ID: 1141482836

View in Genome Browser
Species Human (GRCh38)
Location 16:84318324-84318346
Sequence GCTCCTGGATGGCCCTGAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 246}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141482828_1141482836 9 Left 1141482828 16:84318292-84318314 CCGAAACCTCGATGGCTTGGTGG 0: 1
1: 0
2: 0
3: 7
4: 47
Right 1141482836 16:84318324-84318346 GCTCCTGGATGGCCCTGAGGAGG 0: 1
1: 1
2: 1
3: 26
4: 246
1141482830_1141482836 3 Left 1141482830 16:84318298-84318320 CCTCGATGGCTTGGTGGCAATGG 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1141482836 16:84318324-84318346 GCTCCTGGATGGCCCTGAGGAGG 0: 1
1: 1
2: 1
3: 26
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141482836 Original CRISPR GCTCCTGGATGGCCCTGAGG AGG Exonic
900994366 1:6112493-6112515 ACTCCTGGGTGGTCCTGATGTGG - Intronic
901494645 1:9614028-9614050 GCTCCTTCCTGGCACTGAGGAGG + Exonic
902408293 1:16198527-16198549 GCTCCTGGATGGTCCTGGAGGGG - Exonic
902510785 1:16965922-16965944 GAACCTGGAGGGCCCTGGGGAGG + Intronic
903621702 1:24702800-24702822 GCTCCTGGAGGGGGCTGAGCAGG - Intergenic
904604572 1:31691629-31691651 TCTCCTGGCCGGCCCTGTGGGGG + Exonic
904771712 1:32884719-32884741 GCCACTGGAGGGCCCTGGGGTGG + Intergenic
905740334 1:40364779-40364801 GCACCTTGATGTCCCTGTGGAGG - Intronic
906460265 1:46031112-46031134 GTTCCCGGAGGGCCCTGAGGAGG + Exonic
907285160 1:53375510-53375532 ACCCCAGGATGGCCCTGAGGTGG + Intergenic
909074680 1:71039141-71039163 TCTGCTCGATGGCCCTGAGAAGG - Intronic
911146218 1:94554891-94554913 GCTCCGGGATGGCCATGGGGTGG - Intergenic
912633232 1:111267410-111267432 GATCCTCTATGGCCCTGGGGAGG + Intergenic
915772407 1:158441542-158441564 GCTACTGGGTGGCAATGAGGAGG - Intergenic
916031930 1:160884595-160884617 GCTTTTGTGTGGCCCTGAGGGGG - Intronic
917590826 1:176475232-176475254 GCTCCTGGCTGGCACAGAGTAGG + Intronic
919945820 1:202318467-202318489 GCTGCTGGCTGACCCTCAGGTGG - Exonic
920096094 1:203487566-203487588 CCTCCTGGCTGGGCCTCAGGAGG + Exonic
920211523 1:204332096-204332118 GCTCCTTGATTGGTCTGAGGTGG - Intronic
921043014 1:211452445-211452467 GCTCCTTGAGGGGCCTGAAGTGG - Intergenic
921075207 1:211695107-211695129 GCTTCTGGATGGTCCAGAGGGGG - Intergenic
922481217 1:225941080-225941102 GCCCCTGGCTGGCCCCGGGGCGG - Exonic
922769910 1:228176151-228176173 GCTCCTGGAGGGCTCTGAGGAGG - Exonic
1063362383 10:5469046-5469068 GCTCCTGGGTGGCTCGGACGTGG + Intergenic
1067011393 10:42717334-42717356 GCTCCTAGATTGACCTGATGGGG - Intergenic
1070744231 10:78923193-78923215 TCTCCTGGAAGGCACAGAGGTGG - Intergenic
1070779206 10:79127710-79127732 CCTCCTGCATGGCCCTGAACAGG - Intronic
1072798834 10:98377728-98377750 GTTCCTGGCTGGCCGTGAGGAGG - Intergenic
1074049852 10:109871660-109871682 GCACCTGGCTGGGCCTGAAGTGG + Intronic
1075512991 10:123087128-123087150 GCACCTTCATGCCCCTGAGGTGG - Intergenic
