ID: 1141490336

View in Genome Browser
Species Human (GRCh38)
Location 16:84368390-84368412
Sequence CGCTGTCCCCAGAGCCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 326}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141490323_1141490336 22 Left 1141490323 16:84368345-84368367 CCTGAGGCGACGCAGCCTCTCCC 0: 1
1: 0
2: 1
3: 8
4: 170
Right 1141490336 16:84368390-84368412 CGCTGTCCCCAGAGCCCCTGGGG 0: 1
1: 0
2: 0
3: 38
4: 326
1141490328_1141490336 2 Left 1141490328 16:84368365-84368387 CCCTGGGCCTTTCATGGCCAGCC 0: 1
1: 0
2: 0
3: 22
4: 207
Right 1141490336 16:84368390-84368412 CGCTGTCCCCAGAGCCCCTGGGG 0: 1
1: 0
2: 0
3: 38
4: 326
1141490327_1141490336 7 Left 1141490327 16:84368360-84368382 CCTCTCCCTGGGCCTTTCATGGC 0: 1
1: 1
2: 2
3: 38
4: 387
Right 1141490336 16:84368390-84368412 CGCTGTCCCCAGAGCCCCTGGGG 0: 1
1: 0
2: 0
3: 38
4: 326
1141490321_1141490336 28 Left 1141490321 16:84368339-84368361 CCAAGCCCTGAGGCGACGCAGCC 0: 1
1: 0
2: 1
3: 16
4: 142
Right 1141490336 16:84368390-84368412 CGCTGTCCCCAGAGCCCCTGGGG 0: 1
1: 0
2: 0
3: 38
4: 326
1141490322_1141490336 23 Left 1141490322 16:84368344-84368366 CCCTGAGGCGACGCAGCCTCTCC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1141490336 16:84368390-84368412 CGCTGTCCCCAGAGCCCCTGGGG 0: 1
1: 0
2: 0
3: 38
4: 326
1141490329_1141490336 1 Left 1141490329 16:84368366-84368388 CCTGGGCCTTTCATGGCCAGCCG 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1141490336 16:84368390-84368412 CGCTGTCCCCAGAGCCCCTGGGG 0: 1
1: 0
2: 0
3: 38
4: 326
1141490320_1141490336 29 Left 1141490320 16:84368338-84368360 CCCAAGCCCTGAGGCGACGCAGC 0: 1
1: 0
2: 1
3: 20
4: 81
Right 1141490336 16:84368390-84368412 CGCTGTCCCCAGAGCCCCTGGGG 0: 1
1: 0
2: 0
3: 38
4: 326
1141490331_1141490336 -5 Left 1141490331 16:84368372-84368394 CCTTTCATGGCCAGCCGGCGCTG 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1141490336 16:84368390-84368412 CGCTGTCCCCAGAGCCCCTGGGG 0: 1
1: 0
2: 0
3: 38
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141490336 Original CRISPR CGCTGTCCCCAGAGCCCCTG GGG Intergenic
900321298 1:2085598-2085620 CCCTGTTCTCAGAGCCCGTGAGG + Intronic
900321314 1:2085654-2085676 CCCTGTTCTCAGAGCCCGTGAGG + Intronic
900321330 1:2085710-2085732 CCCTGTTCTCAGAGCCCGTGAGG + Intronic
900321346 1:2085766-2085788 CCCTGTTCTCAGAGCCCGTGAGG + Intronic
900417499 1:2541883-2541905 CGCTGTCCTCACCGCCCCCGGGG + Intergenic
900464715 1:2820059-2820081 CGCTGACTCCAGAGCCCCATAGG - Intergenic
901166640 1:7226069-7226091 AGTTGTCCCCACATCCCCTGAGG + Intronic
901646575 1:10720045-10720067 TGCTCTGCCCAGAGGCCCTGTGG + Intronic
