic
1022777639 7:33544493-33544515 CTGGCTCCGGGCTGGTACTGCGG + Intronic
1023701329 7:42893960-42893982 CTGGCTCCAGACTGGCACTGGGG - Intergenic
1023844490 7:44113171-44113193 CAGGCTCCTGGATGGGCGGGAGG + Intronic
1027804813 7:82804888-82804910 CTGGGACCTGGGTGGCCCAGTGG + Intronic
1028223103 7:88219760-88219782 CCTTCTCCTGGATGGCCCTGCGG - Intronic
1029458433 7:100682551-100682573 GAGGCTCCGGGATGGCCCTGAGG - Intronic
1029462868 7:100706272-100706294 CGCGCGCCTGGAGGGCCCTGTGG + Exonic
1030196566 7:106858980-106859002 CTAGCTCCTGCAGGGACCTGGGG - Intergenic
1032339932 7:131061425-131061447 ATAGCTCCTGGATGGCCGTGTGG - Intergenic
1032436644 7:131906374-131906396 CTGGCTTCTGCATGCCTCTGTGG + Intergenic
1032496872 7:132369255-132369277 CTGGCACCTGGGTGGCTCTGGGG - Intronic
1033728414 7:144147098-144147120 CAGGCTCCTGGCTGGCCCCATGG + Intergenic
1034442755 7:151095297-151095319 CAGCCTCCTGGGTGGCCCAGAGG - Intronic
1035291275 7:157840832-157840854 CTGGCTCCTGGAGGGGTCTGAGG - Intronic
1035344682 7:158190455-158190477 CAGGCTCCTGGAAGGCTTTGGGG + Intronic
1035605312 8:926546-926568 CTGGCTCCTGGAGGGCACAGTGG + Intergenic
1036287059 8:7452232-7452254 ATGTCTCCTGGTTAGCCCTGGGG - Intronic
1036334422 8:7859290-7859312 ATGTCTCCTGGTTAGCCCTGGGG + Intronic
1036613525 8:10370796-10370818 TCGGCTCCTGGCTGGCCATGTGG + Intronic
1036693200 8:10957689-10957711 CTCACTCCTGGATGGCCAGGAGG - Intronic
1036704327 8:11035332-11035354 CTGGCTCCTGCATGGCCAGTGGG - Intronic
1037814474 8:22104549-22104571 CTGGCTCCTGGCAGGCGCTGAGG - Exonic
1038037966 8:23702476-23702498 GTGGCTGCCAGATGGCCCTGCGG + Exonic
1038328506 8:26589977-26589999 GTGGCTCCTGAATGTCACTGCGG + Intronic
1039030174 8:33300048-33300070 CAGGCTCCTGGCTGGTGCTGGGG - Intergenic
1039095486 8:33880526-33880548 CTGGCTCCAGGCTGGTACTGGGG + Intergenic
1040578498 8:48675350-48675372 CAGTCTCCTGGATAGCCTTGGGG - Intergenic
1040782360 8:51124864-51124886 CTGACCCCTGGTGGGCCCTGAGG - Intergenic
1042185790 8:66135203-66135225 CTGGCCCCAGGAAGGCCCTAAGG - Intronic
1045293257 8:100851636-100851658 CTGGCTCCTGAAAGGTGCTGAGG + Intergenic
1045779891 8:105850167-105850189 CTGGCTCCAGGCTGGTACTGGGG - Intergenic
1046379629 8:113435043-113435065 GTGGTTAATGGATGGCCCTGGGG - Intronic
1047795466 8:128250614-128250636 CTGGTTCCTGGATTGCTTTGTGG + Intergenic
1048184780 8:132229731-132229753 ATGCCTCTTGGAAGGCCCTGGGG - Intronic
1049172046 8:141167445-141167467 CTAGCTCCTGGAGGGCCCTTAGG + Intronic
1049216923 8:141412530-141412552 CTGTCCCCTGGATGGTCCAGGGG + Intronic
1049230438 8:141478845-141478867 CTGGCTCTAGCAGGGCCCTGGGG + Intergenic
1049679749 8:143912882-143912904 CTGGCTCCTGGTGGGAGCTGTGG - Intergenic
1049724060 8:144137433-144137455 CTGGCTTCTCGTGGGCCCTGAGG - Intergenic
1049896735 9:116794-116816 CTGGCTCTAGGAGGGCCCTGCGG + Exonic
1050336733 9:4596774-4596796 CTGCCACCTGGTTGGCCCTGAGG - Intronic
1050987787 9:12104669-12104691 CAGGCTCTGGGATGGCACTGCGG - Intergenic
1053739832 9:41126993-41127015 CTGGCTCTAGGAGGGCCCTGCGG + Exonic
1054442800 9:65282990-65283012 CTGGCTCTAGGAGGGCCCTGCGG + Exonic
1054487478 9:65738511-65738533 CTGGCTCTAGGAGGGCCCTGCGG - Exonic
1054688518 9:68304320-68304342 CTGGCTCTAGGAGGGCCCTGCGG - Exonic
