ID: 1141482842

View in Genome Browser
Species Human (GRCh38)
Location 16:84318345-84318367
Sequence GGTGTTACAAGGTACCTGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 55}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141482837_1141482842 -5 Left 1141482837 16:84318327-84318349 CCTGGATGGCCCTGAGGAGGTGT 0: 1
1: 0
2: 0
3: 13
4: 232
Right 1141482842 16:84318345-84318367 GGTGTTACAAGGTACCTGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 55
1141482830_1141482842 24 Left 1141482830 16:84318298-84318320 CCTCGATGGCTTGGTGGCAATGG 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1141482842 16:84318345-84318367 GGTGTTACAAGGTACCTGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 55
1141482828_1141482842 30 Left 1141482828 16:84318292-84318314 CCGAAACCTCGATGGCTTGGTGG 0: 1
1: 0
2: 0
3: 7
4: 47
Right 1141482842 16:84318345-84318367 GGTGTTACAAGGTACCTGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141482842 Original CRISPR GGTGTTACAAGGTACCTGCC GGG Exonic
900237092 1:1598112-1598134 GGTGTCACACGGCACCAGCCAGG + Exonic
901200213 1:7462739-7462761 GGGGTTACTAGGTCCCTGCCAGG - Intronic
913297356 1:117335041-117335063 GGTCTTTCAAGGAACCTGTCAGG - Intergenic
919193013 1:194247576-194247598 AGTCTTACTAGGGACCTGCCAGG - Intergenic
922241214 1:223756492-223756514 GGTGTAAACAGGTCCCTGCCAGG - Intronic
924134752 1:240952379-240952401 TCTGTTACAAGGTACCTTCATGG + Intronic
1063418881 10:5895306-5895328 GCTAGTACAAGGTACCTGACTGG - Intronic
1067068509 10:43116721-43116743 GATGCTGAAAGGTACCTGCCAGG + Exonic
1068945966 10:62729159-62729181 TGTGTTAGAAGGTACATTCCTGG - Intergenic
1071396947 10:85233407-85233429 GGTGATAGAAGATACCTGCAGGG - Intergenic
1076816983 10:132919900-132919922 GGTGGGACGAGGTCCCTGCCTGG - Intronic
1080395487 11:31886162-31886184 GGTGTTACCAGGAAGCTGCTGGG + Intronic
1088409664 11:109520342-109520364 GGTGTGGCCAGGTAGCTGCCTGG + Intergenic
1104568819 12:129907666-129907688 GGTGTCACCAGGTAACTGCCAGG + Intergenic
1104932059 12:132345110-132345132 GGTGGAACAAGATGCCTGCCAGG - Intergenic
1107904248 13:45047571-45047593 TCTGCTACAAGGTACCAGCCGGG - Intergenic
1113669968 13:112170061-112170083 GATGTCACAAGGGACCTGGCAGG + Intergenic
1120341374 14:83225283-83225305 GGGGTTACAAGGTACATGGTGGG + Intergenic
1121123083 14:91388440-91388462 GGCGCTACCTGGTACCTGCCTGG - Intronic
1122012981 14:98768607-98768629 GGTGATACAAGATGCATGCCCGG + Intergenic
1125990183 15:44099062-44099084 GGTGTTACATGGTTTCTGCATGG + Intronic
1127285210 15:57526808-57526830 GGTGTTAGGAGGGACCTGCTGGG + Intronic
1133446101 16:5862409-5862431 GGTGCTACAAGCGACCCGCCAGG - Intergenic
1141482842 16:84318345-84318367 GGTGTTACAAGGTACCTGCCGGG + Exonic
1151716596 17:75834310-75834332 GGTCGGACAAGGTACCTGCTCGG + Exonic
1158559707 18:58503815-58503837 GGTGTTTCAAGGTACCCAGCAGG + Intronic
1161028750 19:2048437-2048459 AGTGGTACAAGGAACCTGACCGG - Intronic
926558027 2:14382480-14382502 GCTGTTACCAGGTATCTGGCTGG + Intergenic
929945169 2:46365580-46365602 AGTGTTACAGGGTACCTGTAGGG - Intronic
938690130 2:133780178-133780200 GGTGTGAAAAGGTACCTCCCAGG - Intergenic
940982316 2:160017487-160017509 GGTGTTTCATGGTAGCTTCCAGG - Intronic
941640741 2:167985416-167985438 GATGTTACAAGGGTCATGCCAGG + Intronic
1172324928 20:34026979-34027001 GGTCTTACGAACTACCTGCCAGG - Intronic
1172800793 20:37574698-37574720 GGTGTTCCAGGATCCCTGCCAGG - Intergenic
1174201554 20:48809752-48809774 GGCGTTAGAGGGTCCCTGCCTGG - Intronic
1177357090 21:20022287-20022309 TGAGTTACAATGTAACTGCCTGG - Intergenic
1179824091 21:43954322-43954344 GGTGGAACAGGGTACCTGCGAGG + Intronic
962388986 3:134956105-134956127 GCTGTTAGAAGGAACCTGGCAGG + Intronic
970329553 4:14965492-14965514 GGTGTTCAGTGGTACCTGCCAGG - Intergenic
972274578 4:37545199-37545221 GTTGGTAGAAGGTAGCTGCCAGG + Intronic
986334068 5:6739880-6739902 GATGTGACAAGGCTCCTGCCCGG - Intronic
988478341 5:31608041-31608063 GGTGTTAGAAGGTCACTGCTGGG - Intergenic
996882146 5:128311387-128311409 GGAGTTACCAGGTCTCTGCCAGG - Exonic
1002422930 5:179158990-179159012 GGTGGTACAAAGGCCCTGCCCGG + Intronic
1008061249 6:46999256-46999278 GATGTTTTAAGGTACCTCCCTGG + Exonic
1017712302 6:157181686-157181708 GGTGTGACAGGGGAGCTGCCTGG + Intronic
1018457096 6:163962333-163962355 GGTGTTAGGAGCTAGCTGCCTGG + Intergenic
1023658449 7:42449510-42449532 GGTGTTACTAAGTACCTTCTAGG - Intergenic
1028315984 7:89403905-89403927 GGTGTTAGATGGTACCTCACTGG + Intergenic
1033457024 7:141511900-141511922 GGTGCGACCAGGTACCTCCCAGG + Intergenic
1034558451 7:151864463-151864485 AGGGTTGCAGGGTACCTGCCAGG - Intronic
1038461031 8:27717129-27717151 GGTGTGACATGGAACCTGACTGG + Intergenic
1040904196 8:52448802-52448824 GGGGTCACAGGGTACCTGCAGGG - Intronic
1043176846 8:77032139-77032161 GGTTTTACAATGTAATTGCCAGG - Intergenic
1049459884 8:142721549-142721571 GGTATTACAAGGTGACTGGCAGG - Intergenic
1051448721 9:17171476-17171498 TGTGTTACAAGGTGTCTGCAGGG + Intronic
1060257805 9:122047873-122047895 GGTGTAACCAGGTATCTGGCAGG + Intronic
1186636926 X:11416238-11416260 GGTGATACAAAGTATCTGCGTGG + Intronic
1188353966 X:29166973-29166995 GGTGTTAGAAGGTATGTGACAGG - Intronic
1191197050 X:57735979-57736001 GGTGTTACATGGTCACTGCCAGG - Intergenic
1195624707 X:106996243-106996265 GGAGTTACAATGTAGCTGCCAGG + Intronic