ID: 1141488495

View in Genome Browser
Species Human (GRCh38)
Location 16:84356288-84356310
Sequence TCGCACTTGCCGGTTGCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141488486_1141488495 3 Left 1141488486 16:84356262-84356284 CCCACCAAAGGCTAGAACCTCCT No data
Right 1141488495 16:84356288-84356310 TCGCACTTGCCGGTTGCCTGGGG No data
1141488488_1141488495 -1 Left 1141488488 16:84356266-84356288 CCAAAGGCTAGAACCTCCTGCCT No data
Right 1141488495 16:84356288-84356310 TCGCACTTGCCGGTTGCCTGGGG No data
1141488485_1141488495 9 Left 1141488485 16:84356256-84356278 CCTTGTCCCACCAAAGGCTAGAA No data
Right 1141488495 16:84356288-84356310 TCGCACTTGCCGGTTGCCTGGGG No data
1141488487_1141488495 2 Left 1141488487 16:84356263-84356285 CCACCAAAGGCTAGAACCTCCTG No data
Right 1141488495 16:84356288-84356310 TCGCACTTGCCGGTTGCCTGGGG No data
1141488483_1141488495 15 Left 1141488483 16:84356250-84356272 CCTCTGCCTTGTCCCACCAAAGG No data
Right 1141488495 16:84356288-84356310 TCGCACTTGCCGGTTGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141488495 Original CRISPR TCGCACTTGCCGGTTGCCTG GGG Intergenic
No off target data available for this crispr