902379615 1:16046523-16046545 GGCTGTCCCCAGCGCACCAGTGG + Exonic
902550466 1:17216168-17216190 GGCTGTCACCAGAGCCTGTGTGG - Intronic
902839317 1:19065263-19065285 CGCTGTCCCCAGGGTCCGTTTGG + Intergenic
903291747 1:22318508-22318530 CCCTGTTCCCACCGCCCCTGGGG - Intergenic
904044162 1:27600286-27600308 CTCTGTCCCAAGAGACCCAGGGG + Intronic
904200375 1:28815609-28815631 CGCTCTCCCCACTGCCCTTGGGG - Intronic
904526391 1:31136943-31136965 CACAATCCCCAGAGCCCCAGAGG - Intergenic
904697450 1:32338225-32338247 CCAAGTCCCCAGAGCCCCAGAGG + Intergenic
908772673 1:67610482-67610504 TCCTGTCCCAACAGCCCCTGAGG - Intergenic
911188786 1:94927506-94927528 CGCTGGGCCCAGAGCCCGGGAGG - Intergenic
915571374 1:156747029-156747051 CTCTGTCCCCAGAGGCCACGGGG - Intronic
917674949 1:177310071-177310093 CTCTGTCCCCAGAGCAGCAGTGG - Intergenic
917872641 1:179255762-179255784 CGCTGGCCACACAGGCCCTGAGG + Intergenic
918099718 1:181363029-181363051 CTATGTCCACAGAGCCCTTGAGG - Intergenic
919929775 1:202213835-202213857 GTCTGACCCCAGAGCCACTGAGG + Intronic
919991729 1:202712032-202712054 AGCTGTGCTCACAGCCCCTGAGG + Intergenic
920371907 1:205484473-205484495 CGCTGTCCTCAAATGCCCTGGGG + Intergenic
920502758 1:206495873-206495895 AGCTGTACCCAGAGTCTCTGGGG - Intronic
920755332 1:208725173-208725195 CACTGTCCACTGTGCCCCTGGGG - Intergenic
921463207 1:215453645-215453667 CACAGTCCCCAAAGCACCTGGGG + Intergenic
923009214 1:230074898-230074920 CACTGCCTCCAGAGGCCCTGAGG - Intronic
923558899 1:235023514-235023536 CTCTGACCCCAGACACCCTGTGG + Intergenic
923764825 1:236883357-236883379 CGCTGCTCCCAGAGCCACAGTGG - Intronic
924887897 1:248239606-248239628 GACTTTCCCCAGAGCCCATGTGG - Exonic
1063158693 10:3403385-3403407 CCCAGTCCCCAGAGGCCCAGAGG - Intergenic
1065909209 10:30286862-30286884 CTGTGACCCCAGAGCCCCAGAGG + Intergenic
1067709302 10:48635639-48635661 CACTCTTCCCAGAGTCCCTGTGG + Intronic
1067730655 10:48808852-48808874 CCCTGTCCCCAGGGACCCAGAGG + Intronic
1067839734 10:49666160-49666182 AGCTGTCCCCTAAGTCCCTGAGG - Intergenic
1069505201 10:68991191-68991213 GCCTGGCCCCAGAGCCCCGGTGG - Intronic
1069545042 10:69321542-69321564 GTCTGTCTCCAGAGCCCCGGAGG - Intronic
1069651502 10:70053102-70053124 GCCTCTCCCCCGAGCCCCTGCGG + Intronic
1069737995 10:70670132-70670154 CAGAGTCCCCAGAGTCCCTGGGG + Intergenic
1069909477 10:71750741-71750763 GCCTGGCCCCAGAGCCACTGTGG + Exonic
1070629006 10:78071049-78071071 CCATGTCCCCTGTGCCCCTGTGG + Intergenic
1070742100 10:78909970-78909992 GACAGTCCCCTGAGCCCCTGAGG + Intergenic
1071526557 10:86362969-86362991 CGCTGGCCCCAGAGTCCCCATGG + Intronic
1071567087 10:86676918-86676940 GACTGTCCCCAGAGCCTCTCTGG + Intronic
