ID: 1141482835

View in Genome Browser
Species Human (GRCh38)
Location 16:84318321-84318343
Sequence CTGGCTCCTGGATGGCCCTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 548
Summary {0: 1, 1: 0, 2: 6, 3: 71, 4: 470}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141482830_1141482835 0 Left 1141482830 16:84318298-84318320 CCTCGATGGCTTGGTGGCAATGG 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1141482835 16:84318321-84318343 CTGGCTCCTGGATGGCCCTGAGG 0: 1
1: 0
2: 6
3: 71
4: 470
1141482828_1141482835 6 Left 1141482828 16:84318292-84318314 CCGAAACCTCGATGGCTTGGTGG 0: 1
1: 0
2: 0
3: 7
4: 47
Right 1141482835 16:84318321-84318343 CTGGCTCCTGGATGGCCCTGAGG 0: 1
1: 0
2: 6
3: 71
4: 470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141482835 Original CRISPR CTGGCTCCTGGATGGCCCTG AGG Exonic