ID: 1141482841

View in Genome Browser
Species Human (GRCh38)
Location 16:84318344-84318366
Sequence AGGTGTTACAAGGTACCTGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141482830_1141482841 23 Left 1141482830 16:84318298-84318320 CCTCGATGGCTTGGTGGCAATGG 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1141482841 16:84318344-84318366 AGGTGTTACAAGGTACCTGCCGG 0: 1
1: 0
2: 2
3: 3
4: 78
1141482837_1141482841 -6 Left 1141482837 16:84318327-84318349 CCTGGATGGCCCTGAGGAGGTGT 0: 1
1: 0
2: 0
3: 13
4: 232
Right 1141482841 16:84318344-84318366 AGGTGTTACAAGGTACCTGCCGG 0: 1
1: 0
2: 2
3: 3
4: 78
1141482828_1141482841 29 Left 1141482828 16:84318292-84318314 CCGAAACCTCGATGGCTTGGTGG 0: 1
1: 0
2: 0
3: 7
4: 47
Right 1141482841 16:84318344-84318366 AGGTGTTACAAGGTACCTGCCGG 0: 1
1: 0
2: 2
3: 3
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141482841 Original CRISPR AGGTGTTACAAGGTACCTGC CGG Exonic