ID: 1141486446

View in Genome Browser
Species Human (GRCh38)
Location 16:84343351-84343373
Sequence GGACCCCGGGCCCAGCGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141486446_1141486451 9 Left 1141486446 16:84343351-84343373 CCATCACGCTGGGCCCGGGGTCC 0: 1
1: 0
2: 1
3: 15
4: 169
Right 1141486451 16:84343383-84343405 TCGTATGAGACCCACCTCCTTGG 0: 1
1: 0
2: 0
3: 8
4: 59
1141486446_1141486455 23 Left 1141486446 16:84343351-84343373 CCATCACGCTGGGCCCGGGGTCC 0: 1
1: 0
2: 1
3: 15
4: 169
Right 1141486455 16:84343397-84343419 CCTCCTTGGCTACAGCTGATTGG 0: 1
1: 3
2: 6
3: 26
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141486446 Original CRISPR GGACCCCGGGCCCAGCGTGA TGG (reversed) Intergenic
900082689 1:870152-870174 GGGGCCCGGGCCCGGCGTGGGGG - Intergenic
900129666 1:1082020-1082042 GGAGCCCGGGCCTGGCGTGCGGG + Exonic
900777503 1:4595815-4595837 GGACCCCAGGCCCAGCGTCATGG - Intergenic
904785004 1:32976109-32976131 GGGCCCCGGGTCCAGAGGGATGG - Intergenic
905915091 1:41679019-41679041 GGACCCATGGCCCAGGGAGAAGG + Intronic
907704151 1:56818754-56818776 GGACCCAGGGCTCAGGATGACGG + Intronic
909980517 1:82094890-82094912 GGCCCCCGGGCTAAGGGTGAGGG + Intergenic
913452040 1:118999092-118999114 GGACCTTGGGTTCAGCGTGAAGG + Intergenic
918009079 1:180569709-180569731 GGACACAGGGACCAGCCTGAAGG + Intergenic
919127108 1:193408390-193408412 AGACTCCGGACCCAGCCTGAAGG - Intergenic
922806955 1:228395115-228395137 TGACCCCGGCCCCTGCGTGCTGG - Exonic
923108067 1:230869072-230869094 AGGCCCCGGGCCCAGCGTCCTGG - Intronic
1064265269 10:13820807-13820829 GGACCCCGGGACCTGCTGGATGG + Intronic
1066322312 10:34315982-34316004 GGAACCATGGCCCAGCCTGAAGG - Intronic
1066657839 10:37712018-37712040 GGACCCTGGGCCCAGAGTCACGG + Intergenic
1071503530 10:86219598-86219620 GGCCCCCCGTCCCAGAGTGAGGG + Intronic
1075411895 10:122234251-122234273 GGACCCCAGGCACAGCCTGCAGG + Intronic
1075635413 10:124027182-124027204 TGAGCACGGGCCCAGTGTGAGGG - Intronic
1076911761 10:133394017-133394039 GGGGCCCGGGCCCAGAGGGAGGG - Intronic
1077297909 11:1834687-1834709 GGACCCTGGGCCCTGCCTGGGGG - Intronic
1077491087 11:2861389-2861411 GGGCCCCGGACCCAGCCTGAGGG - Intergenic
1082160823 11:48886075-48886097 GGACCCCGGGCCGTGTCTGATGG + Intergenic
1082161543 11:48894331-48894353 GGACCCCGGGCCGTGTCTGATGG - Intergenic
1083923815 11:65794146-65794168 GGCCCCCGGGCCCTGTGTGGTGG + Exonic
1084969510 11:72763021-72763043 GGACACCGGAACCAGCTTGAAGG + Intronic
1085476998 11:76795158-76795180 AGACCTCGGGCCCCGGGTGAGGG - Intronic
1088983316 11:114883504-114883526 GGAATACGGGCCCAGAGTGAGGG - Intergenic
1090945905 11:131429340-131429362 GGACCCCCCGCCCAGCCTCAGGG + Intronic
1091950826 12:4591604-4591626 GGACCCAGGGGCCAGCGGGAAGG + Intronic