1072578201 10:96719273-96719295 AGCTCTCCCCAGATCCTCTGAGG - Intronic
1074401462 10:113144286-113144308 CTCTGTCCACAGAGCCTCTGGGG - Intronic
1075780051 10:125011667-125011689 CGGGTTCCTCAGAGCCCCTGGGG + Intronic
1075788317 10:125065461-125065483 CGCCTTCCCCAAAGCCCCTGCGG - Intronic
1075897368 10:126008762-126008784 CCCTGTCCCCAGGACCACTGTGG + Intronic
1076501934 10:130944003-130944025 CGCTGTCCCCAGAGGAGATGAGG + Intergenic
1076695924 10:132247382-132247404 CTCTGTCCCCAGGGCCCATGAGG - Intronic
1076737217 10:132464257-132464279 CCCTGGCCCCAGGTCCCCTGTGG - Intergenic
1076909493 10:133379868-133379890 CACTGTCCCCAAGGGCCCTGTGG - Intronic
1076996846 11:301547-301569 AGCTGTGCCCTGAGCCCCTTGGG - Intergenic
1077288443 11:1777933-1777955 AGATGTCCCAAGAGCCCCTAGGG - Intergenic
1077413911 11:2415686-2415708 GGCTGTCCCCAAAGCCCAAGGGG - Intronic
1080115827 11:28620737-28620759 TGCTATCCCCAGAGCTCCTAGGG - Intergenic
1080666323 11:34339381-34339403 CATTGTCCCCACAGCCCCTCAGG - Intronic
1082821269 11:57546102-57546124 GGCTGTTCCCACTGCCCCTGAGG - Intronic
1082983140 11:59142780-59142802 CGCTGGCGGCAGAGCCACTGTGG - Exonic
1083593247 11:63907311-63907333 TGCTCTCTCCAGACCCCCTGTGG - Intronic
1083696164 11:64444100-64444122 CGCTGTCCACAGTTCCCCTCTGG - Intergenic
1084544423 11:69807606-69807628 CACTGTCCCTGGAGCCCCTGGGG + Intergenic
1084641792 11:70430607-70430629 CGCAGTCCCCAGACCCCATGGGG - Intronic
1084939998 11:72607347-72607369 GGCTGCCCCGAGAGCCTCTGTGG - Intronic
1085343071 11:75746198-75746220 CTGTGTGCCCGGAGCCCCTGGGG - Intergenic
1087868962 11:103267161-103267183 CTTAGTCCCCAGAGCCACTGAGG + Intronic
1089212964 11:116818984-116819006 TGCTGACTCCAGAACCCCTGGGG - Intergenic
1089365142 11:117916991-117917013 TGCTGCCCCCGGGGCCCCTGTGG - Intronic
1089780680 11:120871305-120871327 CGCTTTCCCCTGAGCACATGTGG - Intronic
1090437681 11:126700564-126700586 TGCTGTCCCCAGATCAGCTGAGG + Intronic
1090660692 11:128879890-128879912 AGCTGTCTCCAGGGACCCTGAGG + Intergenic
1091699529 12:2650796-2650818 CCCCTTCCCCAGGGCCCCTGAGG + Intronic
1091794421 12:3289436-3289458 ACCTGTTCCCTGAGCCCCTGCGG - Intergenic
1092228362 12:6763732-6763754 CGTTGGCCCCAGAGGCTCTGAGG + Intronic
1092253563 12:6914670-6914692 CGCCAGGCCCAGAGCCCCTGTGG + Intronic
1092793453 12:12088822-12088844 CACGGTCCCCTGAGCCTCTGTGG - Intronic
1094469568 12:30791261-30791283 CTGTGTCCCCAGAGCCCCCAGGG + Intergenic
1094743365 12:33314803-33314825 CCCTGTCACCACAGGCCCTGAGG - Intergenic
1096622172 12:52871811-52871833 CGCTTTCCCCAGCTCCCCCGAGG + Intergenic
1096678123 12:53236615-53236637 CCCTGTGCCCACATCCCCTGGGG + Intergenic
1099202116 12:79690062-79690084 CGGGGTGCCCAGAGCCCCCGCGG + Exonic
