ID: 1141482835 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:84318321-84318343 |
Sequence | CTGGCTCCTGGATGGCCCTG AGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 548 | |||
Summary | {0: 1, 1: 0, 2: 6, 3: 71, 4: 470} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1141482828_1141482835 | 6 | Left | 1141482828 | 16:84318292-84318314 | CCGAAACCTCGATGGCTTGGTGG | 0: 1 1: 0 2: 0 3: 7 4: 47 |
||
Right | 1141482835 | 16:84318321-84318343 | CTGGCTCCTGGATGGCCCTGAGG | 0: 1 1: 0 2: 6 3: 71 4: 470 |
||||
1141482830_1141482835 | 0 | Left | 1141482830 | 16:84318298-84318320 | CCTCGATGGCTTGGTGGCAATGG | 0: 1 1: 0 2: 0 3: 8 4: 85 |
||
Right | 1141482835 | 16:84318321-84318343 | CTGGCTCCTGGATGGCCCTGAGG | 0: 1 1: 0 2: 6 3: 71 4: 470 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1141482835 | Original CRISPR | CTGGCTCCTGGATGGCCCTG AGG | Exonic | ||