1076601274 10:131658523-131658545 CCTCCTGGAGGGCACAGAGGTGG + Intergenic
1080625592 11:34027940-34027962 GCTCCTGGATAGCCTTGGGATGG - Intergenic
1081237284 11:40660274-40660296 GCACCTGGATTGCCCTCAGCAGG + Intronic
1081392648 11:42547091-42547113 GCTTCTGCATGGCCCAGAGCTGG - Intergenic
1083204334 11:61139015-61139037 GCTCCTTGATCTCCCTGGGGAGG - Intronic
1083482188 11:62956517-62956539 GCCCCAGGATGCCCCTCAGGAGG - Intronic
1083752405 11:64767735-64767757 GGTCCTGGTGGGCCCGGAGGTGG - Exonic
1083843510 11:65317475-65317497 GCCCCTGGCTGGGCCTGGGGAGG + Intronic
1083911595 11:65713126-65713148 GCTCCTGGATGGGCAGGAGGCGG + Intronic
1083934677 11:65864051-65864073 GCGCCTGGATGGGCCTGTGGGGG - Intronic
1084105483 11:66977522-66977544 GTTTCTGAATGGCCCTGATGGGG - Intergenic
1084274307 11:68043856-68043878 GCTGCTGCAGGGCCCCGAGGCGG - Exonic
1084661871 11:70550808-70550830 GCTCCAGGAGGGCCCAGAGGTGG + Intronic
1089359671 11:117877344-117877366 GCTCCTGGCAGGGCCAGAGGTGG - Intronic
1089530711 11:119127070-119127092 GCACCTGCATGGCTCTGGGGAGG + Exonic
1089876539 11:121727241-121727263 TCCCCTGGACAGCCCTGAGGTGG - Intergenic
1090243364 11:125199264-125199286 GCTCCTAGACTGCTCTGAGGAGG + Intronic
1090830043 11:130414803-130414825 TCTCCTGGATGCCCCTGCTGCGG - Exonic
1090913546 11:131142662-131142684 GCTCATGGCTGGCCCAGGGGTGG + Intergenic
1091168833 11:133502860-133502882 CCTTCTGGATGGGACTGAGGAGG + Intronic
1093708060 12:22297040-22297062 GCTCCTGAATAGCACTGGGGAGG + Intronic
1094307900 12:29041463-29041485 GCTCTTGGATGGCCCTCAACAGG - Intergenic
1094465347 12:30747883-30747905 ACTCGTGGATGACTCTGAGGGGG + Intronic
1096233884 12:49912889-49912911 GCTCCTGGAGGGCGGGGAGGGGG - Intergenic
1096243832 12:49973592-49973614 GCACCTGGAGGGCCAGGAGGCGG + Intronic
1096541448 12:52309597-52309619 CCTCCAGGAAGGCCCTGGGGTGG - Intergenic
1100423496 12:94460123-94460145 GTTCCTGGAGGGCCCTGGGATGG + Intergenic
1102073019 12:110037350-110037372 TCTCCTGGATGGCCCTGGGTTGG - Exonic
1102645692 12:114402222-114402244 GCTCCGGAATGTCACTGAGGAGG + Intronic
1104226342 12:126838087-126838109 GCTGCTGGAAGGCACTCAGGTGG + Intergenic
1106218475 13:27724150-27724172 CCTCCTGGAGGGCCATAAGGAGG - Intergenic
1106788100 13:33127407-33127429 TCTCCATGATGGCCGTGAGGCGG + Exonic
1107672686 13:42762201-42762223 TCTCCTGGATGGCCCAGCAGTGG - Intergenic
1114550031 14:23527424-23527446 CCTCCTGGATGGCCCTAACAAGG + Intronic
1119637474 14:76288310-76288332 AATCCTTGATGGCACTGAGGTGG - Intergenic
1119761976 14:77158142-77158164 TCTCCTTGGTGGCCTTGAGGAGG - Intronic
1122269623 14:100562727-100562749 GCTCAGGGAAGGCCCTGAGCGGG - Intronic
1122290911 14:100679984-100680006 GCTCCAGGAGGGCCTTGTGGTGG + Intergenic
1122786558 14:104166850-104166872 GCTTCTGCATAGCCCTGGGGAGG - Exonic
1122804682 14:104250432-104250454 GGTCCTGCATGGTCCTGCGGTGG + Intergenic
