ID: 1141485746

View in Genome Browser
Species Human (GRCh38)
Location 16:84339273-84339295
Sequence TAGACTATAGGCAGCAGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141485746_1141485755 5 Left 1141485746 16:84339273-84339295 CCGCCCCTGCTGCCTATAGTCTA No data
Right 1141485755 16:84339301-84339323 ACACAGTACATGGAGAAGCAGGG No data
1141485746_1141485753 -5 Left 1141485746 16:84339273-84339295 CCGCCCCTGCTGCCTATAGTCTA No data
Right 1141485753 16:84339291-84339313 GTCTAGTGGGACACAGTACATGG No data
1141485746_1141485756 18 Left 1141485746 16:84339273-84339295 CCGCCCCTGCTGCCTATAGTCTA No data
Right 1141485756 16:84339314-84339336 AGAAGCAGGGATTTGAACCATGG No data
1141485746_1141485754 4 Left 1141485746 16:84339273-84339295 CCGCCCCTGCTGCCTATAGTCTA No data
Right 1141485754 16:84339300-84339322 GACACAGTACATGGAGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141485746 Original CRISPR TAGACTATAGGCAGCAGGGG CGG (reversed) Intergenic
No off target data available for this crispr