1092695973 12:11171582-11171604 GGCCTCCGGGGCCAGCATGATGG + Intronic
1094534818 12:31311601-31311623 GGACCCAGGGCCAAGCATGGCGG + Intronic
1100600302 12:96107188-96107210 GGACCCCGGGCTGGGCGTGCTGG - Intergenic
1101659375 12:106752535-106752557 AGACCCAAGGCCCAGGGTGAGGG - Intronic
1101970637 12:109309803-109309825 GGGGCCCGGGCCCAGCGCGGCGG + Intergenic
1102134210 12:110559436-110559458 GGGTCTCGGGCCCAGCGTGGTGG + Intronic
1103722003 12:122980246-122980268 GGACCCCAGGCCCATCCGGAAGG - Exonic
1105699707 13:22926763-22926785 GGACCCCAGACCCAGCGAGGAGG - Intergenic
1112344040 13:98576354-98576376 GGTCCCGGGGCCCTGCGTGGTGG - Intronic
1112408248 13:99139612-99139634 AGTCCCCGGGCCCAGAGGGAGGG + Intergenic
1113747894 13:112757915-112757937 GGAGCCAGGGGCCAGCGTGGTGG + Intronic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1114670593 14:24408843-24408865 GGACCCCGGGGCCAGCCTTTGGG + Exonic
1115650733 14:35401337-35401359 GCACCCTGGGCCCAGTGTGTGGG - Intergenic
1122902749 14:104788554-104788576 GGACCCCAGGACCAGCTGGATGG + Intronic
1122959940 14:105089777-105089799 GGTCTCTGGGCCCAGGGTGAAGG - Intergenic
1122977674 14:105177615-105177637 GGACACTGGGCCCAGGGCGAAGG - Intronic
1123625366 15:22223429-22223451 GGACCCCAGGGCCTGCGTGGTGG + Intergenic
1124496669 15:30191647-30191669 GGTCCCCGGTCCCAGCGCTAAGG + Intergenic
1124595113 15:31085928-31085950 AGACCCCAGGCCCAGACTGATGG + Intronic
1124746907 15:32347001-32347023 GGTCCCCGGTCCCAGCGCTAAGG - Intergenic
1125608254 15:40954286-40954308 GGAACCCTGGCCCAGTGTGAAGG + Intronic
1127256975 15:57300772-57300794 AGACCCCGGCCACAGCGGGAGGG - Intergenic
1127303980 15:57684079-57684101 AGGCCCCAGGCCCAGCGTGGTGG - Intronic
1128146360 15:65334443-65334465 GGTCCCCGAGGCCAGGGTGAGGG + Intronic
1128605419 15:69033205-69033227 GGACCTCGGCGCCAGCGTCATGG + Exonic
1132934074 16:2472239-2472261 GCACCCCTGGCCCAGCCTGATGG + Exonic
1136537842 16:30910698-30910720 GGAGCCCGGGCCCAGCGCCTGGG - Intergenic
1136594913 16:31241574-31241596 GGACCCAGGTCCCACCCTGATGG - Intergenic
1136872860 16:33824461-33824483 GGAGCCCGGGCCCAGCCTTCAGG + Intergenic
1138529946 16:57629554-57629576 GGACCCCGGACCCAGCCCCAGGG - Intronic
1138623173 16:58227886-58227908 GGACACAGGACCCAGCTTGAAGG + Intergenic
1139770747 16:69274364-69274386 GGAGCTCTGGCCCAGCGTGGTGG + Intronic
1141137619 16:81476935-81476957 AGACCCCAGCCCCAGCGTGGAGG + Intronic
1141184825 16:81779570-81779592 GGACCCCGGGCACGGCGGGCCGG - Intronic
1141486446 16:84343351-84343373 GGACCCCGGGCCCAGCGTGATGG - Intergenic
1141609851 16:85175202-85175224 GGACCCGGGGCCCAGCTGGAGGG - Intronic
1142181474 16:88672961-88672983 AGACCCAGGGCCCAGCCTAACGG - Intergenic
1142230950 16:88900083-88900105 GGACGGCGGGCCCAGCGTGCAGG - Intronic
