ID: 1141482838

View in Genome Browser
Species Human (GRCh38)
Location 16:84318334-84318356
Sequence GGCCCTGAGGAGGTGTTACA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141482830_1141482838 13 Left 1141482830 16:84318298-84318320 CCTCGATGGCTTGGTGGCAATGG 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1141482838 16:84318334-84318356 GGCCCTGAGGAGGTGTTACAAGG 0: 1
1: 0
2: 2
3: 19
4: 136
1141482828_1141482838 19 Left 1141482828 16:84318292-84318314 CCGAAACCTCGATGGCTTGGTGG 0: 1
1: 0
2: 0
3: 7
4: 47
Right 1141482838 16:84318334-84318356 GGCCCTGAGGAGGTGTTACAAGG 0: 1
1: 0
2: 2
3: 19
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141482838 Original CRISPR GGCCCTGAGGAGGTGTTACA AGG Exonic
900867805 1:5280862-5280884 GACCCAGAGGAGGTGTGACAGGG - Intergenic
902650473 1:17833935-17833957 GGCGATGAGGAGGTGAAACAAGG + Intergenic
903460022 1:23514317-23514339 GGCACTGGGGAGGTGTCCCAAGG + Intronic
904897021 1:33825022-33825044 GGCCCTGATCAGGTGTTTCTGGG + Intronic
907144755 1:52221841-52221863 GGTCCAGAGGAGGGTTTACAGGG + Intronic
910515027 1:88051207-88051229 GGTCCTGGTGAGGTGTCACAAGG - Intergenic
911184308 1:94887908-94887930 GCACCTGAGGAGGTGTGGCAGGG - Intronic
914050355 1:144125873-144125895 GGCCCTGTGGGGGTGTTAGATGG - Intergenic
914128827 1:144839572-144839594 GGCCCTGTGGGGGTGTTAGATGG + Intergenic
915195666 1:154187753-154187775 GGGCTTGAGGAGGTGTTTCCAGG - Intronic
917497568 1:175555167-175555189 GGCCCAGAGGAGATATTCCATGG + Intronic
920385299 1:205567324-205567346 GGCCGTGGGGAGCAGTTACAGGG + Intergenic
923737983 1:236630027-236630049 GGCCATGAGGAGGAGAAACAAGG + Intergenic
1066440717 10:35436115-35436137 GGCCATGGGGAAGTGTGACATGG + Intronic
1067239260 10:44476470-44476492 GGCACAGTGGAGGTGTTAGAGGG - Intergenic
1070590651 10:77798353-77798375 GGCTCTGAGGAGGAGTCACGGGG + Intronic
1072543309 10:96414674-96414696 AGCCCAGGGGAGGTGTTACGAGG - Intronic
1072915736 10:99536367-99536389 GGCCCACCGGAGGTGTTACCGGG + Exonic
1073105279 10:101029353-101029375 AGCCCTGGGGAGGTGTTACAAGG - Intronic
1073259488 10:102178175-102178197 GACCCTGAGAAGGTGTTTCCAGG + Intergenic
1074321394 10:112406473-112406495 GGGCCGGAGGAGGGGTGACAGGG + Intronic
1075048656 10:119165769-119165791 GGCCCCGAGGCGCTGTGACACGG - Intergenic
1083919841 11:65776463-65776485 GGCCCTGCAGAGCTGTTGCAAGG + Exonic
1084931722 11:72561543-72561565 TGGCCTCAGGAGCTGTTACAGGG + Intergenic
1085458306 11:76678211-76678233 GGCCAGGAGGGGGTGTTCCAAGG - Intergenic
1091173870 11:133542621-133542643 GGCCCTGATGCAGTGTTCCACGG + Intergenic
1091410024 12:233222-233244 GGCCCTGAAGTGTTGTTACCCGG - Intronic
1091776660 12:3189182-3189204 AGCCTTGAGGAGATGTTTCAAGG - Intronic
1097107794 12:56635450-56635472 AGCCCTGAGGAGCTGAAACACGG - Intronic
1102946810 12:116997144-116997166 GGCTCTGTGGAGGTGCTACAGGG - Intronic
1103917484 12:124383562-124383584 GGCCCTGAGAAGGGGGTAGATGG + Intronic
1113592747 13:111512499-111512521 GGCCCTGTATAGGTTTTACAGGG - Intergenic