1122829979 14:104391143-104391165 GCTCCAGGGAGGCCCTGAGGCGG + Intergenic
1123006961 14:105328371-105328393 GCCCCAGGAAGGCCCAGAGGAGG - Intronic
1124042636 15:26119116-26119138 GATCCTGGAAGGCCATGACGCGG + Intergenic
1125059160 15:35398277-35398299 GCTCCTGGATAGCCTTGGGATGG + Intronic
1125761967 15:42103028-42103050 GCTCCTTCCTGCCCCTGAGGAGG + Intergenic
1125886288 15:43232135-43232157 GGTCCTGGATGGCCTTGGGTTGG - Intergenic
1126564933 15:50085042-50085064 GCTAGTGGATGGCCTTGAGTAGG - Intronic
1128537538 15:68502235-68502257 GCTACTGGTTGGCTCTGAGCTGG - Intergenic
1129370321 15:75089423-75089445 ACCCCTGGTTGGCCATGAGGTGG - Intronic
1129833455 15:78685749-78685771 GCTTCTTTATGACCCTGAGGAGG + Intronic
1132410958 15:101577998-101578020 GCTCATGGAAGGACCTGAAGAGG - Intergenic
1132539711 16:503061-503083 GCTCATGGAGGGCCCAGAGGAGG + Exonic
1132871549 16:2117742-2117764 CCATCTGGATGGCCCTGGGGAGG + Intronic
1133275246 16:4634346-4634368 TTTCCTGGATGACCCTGAAGTGG + Intronic
1133334235 16:4996388-4996410 TCTCCTGCATGGGCGTGAGGTGG - Exonic
1133905797 16:10021316-10021338 CCTCCTGGATGGCCCTGTGAGGG + Intronic
1134520980 16:14919153-14919175 CCATCTGGATGGCCCTGGGGAGG - Intronic
1134550592 16:15136820-15136842 CCATCTGGATGGCCCTGGGGAGG + Intronic
1134708656 16:16317804-16317826 CCATCTGGATGGCCCTGGGGAGG - Intergenic
1134715869 16:16357837-16357859 CCATCTGGATGGCCCTGGGGAGG - Intergenic
1134950948 16:18350841-18350863 CCATCTGGATGGCCCTGGGGAGG + Intergenic
1134958887 16:18394322-18394344 CCATCTGGATGGCCCTGGGGAGG + Intergenic
1135489497 16:22896917-22896939 GCTACTTGATGGGGCTGAGGTGG - Intronic
1136550428 16:30979788-30979810 GGTCCTGGAGGCCCCCGAGGTGG + Exonic
1141482836 16:84318324-84318346 GCTCCTGGATGGCCCTGAGGAGG + Exonic
1142263922 16:89054878-89054900 CCTCCTGCATGTCCCGGAGGTGG + Intergenic
1143338346 17:6190323-6190345 GGGCCTGGACTGCCCTGAGGTGG + Intergenic
1143551381 17:7632464-7632486 GCTTATGGATGGCACTCAGGTGG + Intronic
1144604529 17:16653380-16653402 GCGCCTTGCAGGCCCTGAGGAGG - Intronic
1144665983 17:17102585-17102607 CCTCCTTAATGACCCTGAGGAGG - Intronic
1145995695 17:29103599-29103621 GCTGCTGCATGGGCCTGAGCCGG - Exonic
1146910220 17:36643651-36643673 GCCCCTGGAAGGCTCTGAGCAGG - Intergenic
1147453214 17:40519052-40519074 GCTCCTCCAAGGCCTTGAGGAGG + Intergenic
1147782901 17:42956409-42956431 GAGCCTGGATGATCCTGAGGTGG - Exonic
1148195524 17:45710058-45710080 ACTGCTGGATTGCCCTGTGGGGG + Intergenic
1148463741 17:47852067-47852089 GCGCCTGAATGGCCCTGGGAAGG + Intronic
1148464947 17:47859338-47859360 GCTCCTGGCTGGCACATAGGCGG + Intergenic
1149601898 17:57898757-57898779 GGTCCTGGAGGTCCCTGAGTGGG - Intronic
1150039921 17:61849703-61849725 GGTCCTGGATGACCTTGAGAAGG - Intronic
1152293848 17:79455374-79455396 CCTCCTGGATGACCCTCAGGTGG - Intronic
1152298761 17:79483503-79483525 GCTCCTGGATGGCCTTGGAAAGG - Intronic