1054867723 9:70020041-70020063 CTGGCTCCAGGCTGGTACTGGGG + Intergenic
1055662448 9:78518684-78518706 CTCACTGCTGGATGACCCTGAGG + Intergenic
1056057390 9:82841002-82841024 GTGGCTCCTCGGTGGCCCTCTGG - Intergenic
1056444610 9:86653685-86653707 CTGGCTCATGCACTGCCCTGGGG + Intergenic
1056632439 9:88304951-88304973 TTGACTCCTGGGTGGCCATGTGG - Intergenic
1057206949 9:93179155-93179177 CCGGCTCCCAGGTGGCCCTGAGG - Intergenic
1057478730 9:95427075-95427097 CTGGCTCCTGGCTGCCCCTTGGG - Intergenic
1057897350 9:98919896-98919918 CCTCCTGCTGGATGGCCCTGGGG - Intergenic
1057909297 9:99005352-99005374 CGGGCTCCTGGAGGGCGATGGGG + Intronic
1058234603 9:102474231-102474253 CTGGGGCTTGGATGGCCCTTGGG + Intergenic
1058314972 9:103554153-103554175 CAGGCTGATGGATGGCCATGTGG - Intergenic
1058774934 9:108273650-108273672 CTGCCTCTTGGAGGGCCCTGTGG - Intergenic
1059433821 9:114264918-114264940 TGGGGTCCTGGAGGGCCCTGTGG - Exonic
1059747482 9:117217239-117217261 CTGGCCCATTGATGCCCCTGGGG + Intronic
1060040116 9:120293125-120293147 CTGGCACCTGTTTGCCCCTGGGG + Intergenic
1060397716 9:123327660-123327682 CTGGGTCTGGGGTGGCCCTGGGG + Intergenic
1060523705 9:124308831-124308853 CTGGCTCCAGGATTTCTCTGAGG - Intronic
1061728746 9:132597106-132597128 CTGGCTCCTGTGTGGCTCTGGGG - Intronic
1061857277 9:133449259-133449281 CTAGCTCCAGGACGGCCCCGGGG - Intronic
1062395418 9:136350765-136350787 GGGGCTCCTGGCTAGCCCTGAGG - Intronic
1062401217 9:136373531-136373553 GTGGCTCCTGGAAGACCCTCAGG - Exonic
1062440697 9:136568009-136568031 CTGGCTCCCGGGCGGTCCTGGGG + Intergenic
1062628309 9:137452847-137452869 TTGGCTTTTGGATGGGCCTGGGG - Intronic
1185736620 X:2500817-2500839 CTGGCTCCAGGAAGCCCCCGCGG + Exonic
1186055445 X:5644725-5644747 CAGGCACCTAGCTGGCCCTGAGG - Intergenic
1187633974 X:21206098-21206120 CAGGCTCCTGTTTGGCACTGGGG - Intergenic
1188526947 X:31097400-31097422 CAGGCTCCATGAGGGCCCTGCGG + Intergenic
1189376878 X:40473542-40473564 CTGTCTAGTGGCTGGCCCTGGGG - Intergenic
1189499456 X:41542304-41542326 CTGGCTCCTGCCTGGCCCTTGGG - Intronic
1189603242 X:42649172-42649194 CTGGCTCCAGGCTGGTACTGGGG - Intergenic
1189891987 X:45612665-45612687 CTGGCGTTTGGATGGGCCTGGGG - Intergenic
1190895410 X:54613707-54613729 CTGGCTCCCGGCTGGTACTGGGG + Intergenic
1192547955 X:72029026-72029048 CTGGCTCTTGGGTGGTCCTTTGG + Intergenic
1193232574 X:79065808-79065830 CTGCCTCCTGGACCTCCCTGGGG - Intergenic
1194561629 X:95428488-95428510 CTGACTCCTGGAGGGCTCTATGG + Intergenic
1195176754 X:102320420-102320442 CTGCTCCCTGGCTGGCCCTGGGG - Intronic
1195182110 X:102366673-102366695 CTGCTCCCTGGCTGGCCCTGGGG + Intronic
1195985110 X:110621339-110621361 CAGGCTCCAGGATGGCACTGGGG + Intergenic
1196614046 X:117747034-117747056 CAGGCTCATGGATGGCCATTGGG + Intergenic
1197588972 X:128384594-128384616 CTGGCTCCAGGCTGGTACTGGGG - Intergenic
1198691523 X:139290078-139290100 CTGGGTCCTGGATGACAATGTGG - Intergenic
1199014891 X:142804031-142804053 CGGGCTCCTGGCTGGTACTGGGG + Intergenic
1199057785 X:143318691-143318713 CTGACTCCGGGCTGGCACTGGGG + Intergenic
1200153495 X:153963157-153963179 CTGCCTCTTGGCTGGCCCCGTGG - Intronic
1200236322 X:154469506-154469528 CTGGCTCCCAGGTGGCCCTGGGG - Intronic
1200364205 X:155644458-155644480 CTGGCTCCTGGATGGTACCTCGG - Intronic