1102261375 12:111445407-111445429 CGCTGTGTCCAGTGCCCGTGTGG + Intronic
1103167418 12:118782384-118782406 GGCTGTCTCCAGGGCCTCTGTGG - Intergenic
1103987621 12:124778264-124778286 CGCAGGACCCACAGCCCCTGTGG + Exonic
1104016525 12:124965596-124965618 GGATGTGCCCAGAGCCCTTGTGG - Intronic
1104348989 12:128028652-128028674 CGCCCTGCCCACAGCCCCTGAGG - Intergenic
1104468250 12:129007517-129007539 GGCTGGTCCCAGAGACCCTGAGG + Intergenic
1104755934 12:131269374-131269396 CACTGTCCTCTGAGCCCCTGGGG + Intergenic
1104777778 12:131401307-131401329 CACTGTCCTCTGAGCCCCTGGGG - Intergenic
1104827470 12:131723596-131723618 GGCTGGCCCCACTGCCCCTGGGG + Intronic
1104927980 12:132323525-132323547 CGCTGCCCCCAGATTCGCTGGGG - Intronic
1104940315 12:132392050-132392072 CGCTCTCCCCAGGGACCCTCCGG + Intergenic
1104963264 12:132498084-132498106 CACCCTCCCCAGAGGCCCTGTGG - Intronic
1108382084 13:49864036-49864058 GGCTGTCCCCAAGGCCACTGTGG - Intergenic
1113318957 13:109213557-109213579 CTCTGTTCCTAGAGCTCCTGAGG + Intergenic
1113812432 13:113150762-113150784 CGTGGTCCCCAGGGCCCCAGAGG + Intergenic
1113876631 13:113598635-113598657 GGCTGTCCCCTGAGGACCTGGGG + Intronic
1116326820 14:43540818-43540840 CGGCTGCCCCAGAGCCCCTGAGG - Intergenic
1119437824 14:74609663-74609685 TGCTGCCCACAGAGCCCCAGGGG + Intronic
1121112567 14:91322211-91322233 CCCTGTACCCACAGCCCCTGGGG - Intronic
1121337784 14:93087840-93087862 GGCTGTACCCAGTGCCCCTTGGG - Intronic
1121465943 14:94115682-94115704 CTCTTTCTCCAGATCCCCTGGGG + Intronic
1121544180 14:94751466-94751488 CGCTGTTCCCACGGCCTCTGGGG + Intergenic
1121653465 14:95576831-95576853 CTCTGCCCCTGGAGCCCCTGGGG - Intergenic
1122172510 14:99888908-99888930 TCGTGTGCCCAGAGCCCCTGAGG - Intronic
1122288809 14:100668536-100668558 GGCTGTGTCCAGAGCCACTGGGG + Intergenic
1122956727 14:105074720-105074742 GGCTGTCCCCCCAACCCCTGTGG + Intergenic
1123071990 14:105646532-105646554 CTCTGTCCCCTGAGCTCCAGGGG + Intergenic
1123855626 15:24408173-24408195 AGTTGTACCCAGAGCTCCTGTGG + Intergenic
1123860534 15:24461744-24461766 AGTTGTACCCAGAGCTCCTGTGG + Intergenic
1123864156 15:24500356-24500378 AGTTGTACCCAGAGCTCCTGTGG + Intergenic
1123989517 15:25673095-25673117 TGCAGCCCTCAGAGCCCCTGAGG - Intergenic
1125605296 15:40936834-40936856 ATCTGGCCCCAGGGCCCCTGGGG + Exonic
1126370944 15:47946413-47946435 AGCTGTAGGCAGAGCCCCTGGGG + Intergenic
1127267177 15:57371775-57371797 AGCTTTCCCCAGAACCCCAGAGG - Intergenic
1129321716 15:74778724-74778746 GGCTGTCCCTTGAGCCACTGAGG + Intergenic
1132577924 16:672410-672432 CCCTGCCCCTGGAGCCCCTGGGG - Intronic
1132681736 16:1145285-1145307 CGCGGCCTCCAGAGCCCGTGAGG + Intergenic