1113923783 13:113929264-113929286 AGCCCTGAGGAGGTGGCAGACGG - Intergenic
1114736937 14:25051350-25051372 GGCCCTGTTGGGGTGTTAGATGG + Intergenic
1119267280 14:73270353-73270375 AGCCCCAAGGGGGTGTTACAGGG + Intronic
1120523136 14:85547753-85547775 GGTCCTGAGGACGTGTGCCAGGG + Intronic
1121271773 14:92642393-92642415 GGCCCTGAGAATTTCTTACAGGG + Intronic
1123033331 14:105461421-105461443 GGTCCTGAGGTGGAGGTACAGGG - Intronic
1130958550 15:88644575-88644597 GGCCCTAGGGAGCAGTTACAAGG + Intronic
1132909123 16:2299339-2299361 GGCGCTGAGATGGTGTTAAAGGG + Intronic
1133928962 16:10216691-10216713 GGCCCTGAGGAGGGATTGCTTGG + Intergenic
1136721112 16:32320256-32320278 GGCCCTGTGGGGGTGTTAGGTGG - Intergenic
1136839494 16:33526542-33526564 GGCCCTGTGGGGGTGTTAGGTGG - Intergenic
1136994454 16:35179828-35179850 GGCCATTGGGAGGTCTTACAGGG + Intergenic
1138589338 16:57991187-57991209 GGCACTGAGCAGGTGCTACAGGG - Intergenic
1139170915 16:64628230-64628252 GCCCCAGTGGGGGTGTTACAGGG - Intergenic
1139337804 16:66245376-66245398 GGCAGTGAGCAGGTGTTTCATGG - Intergenic
1141482838 16:84318334-84318356 GGCCCTGAGGAGGTGTTACAAGG + Exonic
1142267745 16:89072275-89072297 GGACCTGGGGAGGGGGTACAAGG + Intergenic
1203005320 16_KI270728v1_random:197514-197536 GGCCCTGTGGGGGTGTTAGGTGG + Intergenic
1203136870 16_KI270728v1_random:1733635-1733657 GGCCCTGTGGGGGTGTTAGGTGG + Intergenic
1203149660 16_KI270728v1_random:1826827-1826849 GGCCCTGTGGGGGTGTTAGGTGG - Intergenic
1142766988 17:2070403-2070425 GGCCATGAGAGGGTGTGACAGGG - Intronic
1143745583 17:8991811-8991833 GGCCAGGAGGAGATGTTCCAGGG - Intergenic
1144953506 17:19005973-19005995 GGCTCAGAGAAGGTCTTACAGGG - Intronic
1146314228 17:31794669-31794691 GGTCCTGAGGAGCTGTAAAATGG - Intergenic
1147182774 17:38697121-38697143 GGCACTGAAGAGGTGTCAGAGGG - Intergenic
1147325944 17:39669674-39669696 GGCACTGAGCAGCTGGTACACGG - Exonic
1150273246 17:63880283-63880305 GGCACTGGGGAGGGGTCACAGGG + Exonic
1150278854 17:63917271-63917293 GGCACTGGGGAGGGGTCACAGGG + Exonic
1151448363 17:74181926-74181948 GGCCATGAGAAGCAGTTACATGG - Intergenic
1151660855 17:75517130-75517152 GGCCCAGAGCAAGTGTCACAAGG - Intronic
1151884146 17:76913525-76913547 GGCCCAGGGGAGGTGTGGCATGG + Intronic
1152291384 17:79441960-79441982 GGACCTGAGGAGGATTTCCAAGG - Intronic
1152751332 17:82063791-82063813 GCCCCTGAGGAGGTGTTACTTGG - Intronic
1153361573 18:4203664-4203686 GGCCCTCAGGAAATGTTTCAGGG - Intronic
1155027736 18:21957742-21957764 GGCGCTAGGGAGGTTTTACAAGG - Intergenic
1159326508 18:66926747-66926769 GGCACTGAGGACTTATTACATGG + Intergenic
1160345005 18:78124949-78124971 AGCCCTGAGGAGGTGTGGCAGGG + Intergenic
1161562912 19:4983645-4983667 GGCACTGAGGAGGTGTTTCCGGG + Intronic
1162261590 19:9538717-9538739 TGCCTCGAGGAGGTATTACACGG - Intergenic
1162334811 19:10053790-10053812 GGCACTGAGGGGGTGTAACCTGG - Intergenic
1163797520 19:19345999-19346021 GGCCCTGAGGAGAGGTGTCAGGG + Intronic