1152337525 17:79706998-79707020 GCTCCTCCAGGGCCCTCAGGAGG + Intergenic
1152725712 17:81944660-81944682 GCTCCTGGACAGCCTTGGGGTGG + Intronic
1152962712 18:89315-89337 GCTCCTGGATGTCACTAGGGAGG + Intergenic
1154980306 18:21498238-21498260 GCTGCTGGATGGCTCTGGGCAGG + Intronic
1155071098 18:22317000-22317022 GGTCCTAGAGGTCCCTGAGGGGG - Intergenic
1156513728 18:37662338-37662360 GCTCCTGGCTGGCCTAGATGGGG + Intergenic
1156615699 18:38782341-38782363 GCTTCTGGAGGGGCCTCAGGAGG + Intergenic
1156674687 18:39513605-39513627 GCTTCCTGATGGCCCTGAGCAGG - Intergenic
1157604960 18:48920611-48920633 GCTCCTGGATCTCCCTGAGATGG - Exonic
1158388947 18:57027307-57027329 GCCACTGGATGGCACTGGGGTGG - Exonic
1161008942 19:1950802-1950824 CCTCCTGGATGCCCCAGAGCAGG - Intronic
1161293190 19:3506578-3506600 GCTCCTGGAGGGGCCTGAGCTGG - Intronic
1161302765 19:3551027-3551049 GCTCCGGGATGAGGCTGAGGTGG + Exonic
1162336252 19:10062232-10062254 GATCCTGGATGCCCTTGAAGGGG - Intergenic
1163262652 19:16200417-16200439 GCTCCTGGTTGGAACTGAAGTGG - Intronic
1163327818 19:16616536-16616558 ACTCCAGGATGGCCCTAAGGTGG + Intronic
1163404468 19:17113617-17113639 GCTACTGAAGGTCCCTGAGGGGG + Intronic
1164051474 19:21587961-21587983 GTTCCTGGCTTGCCCTGGGGTGG + Intergenic
1164477440 19:28586309-28586331 TCTCCTAAATGGCTCTGAGGGGG + Intergenic
1164632182 19:29769029-29769051 GCCACAGGATGGCCCTGAAGAGG - Intergenic
1165116801 19:33533513-33533535 CCTTCTGGATGGCCCAGGGGAGG + Intergenic
1165359762 19:35329096-35329118 GCTTCTCTATGGCTCTGAGGGGG - Intronic
1165831129 19:38730988-38731010 GCACCTGGATGGGGGTGAGGGGG - Exonic
1166052732 19:40270045-40270067 GTGCCTGCAAGGCCCTGAGGTGG - Intronic
1166072601 19:40395690-40395712 GCGGGTGGAGGGCCCTGAGGTGG - Exonic
1166295822 19:41888811-41888833 GCTGCAGGAGGGCCATGAGGTGG - Exonic
1166379991 19:42350826-42350848 GCTCCTGGATGGTGGTGGGGTGG - Intronic
1166387324 19:42389522-42389544 GCATCTTGCTGGCCCTGAGGAGG + Intronic
1167291638 19:48628173-48628195 GCTCCTAGATCGCCCTGACTGGG + Exonic
1167446779 19:49542650-49542672 GCACCTGGATGGGAGTGAGGTGG + Exonic
1167567074 19:50263303-50263325 GCTTCTGGAAGGCCCTGGGTGGG - Exonic
1168239273 19:55081222-55081244 CCTCCTGCGTGGCCCTGCGGAGG - Exonic
925480686 2:4270088-4270110 GATCCTGGCTGGCCCTGAGAGGG - Intergenic
927668224 2:25046849-25046871 GCTGTGGGATCGCCCTGAGGAGG - Intronic
927958365 2:27224076-27224098 GCTCCAGGATGGGCATAAGGTGG + Intronic
928169783 2:28995873-28995895 CCCCATGGATGGTCCTGAGGTGG + Intronic
932432778 2:71685678-71685700 GCTCCCGGCTGGCTCTGAGGGGG - Intronic
935065045 2:99640042-99640064 GCTCCTGCATGCCTCCGAGGAGG - Intronic
935168715 2:100592592-100592614 CCTCCTGGATGACTTTGAGGGGG - Intergenic
935350149 2:102145494-102145516 GCTCCTGGATGTGCATGAAGAGG - Intronic
937127284 2:119482681-119482703 GCTGCTGGCTGGGCCTGAGCAGG + Intronic