1203099311 16_KI270728v1_random:1291593-1291615 GGAGCCCGGGCCCAGCCTTCAGG - Intergenic
1143311526 17:5995081-5995103 GGAGCCGGAGCCCAGCGTGGGGG + Intronic
1143509420 17:7387261-7387283 AGACCCAGGGCCCAGGGTGGAGG - Intronic
1146373142 17:32277584-32277606 GGGCTCCAGGCCCAGCCTGAGGG - Intronic
1146844486 17:36174351-36174373 GGACGCCTGGCCCAGCCTCAGGG - Intronic
1146856790 17:36262286-36262308 GGACGCCTGGCCCAGCCTCAGGG - Intronic
1146863827 17:36326089-36326111 GGACGCCTGGCCCAGCCTCAGGG + Intronic
1146872701 17:36386196-36386218 GGACGCCTGGCCCAGCCTCAGGG - Intronic
1146880059 17:36437282-36437304 GGACGCCTGGCCCAGCCTCAGGG - Intronic
1147066687 17:37926677-37926699 GGACTCCTGGCCCAGCCTCAGGG + Intronic
1147094156 17:38130173-38130195 GGACGCCTGGCCCAGCCTCAGGG + Intergenic
1147103054 17:38190330-38190352 GGACTCCTGGCCCAGCCTCAGGG - Intergenic
1148490905 17:48023675-48023697 GGAGCCAGGGCCCAGCCAGACGG - Intergenic
1149712680 17:58756720-58756742 GGGGCCCGGGCCCGGCGGGAGGG - Intronic
1150085987 17:62273413-62273435 GGACGCCTGGCCCAGCCTCAGGG - Intronic
1150323984 17:64241046-64241068 GGAGCCTGGGCACAGGGTGAAGG - Intronic
1150488708 17:65560682-65560704 GGACCCGGCGCCCAGCGTTCCGG - Intronic
1151740473 17:75978856-75978878 GGCCCTCTGGCCCAGCGTTAGGG - Intronic
1152338783 17:79713167-79713189 GGCACCCAGCCCCAGCGTGAGGG - Intergenic
1152383765 17:79956539-79956561 GACCACCGGGCCCAGCGTGGTGG - Intronic
1160853802 19:1206898-1206920 GGACCCTGGGTCCAGCATGGAGG + Exonic
1160898157 19:1412503-1412525 GGTCCCCCGGCCCAGCAGGAAGG + Intronic
1160907472 19:1458226-1458248 GGACAGAGGGCCCAGGGTGACGG - Intronic
1161205068 19:3036546-3036568 CGAGCCCGGGGCCAGCGGGAGGG - Intronic
1161915604 19:7225755-7225777 GGACCCCTGGACCAGGGTGCTGG - Intronic
1161962171 19:7528981-7529003 GGACCTGGGGCCCAGGGTGTTGG - Intronic
1162376943 19:10310432-10310454 GGCCCCAGGGCCCAGATTGAGGG - Exonic
1162417498 19:10546931-10546953 GCACCCTGGGCCCAGCGTGGGGG - Exonic
1162533074 19:11246986-11247008 AGTCCCCTGGCCCAGCTTGAGGG - Intronic
1163019325 19:14474174-14474196 GGACACGGCGCCCAGCGTCATGG + Exonic
1165084481 19:33334098-33334120 GGAGCCTGGGCCAAGCGTGGTGG + Intergenic
1166139832 19:40799788-40799810 GGACCCGGGGCGGAGCGGGACGG - Exonic
1167291773 19:48628767-48628789 GGAGCCCGAGGCCAGCGTCACGG - Exonic
1168415770 19:56167227-56167249 AGACCCCGGGCCAGGCGTGGTGG - Intergenic
925141261 2:1551091-1551113 GGACGCCGGGGCCAGGGTGAGGG + Intergenic
926107768 2:10163002-10163024 GGGCCCGGGGCCCTGCGTGCAGG - Intronic
927971244 2:27307318-27307340 GGGCCCCCGGGCCAGCGGGAGGG - Exonic
929928186 2:46232182-46232204 GCAACACGGGCCCAGAGTGAGGG - Intergenic
930025434 2:47026487-47026509 GGACCCAAGGCCCCGCGAGAAGG + Intronic