1164992252 19:32692671-32692693 GGCCCTGAGCAGGCCTTACCTGG - Exonic
1168381874 19:55931006-55931028 AGACCTGCTGAGGTGTTACAGGG - Intronic
1202689762 1_KI270712v1_random:78511-78533 GGCCCTGTGGGGGTGTTAGATGG - Intergenic
925199843 2:1958550-1958572 GGCCTTGAAGAGGTGTCTCAGGG + Intronic
926152492 2:10432795-10432817 GGCCCTGGGGAGGTGTTTGCTGG - Intergenic
929701574 2:44167905-44167927 GGCTCTGGGGAGGTGTTGCGGGG - Intergenic
931592678 2:63902301-63902323 GGGCCTGAGGTGTTGTTAGAGGG - Intronic
933956658 2:87377511-87377533 GGCCCTGTGGGGGTGTTAGATGG + Intergenic
934121111 2:88840576-88840598 GGCCCTGAGAAGTTGGCACATGG - Intergenic
934240801 2:90269538-90269560 GGCCCTGTGGGGGTGTTAGATGG + Intergenic
934272391 2:91547221-91547243 GGCCCTGTGGGGGTGTTAGATGG - Intergenic
935121698 2:100188657-100188679 GGCTCAGAGGAGGAGTTACTGGG - Intergenic
936148433 2:109997132-109997154 GGCCCTGTGGGGGTGTTAGATGG - Intergenic
936196244 2:110374236-110374258 GGCCCTGTGGGGGTGTTAGATGG + Intergenic
937876703 2:126831394-126831416 GGACCAGAGGAGGGGATACAGGG + Intergenic
938256484 2:129863492-129863514 GGCCCTGAGGAGGGGACACCTGG - Intergenic
939304578 2:140394392-140394414 GGCACTGAGGAGGCAGTACAGGG + Intronic
944633962 2:201656551-201656573 GGCCCAGAGCAGGTGCTAGATGG - Intronic
947712272 2:232323057-232323079 GGTCCTGAGGAGGGGTGGCACGG - Intronic
948784590 2:240345783-240345805 AGCCCAGAGGAGGCGTCACAAGG - Intergenic
948794181 2:240393718-240393740 GCCCCTGAGGACCTGTGACATGG - Intergenic
1169368335 20:5009301-5009323 GGCCTTGAGGAGCTTTTGCAGGG - Intronic
1170032615 20:11958635-11958657 GGTCCTGGGGAGGGGATACATGG + Intergenic
1170159711 20:13298876-13298898 GGCCCACAGGAGGTGCTTCAAGG - Intronic
1170971121 20:21117484-21117506 GGGCCTGTGGAGGTGTTATGCGG - Intergenic
1171289252 20:23971646-23971668 GGGCCTGAGGATGTATTTCAAGG - Intergenic
1173126593 20:40342149-40342171 GGCACTGAGGAGGTCCTAGAAGG - Intergenic
1174398838 20:50264916-50264938 GGCCCCCAGGAGGTGTCACAGGG - Intergenic
1176246398 20:64099284-64099306 TGCCCTGAGGAGACGTCACAGGG - Exonic
1176266576 20:64212391-64212413 CGCCCTGAGGAGTGGGTACAAGG + Intronic
1179947349 21:44687200-44687222 GCCACTGAGGCGGTGTGACAGGG + Intronic
1180167195 21:46036301-46036323 GCCCCTGAGGAGGTGACACAGGG - Intergenic
1180551658 22:16546052-16546074 GGCCCTGTGGGGGTGTTAGATGG + Intergenic
1181352344 22:22267871-22267893 GGCCCTGTGGGGGTGTTAGATGG - Intergenic
1183083197 22:35470318-35470340 GGCCATGAGGAGCTGCCACAGGG - Intergenic
1184109948 22:42388770-42388792 GGCCCTGAGGACGAGTTCAAGGG + Intronic
1184433844 22:44458250-44458272 GGCCCAGAGGAGGTGGCACAGGG - Intergenic
949464820 3:4333366-4333388 CCCCCTGAGGATGTGTAACATGG - Intronic
949879203 3:8648659-8648681 GGCCTGGAGGAGGTGATAGAGGG - Intronic
950451439 3:13067881-13067903 GGCCCTGAGGAGATGGTGCCAGG + Intronic
950625812 3:14246102-14246124 GGCTCTCTGGAGATGTTACATGG - Intergenic
953023138 3:39128730-39128752 GGCCTTGATGAGGTGGTAGAGGG - Exonic
953407928 3:42668897-42668919 GGCTCTGAGGGGATGTTCCAGGG + Intergenic
