ID: 1141482836

View in Genome Browser
Species Human (GRCh38)
Location 16:84318324-84318346
Sequence GCTCCTGGATGGCCCTGAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 246}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141482828_1141482836 9 Left 1141482828 16:84318292-84318314 CCGAAACCTCGATGGCTTGGTGG 0: 1
1: 0
2: 0
3: 7
4: 47
Right 1141482836 16:84318324-84318346 GCTCCTGGATGGCCCTGAGGAGG 0: 1
1: 1
2: 1
3: 26
4: 246
1141482830_1141482836 3 Left 1141482830 16:84318298-84318320 CCTCGATGGCTTGGTGGCAATGG 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1141482836 16:84318324-84318346 GCTCCTGGATGGCCCTGAGGAGG 0: 1
1: 1
2: 1
3: 26
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141482836 Original CRISPR GCTCCTGGATGGCCCTGAGG AGG Exonic