ID: 1141489540

View in Genome Browser
Species Human (GRCh38)
Location 16:84362884-84362906
Sequence CTGTGGGTACGGCGGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141489540_1141489552 19 Left 1141489540 16:84362884-84362906 CCGTCCTCCCGCCGTACCCACAG No data
Right 1141489552 16:84362926-84362948 CTGACTCCTCTAGCTACAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141489540 Original CRISPR CTGTGGGTACGGCGGGAGGA CGG (reversed) Intergenic
No off target data available for this crispr