937829845 2:126407548-126407570 GCTCCTGGAGGGCACTCAGTGGG + Intergenic
938804782 2:134796114-134796136 GCTCCAGGATGGCCCTGTTCAGG - Intergenic
938809936 2:134843699-134843721 GCTCCTTAATGGCTCTGAGTTGG - Intronic
940481242 2:154233844-154233866 GCTCATGGATGGTCAGGAGGAGG + Intronic
943318464 2:186416631-186416653 GCTCAAAGAGGGCCCTGAGGTGG - Intergenic
946075487 2:217070251-217070273 ACTCCTGGAGGGGGCTGAGGAGG - Intergenic
946254928 2:218435386-218435408 ACTTCTGGATGGCCCTGGGTGGG + Exonic
947551236 2:231048250-231048272 GCTCCTGGATTTCCCTGGAGGGG + Exonic
948264649 2:236627881-236627903 GCTCCCTGAGGGCTCTGAGGTGG - Intergenic
948372521 2:237498618-237498640 TCTCCTTGCTGGCCCTTAGGAGG + Intronic
1173821192 20:46021797-46021819 GCTTCTGGCGGGCCCTGCGGGGG - Exonic
1175312330 20:58020410-58020432 GCTCCAGGATGGCCCTGCCCTGG - Intergenic
1175368262 20:58470087-58470109 GCTGCTGAAGGGCCCTGGGGCGG - Intronic
1175466735 20:59194480-59194502 GCTCCGGGACGTCCCTGAGTGGG - Exonic
1175843692 20:62047961-62047983 GGTCTGGGATGGCCCTGATGTGG - Intronic
1175868189 20:62192630-62192652 GCTCCTGGATGGCCTTGGGAGGG - Intronic
1176063178 20:63181124-63181146 CCTGCTGGATAGCCCTGAGCTGG - Intergenic
1176141724 20:63547805-63547827 GCTCCAGGAGGGGCCCGAGGAGG + Intergenic
1176254439 20:64143623-64143645 GCTCCAGGATGAGCCTGAGCTGG + Intergenic
1178166467 21:29983665-29983687 AATCCTTGATGGCGCTGAGGGGG - Intergenic
1178868001 21:36346340-36346362 GATCCTGAACAGCCCTGAGGTGG + Intronic
1178921386 21:36740988-36741010 CCTCCTGGAAGGCGGTGAGGTGG + Intronic
1179577422 21:42316848-42316870 GCTCCTGGAAGGGCCAGTGGGGG - Intergenic
1179659707 21:42866393-42866415 GCTGCAGGATGCCCCTGAGCTGG - Intronic
1180122901 21:45765677-45765699 CCTCCTGGATGGTCCCTAGGAGG + Intronic
1180852153 22:19027046-19027068 GGTCCTGTTGGGCCCTGAGGAGG - Intergenic
1181801099 22:25348504-25348526 GTTCCTGCAGAGCCCTGAGGCGG - Intergenic
1183215032 22:36473939-36473961 GCACATGGCTGGCCCTCAGGGGG + Intronic
1183465534 22:37978394-37978416 GCTCCTGGCAGCCCCTGAGGAGG + Intronic
1185026917 22:48419646-48419668 TCACCTGGATGGCCCTAGGGAGG + Intergenic
1185214543 22:49590948-49590970 GCTCCTGGCTGGCCTGGAAGTGG + Intronic
1185241562 22:49750077-49750099 GCCCCGGGATGGCCATGTGGGGG - Intergenic
1185371183 22:50461628-50461650 GCTGCCGGATGGGCGTGAGGAGG - Exonic
949167136 3:956375-956397 GCTGCTGCATGGCCCTGATTAGG + Intergenic
949543532 3:5053068-5053090 CCTGCTGGATGGCACGGAGGAGG + Intergenic
950611870 3:14132220-14132242 GCTCCAGGACAGCCCTGCGGGGG - Intronic
950927755 3:16759791-16759813 GCTCCTGTATGGCCCAGGGCAGG + Intergenic
952079097 3:29735902-29735924 TCTCCTGAATGGACCTAAGGTGG - Intronic
953877509 3:46674726-46674748 GCACCTGGAGGTCCCTGATGGGG + Exonic
954136677 3:48585103-48585125 GCTCCAGGGAAGCCCTGAGGAGG + Exonic
955339869 3:58116972-58116994 GCTCCTGGAGGGCCCTAAAAGGG + Intronic