954751483 3:52816694-52816716 GGCACTGAGGAGTTGTCCCAGGG - Intronic
954964362 3:54597258-54597280 GGCCCTAAGGAGGTGGGAAAGGG - Intronic
961628904 3:128282096-128282118 GGCCCAGAGGAGGGGCTACCTGG + Intronic
962615815 3:137125406-137125428 GGACCTGAGGGGCTATTACAGGG - Intergenic
967214272 3:187197384-187197406 GTCTCTGAAGAGGTGTTTCAAGG - Intergenic
967839395 3:193992629-193992651 GGCCTTGAGGAGTAGTTGCAAGG - Intergenic
970845450 4:20532580-20532602 GCCCCTGGGGAGGTGTGACGGGG + Intronic
974039777 4:56847403-56847425 AGCCCTGTGGAGGTGCCACATGG - Intergenic
975895802 4:79088837-79088859 GACCCTAAGGAGGTGGTGCATGG + Intergenic
981260312 4:142711042-142711064 GGCCCAGAAGAGGTGTTGGAAGG - Intronic
983395898 4:167195310-167195332 GGGACTGAGGATGAGTTACAAGG + Intronic
985619064 5:944203-944225 GGCCCTGGGAAGGTGTCACCCGG + Intergenic
986273354 5:6253214-6253236 GGCCCTGGGCAGGTGGGACAGGG + Intergenic
987081449 5:14428868-14428890 GGCCCTGAGGGGGTGACTCATGG + Intronic
998092707 5:139380511-139380533 GGTCCTGAGGAGGGGCTATATGG - Intronic
1001211593 5:169815024-169815046 GGCTCTGGGGAGGTGGAACATGG + Intronic
1004667387 6:17761048-17761070 AGCCCTGAGGTGATGTTTCAAGG + Intronic
1011552963 6:88546676-88546698 TGCCCTGAGCAGATGTGACACGG + Intergenic
1012867461 6:104635085-104635107 AGCCCTGAGTAGATGGTACATGG + Intergenic
1013348090 6:109281723-109281745 GGAACTGGGGAGGTCTTACAAGG - Intergenic
1018463030 6:164017184-164017206 GGCACTGAGGAGGTATTCAAAGG - Intergenic
1031999091 7:128253159-128253181 GGCCCTGAGGAGATGCTTCTGGG - Intronic
1034227907 7:149497414-149497436 GGCCCTGGGGAGGGGTTCCGGGG - Intronic
1034748305 7:153544078-153544100 GGCTCAGAGGAGGTGCTCCATGG + Intergenic
1039164407 8:34660990-34661012 GGCCCTGAGAAGGCTTTATAAGG - Intergenic
1044411560 8:91889761-91889783 GGACCTGCAGAGGTCTTACAGGG - Intergenic
1044449691 8:92320005-92320027 GGCACGGAAGAGGTGCTACAGGG + Intergenic
1046762771 8:118038653-118038675 TGCCCTTCGGAGTTGTTACAAGG - Intronic
1048522681 8:135171287-135171309 GGCCCAGAGGCAGTGTTAAAGGG - Intergenic
1049053500 8:140217292-140217314 GGCCTTGAGGAGGTCCTACTCGG + Intronic
1049642107 8:143720476-143720498 GGCCCAGAGGAGCTGTGCCAGGG + Intronic
1051846409 9:21455909-21455931 GGCCTTGAGGAGGTATTTCCAGG + Intergenic
1053468987 9:38332127-38332149 GACCCTGAGAATATGTTACATGG - Intergenic
1055861172 9:80750958-80750980 GGACCTGAGAAGGTGAGACAGGG + Intergenic
1057031414 9:91778385-91778407 GGCACCGAGGAGATGTTGCAGGG - Intronic
1058431947 9:104927783-104927805 GGACCGGAGGCGGTGTTAAATGG - Intronic
1061013836 9:127970874-127970896 GGCCCTAAGGAGGTGATGCTGGG - Intronic
1061374646 9:130216737-130216759 GGCCCTGAGAAGGTACTACGAGG - Intronic
1189249267 X:39587494-39587516 GGAAGTGAGGAGGTGATACAAGG + Intergenic
1192032930 X:67533933-67533955 GGCCCTGAGGTTGAGCTACAGGG + Intergenic
1197762730 X:130039118-130039140 TGGCCTGTGGAGGTGATACAGGG - Exonic
1199677032 X:150197625-150197647 GGCCCTGAGCAGGTCTGACAAGG - Intergenic