932699754 2:73984791-73984813 GGGCCCCGGGCCGGGCGAGAGGG - Intergenic
932741112 2:74291810-74291832 GGACACCAGGCCCTGCCTGAGGG + Intronic
935627575 2:105184105-105184127 GGAGGCCGGGCCCAGGCTGAGGG - Intergenic
940883262 2:158968355-158968377 GGACCCGGTGCCCAGAGGGATGG + Intergenic
942149040 2:173056713-173056735 GGACCCAGGGCTCAGTGTGTGGG + Intergenic
942456385 2:176141006-176141028 AGACCCACGGCCCAGCGGGAGGG - Intergenic
942893148 2:181016898-181016920 GGACCAAGGGCCCAGAGAGAGGG + Intronic
947605765 2:231484131-231484153 GGCCCGCGGACCCAGCGTGGGGG + Intergenic
947814282 2:233025526-233025548 GGACCCCAGGGTCAGCTTGAGGG - Intergenic
948455192 2:238101539-238101561 GGACCCTGTGGCCAGCGGGAGGG + Intronic
1168773564 20:431132-431154 GGACCCCATGCCCAGCCTCAGGG + Intergenic
1168894404 20:1313465-1313487 GGGCCCCGGGCCCGGCCAGATGG - Exonic
1170890243 20:20369497-20369519 GTACCCCGGGCCCGACGAGAAGG + Exonic
1172458061 20:35093006-35093028 GGCCCCCGGGCCCAGCATTTCGG + Intergenic
1174869053 20:54166742-54166764 GGACACAGGGCCGAGCGTGGTGG + Intronic
1175922692 20:62457468-62457490 GGTCCCCGGGGCCTGTGTGAGGG - Intergenic
1175947256 20:62564659-62564681 GGAGCCCGGGCAGAGCGAGAGGG + Intronic
1176100285 20:63361498-63361520 GGACCGCGCGCCCAGGGGGACGG + Intronic
1176383871 21:6127401-6127423 GGTCCCTGGGCCCAGCCTGGAGG + Intergenic
1176517479 21:7796807-7796829 GGATCCTGGGTCCAGCGTGAAGG - Intergenic
1178440668 21:32595575-32595597 CGACCCCGGGCACAGAGTTAGGG - Intronic
1178651507 21:34426819-34426841 GGATCCTGGGTCCAGCGTGAAGG - Intergenic
1179654274 21:42835425-42835447 GAACCCAGGGGCCAGCCTGAGGG - Intergenic
1179739602 21:43410837-43410859 GGTCCCTGGGCCCAGCCTGGAGG - Intergenic
1180056946 21:45363874-45363896 GGCCCCCGGCCGCAGCATGAAGG - Intergenic
1180920586 22:19519656-19519678 GGACCCCAGGCCTGGCCTGAGGG - Intronic
1181513793 22:23400482-23400504 GGCCCCCGGGCCCATAGTCAGGG + Intergenic
1183633117 22:39045371-39045393 GGAGCGCGGGCCCAGGGTCAGGG + Intronic
1183742538 22:39676918-39676940 GGACCCTGGGGCCAGCCTGCTGG + Intronic
1184408316 22:44312672-44312694 GGACCCCAGGGTCAGCGTGAAGG + Intronic
1184478866 22:44735945-44735967 GGACCCCAGCCCCTGCCTGATGG + Intronic
1185138601 22:49087975-49087997 CCGCCCCGGGCCCCGCGTGAGGG - Intergenic
1185268835 22:49918989-49919011 GGACCCCGGATCCAGGGTGAGGG - Intronic
1185301092 22:50081604-50081626 GGACCCCGGGCCCTGAGTCGGGG + Intronic
1185343171 22:50300465-50300487 GGACTCCGGACCCAGGGTCAAGG + Intronic
1185412961 22:50695525-50695547 GGACCCAGGCCTCAGGGTGAGGG - Intergenic
954783158 3:53074965-53074987 GGGCCCCAGCCCCAGAGTGAGGG + Intronic
955058347 3:55474998-55475020 AGGCCCTGGGCCCAGCTTGAGGG + Intronic
955187728 3:56731249-56731271 GGCCCCCGGGCCCAGCCTGGAGG - Intronic