955996126 3:64682677-64682699 GCTCCTGGATGATGCTGATGCGG - Intronic
956688905 3:71857926-71857948 CCACCTGGAGGGCCCAGAGGAGG + Intergenic
957255024 3:77825653-77825675 GCTGCTGGAATGCACTGAGGTGG + Intergenic
968286554 3:197512457-197512479 GCTCCTGGGTGGCTCAGAAGTGG - Intronic
968436200 4:590984-591006 GCTCCAAGTTGGCCATGAGGGGG + Intergenic
969217812 4:5736045-5736067 CTCCCTGGCTGGCCCTGAGGAGG + Intronic
969322467 4:6420992-6421014 TCTCCTCGATGTGCCTGAGGAGG + Intronic
969594586 4:8141930-8141952 GCTCCTGCATGGAGCTGGGGGGG - Intronic
975005624 4:69280493-69280515 GCACCAGGATGGCTCTGAAGTGG + Exonic
979145367 4:117239990-117240012 GCTCATGGGTGGCCCTGGGTGGG - Intergenic
983750572 4:171264517-171264539 TCTCCTGGAAGTCTCTGAGGAGG + Intergenic
985805441 5:2039517-2039539 CCTCCTGGAGGGCCCTCGGGAGG - Intergenic
986179955 5:5384271-5384293 GCCATTGGAGGGCCCTGAGGAGG + Intergenic
986783555 5:11089377-11089399 CCTCATGGATGGCCCTGTGCCGG + Intronic
986977231 5:13408948-13408970 GCCCCTGGATGGCCCCAAGATGG + Intergenic
987569530 5:19638591-19638613 GTTCCTGGATGAGCATGAGGTGG + Intronic
989102381 5:37834998-37835020 GCTCCTGGGGCGCGCTGAGGAGG - Intronic
990439713 5:55832437-55832459 GCTTCTGGGTGGGCCTCAGGAGG - Intergenic
997013324 5:129904364-129904386 GCTCCGAGCTGGCCCGGAGGAGG - Intergenic
997437221 5:133884248-133884270 GATCCAGGATGGTCCTGGGGAGG - Intergenic
1000957964 5:167564452-167564474 GCTCATAGATGGCTTTGAGGAGG + Intronic
1001311862 5:170616895-170616917 CTTCCTGGATGTCCCTGAGCTGG + Intronic
1002471464 5:179438443-179438465 CCTCCCGGCTGGGCCTGAGGAGG + Intergenic
1002644640 5:180647149-180647171 GCTCCTGCATGTCCCTGAGCTGG + Intronic
1002712989 5:181206031-181206053 GGTCCTGGAAGGCCCTGAGAAGG - Intergenic
1003167040 6:3688748-3688770 GCTCCAGGAAGGCCTTGAGTTGG - Intergenic
1007132343 6:39487383-39487405 GGTGCTGGATGCCCCTGGGGAGG - Intronic
1007375896 6:41456588-41456610 GTTCCTGGTGGGCCCAGAGGAGG - Intergenic
1010393013 6:75358475-75358497 GCTCCAGGAAGGCATTGAGGAGG + Intronic
1011049394 6:83127522-83127544 GCACCGGGAAGGCCCTGAAGGGG + Intronic
1014255839 6:119159494-119159516 GCTTCAGGATGGCCAAGAGGGGG + Intergenic
1017525819 6:155240658-155240680 GCTCCTGGATGACTTTGCGGAGG - Exonic
1018185084 6:161259929-161259951 ACTCCTGGATGGGTCTGAGAAGG - Intronic
1019443944 7:1061249-1061271 CCTGCTGGGTGGCCCTGTGGAGG + Intronic
1021046164 7:15925335-15925357 GCTCCTTTATGGCCCAGAGCCGG - Intergenic
1023054877 7:36283378-36283400 GCTCCCCGATGGCCCTGGAGGGG - Intronic
1023100330 7:36711504-36711526 TTTCCTGGATTGCTCTGAGGTGG - Intronic
1026853963 7:73741098-73741120 GGTCCTGGACCGCCCTAAGGAGG - Intergenic
1029458430 7:100682548-100682570 GCTCCGGGATGGCCCTGAGGGGG - Intronic
1030166870 7:106564089-106564111 GCTCTTGGATGACACTGATGAGG - Intergenic
1030196565 7:106858977-106858999 GCTCCTGCAGGGACCTGGGGCGG - Intergenic
1034442586 7:151094023-151094045 GCTCCTGGAGGGCTCCAAGGGGG - Intronic
1035796968 8:2366719-2366741 GCTCCCCGGTGGCTCTGAGGAGG + Intergenic
1035848890 8:2894179-2894201 GGTCCTGGCTGTCTCTGAGGTGG - Intergenic
1036613932 8:10373829-10373851 GCCCCTGGAGGGCTCTGAGCAGG + Intronic
1037514949 8:19620854-19620876 GCTCCTGGTTGGACTTGAGAAGG - Intronic
1038536174 8:28354183-28354205 GCTCCTGAATGCCTCTGAGCAGG + Intronic
1038993910 8:32900538-32900560 CCTCCCTGATGGCCCTCAGGAGG - Intergenic
1041125820 8:54637258-54637280 ACTCCTGGGTGGTCCTGAGTGGG + Intergenic
1041539561 8:58967577-58967599 GCACCTGGCTGGAGCTGAGGAGG + Intronic
1042526702 8:69771931-69771953 GCTCCAGCCTGGCCCTGGGGAGG + Intronic
1044310542 8:90687420-90687442 GCTCCTTGATGGCCCGGGGTGGG - Intronic
1045293258 8:100851639-100851661 GCTCCTGAAAGGTGCTGAGGAGG + Intergenic
1047765005 8:127983180-127983202 GCTGCTGGATGGCTCGGATGTGG + Intergenic
1048498588 8:134956061-134956083 GCGCCTGGATGGCCATCAGTGGG + Intergenic
1048974804 8:139665201-139665223 TCTCCCGGATGGCCCTCAGAAGG - Intronic
1049180262 8:141218589-141218611 GCTCCTGGCTGGTGCTGCGGGGG + Exonic
1049196372 8:141318009-141318031 GCTACTGTCTGGCCCTGTGGTGG + Intergenic
1049355948 8:142188102-142188124 CCTCCTGCAGGCCCCTGAGGAGG - Intergenic
1049454136 8:142678482-142678504 GCTGCTGGCTGGCTTTGAGGGGG - Intronic
1049612509 8:143562068-143562090 GCTGCTGGAGGGCCTGGAGGGGG + Exonic
1049755650 8:144310260-144310282 GTTCCAGGAAGGGCCTGAGGTGG - Intronic
1053312162 9:37026913-37026935 GCTGCTGGCTGTCCCGGAGGCGG - Intronic
1055184344 9:73432612-73432634 GCTCCTGCATGGCCCTGATAGGG - Intergenic
1056949757 9:91032664-91032686 ACTCCAGGCTGGCCCTGGGGTGG - Intergenic
1057214205 9:93219100-93219122 GCACCTGGATGTCCCTGGAGGGG + Intronic
1060827801 9:126696444-126696466 GCGCCTGGCTGGCTCTCAGGAGG - Exonic
1061255550 9:129452964-129452986 GCAACTGGATGGCCCTCAAGAGG + Intergenic
1061332007 9:129900625-129900647 GCTCCGGGCTGGCCCTCAGATGG - Intronic
1062396871 9:136356126-136356148 CCCCCTGGAAGCCCCTGAGGTGG + Intronic
1062401216 9:136373528-136373550 GCTCCTGGAAGACCCTCAGGTGG - Exonic
1062509855 9:136898860-136898882 GCGCCTGGAAGGGCCTGCGGAGG - Exonic
1062641870 9:137522922-137522944 GCTCCTGGAAGCCCTGGAGGAGG + Intronic
1185889978 X:3815020-3815042 CCTCTGCGATGGCCCTGAGGCGG - Intergenic
1186193296 X:7086998-7087020 GCCCCAGGAGGGCCCTGAGCTGG - Intronic
1187633973 X:21206095-21206117 GCTCCTGTTTGGCACTGGGGTGG - Intergenic
1188526948 X:31097403-31097425 GCTCCATGAGGGCCCTGCGGTGG + Intergenic
1190512421 X:51186412-51186434 CCTCCAGGATTGCACTGAGGGGG - Intergenic
1190700893 X:52989344-52989366 GCCCCTGGCTGTCCCTGAGGTGG + Intronic
1198959971 X:142173785-142173807 GATTCTTGGTGGCCCTGAGGAGG - Intergenic
1200236321 X:154469503-154469525 GCTCCCAGGTGGCCCTGGGGAGG - Intronic
1201565216 Y:15358442-15358464 GTTCCAGGAGGGCCCTGAGCTGG - Intergenic