957169730 3:76722619-76722641 TGACCCTGGGGCCAGCCTGAGGG - Intronic
960047485 3:113211959-113211981 GGGCCCGGGGGCCAGCGTGGTGG - Exonic
961351822 3:126308939-126308961 GGATCGCTGGCCCAGGGTGAGGG + Intergenic
963710866 3:148746066-148746088 AGCCACCGCGCCCAGCGTGAAGG + Intergenic
964165327 3:153697618-153697640 GCAACGCGGGCCCAGCGTGGTGG - Intergenic
964344714 3:155744475-155744497 GGTCCCGGGACCCCGCGTGAGGG + Intronic
967762468 3:193241253-193241275 GGACGCCGAGCCCAGCGCGTCGG + Exonic
968518488 4:1024708-1024730 GGACGCCGGGCCCAGGGGGCGGG - Intronic
968668826 4:1836858-1836880 GGCCCCCGAGCCCAGAGTGCTGG - Intronic
968819952 4:2843343-2843365 GGCCCCCGGGCCCGGCCTGCGGG - Intergenic
969379203 4:6783056-6783078 GGGCTCCGGGGCCAGCCTGAGGG + Intronic
969379221 4:6783097-6783119 GGGCTCCGGGGCCAGCCTGAGGG + Intronic
969722885 4:8902830-8902852 GGACACAGGGGCCACCGTGAAGG - Intergenic
979099745 4:116599539-116599561 GGACACCGGGCACGGCGTCAGGG - Intergenic
979335304 4:119455156-119455178 GGTCCCCGGGCCCTGCCTGGGGG - Intergenic
980628814 4:135408218-135408240 GGAACCCAAGCCCAGCGTGCTGG + Intergenic
985345689 4:189002082-189002104 GGAGGCCGTGCCCAGCGGGAGGG - Intergenic
986743621 5:10725363-10725385 AAACCCCTGGCCCAGCGTGCAGG - Intronic
986744452 5:10731432-10731454 GGATCCCGAGCCCTGTGTGAGGG + Intronic
992611150 5:78509750-78509772 GGACCCCGGGCACGGTGGGATGG - Intronic
1001383022 5:171316287-171316309 CGACCCCGGGCCTAGTGTCAGGG - Intergenic
1002188441 5:177466859-177466881 GGCCCCCGGGCGCACCCTGACGG - Intronic
1003873994 6:10421310-10421332 CGACCTCGGGCCCAGCCGGACGG + Intergenic
1005995008 6:30925660-30925682 GGAGCCTGGGCCCAGCCGGAGGG - Exonic
1016914558 6:149232889-149232911 GTACCCCTGGCCCATCCTGAGGG + Intronic
1026899174 7:74027706-74027728 GGGCCCGGGGCCCAGCCGGAGGG + Intergenic
1033604645 7:142917737-142917759 GGACCCCGGGGACAGAGTGCTGG - Intronic
1038883587 8:31640024-31640046 GGCCCCCGGGCCCAGCGCCCCGG + Intronic
1039953064 8:42187412-42187434 GTTCCCCAGGCCCAGCCTGATGG + Exonic
1049411234 8:142474872-142474894 GAACCCAGGGCACAGCCTGACGG - Intronic
1049844601 8:144793663-144793685 GGACCCTGGGGGCAGGGTGAGGG + Intergenic
1053306205 9:36986331-36986353 GGGCCCGGGGCGCAGCGTGGAGG - Intronic
1055274732 9:74602032-74602054 GGGCCCCTGGCTCAGCATGATGG - Intronic
1057470043 9:95349361-95349383 TGAGCCCTGGCCCAGCGGGAAGG - Intergenic
1059424177 9:114210586-114210608 AGACCCCTGGCCCAGCCTGGAGG + Intronic
1062598567 9:137310041-137310063 GGACACAGGGCCCAGCCTTAAGG + Intronic
1203780338 EBV:97006-97028 GGACCCCGGGGTCAGGGTGATGG + Intergenic
1185627722 X:1494158-1494180 GGACCCCCTGCCTAGCTTGACGG - Intronic
1185783280 X:2867470-2867492 CGGCCCCAGGCACAGCGTGAAGG + Intronic
1196785843 X:119420819-119420841 GGCCACCAGGCCCAGCCTGAAGG - Intronic