1134569172 16:15276956-15276978 AGCTGTACCCCGAGCCTCTGGGG + Intergenic
1134733205 16:16479089-16479111 AGCTGTACCCCGAGCCTCTGGGG - Intergenic
1134934233 16:18232884-18232906 AGCTGTACCCCGAGCCTCTGGGG + Intergenic
1135113040 16:19705470-19705492 CGCTGTCCCCACAGCCGATGAGG + Exonic
1135323476 16:21511977-21511999 CGCGCTCCCCAGAGGCCCTGTGG - Intergenic
1135517525 16:23148590-23148612 CACTGCACCCCGAGCCCCTGGGG - Intronic
1136334964 16:29605242-29605264 CGCGCTCCCCAGAGGCCCTGTGG - Intergenic
1137432269 16:48427870-48427892 CTCTGCTCCCAGAGCCCCCGTGG - Intronic
1137603761 16:49773880-49773902 CACTGTCCCCAAGGCCCATGTGG - Intronic
1139490894 16:67285396-67285418 CGCTGACCGCGGAGGCCCTGGGG - Exonic
1140943553 16:79746661-79746683 TGATGTCCCCAGAGCCTCAGGGG + Intergenic
1141467291 16:84214749-84214771 CGCTGTCCCCACGGGCCCTATGG - Intergenic
1141490336 16:84368390-84368412 CGCTGTCCCCAGAGCCCCTGGGG + Intergenic
1141761769 16:86033315-86033337 CACTCTCCCCAGAGCCCGTTTGG + Intergenic
1142035678 16:87861061-87861083 CACGCTCCCCAGAGGCCCTGTGG - Intronic
1142210978 16:88808373-88808395 TCCTTTCCCCAGCGCCCCTGAGG + Exonic
1142286405 16:89173238-89173260 CCCTGTCCCCAGAGCAGGTGGGG - Intronic
1142409777 16:89910118-89910140 CGCCCTCCCTAGAGCTCCTGAGG + Intronic
1142694639 17:1627133-1627155 AGATGTCCTCAGAGCCCGTGGGG + Intronic
1143447643 17:7018617-7018639 CCCACTCCCCAGGGCCCCTGAGG + Intergenic
1143550340 17:7626859-7626881 CCCTGTCCCCAGAGCCCAGCCGG - Intronic
1143576681 17:7797944-7797966 CCCTGGCCCCAGATGCCCTGTGG + Intronic
1143749839 17:9020708-9020730 AGCCCTCCCCAGATCCCCTGAGG - Intergenic
1144081868 17:11770356-11770378 TGCTTTCCCCAGTGCCCCTGGGG + Intronic
1145125112 17:20293623-20293645 CACTCTCCCCACAGCCACTGAGG - Intronic
1146941118 17:36845192-36845214 CCCGGTGCCCAGAGCCTCTGAGG + Intergenic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1147418616 17:40310989-40311011 AGCTGTTACCAGAGCACCTGTGG + Intronic
1147592756 17:41695455-41695477 CGCAGTCCTCAGAGATCCTGTGG - Intergenic
1147602452 17:41754857-41754879 AGCTGTCCCCAGAGCTCCCTGGG + Exonic
1147989137 17:44322728-44322750 CCCTGTCCCCAGGGCACCAGTGG - Intronic
1148216305 17:45835642-45835664 CGTTGTCCCAAGAGCCACTTGGG - Exonic
1148243314 17:46014003-46014025 CACAGTCCCCAGCTCCCCTGGGG + Intronic
1149058358 17:52391392-52391414 CACTTTCCCCAGAGCAGCTGTGG + Intergenic
1151357649 17:73570088-73570110 GACTCTCCCCAGAGCCCCTCGGG + Intronic
1152031418 17:77845772-77845794 CACTGTCCCCAGAAGGCCTGCGG + Intergenic
1152125448 17:78443935-78443957 GTCTGTCCTCAGAGCACCTGTGG - Intronic
1152262237 17:79273485-79273507 CCCTGTGCCCAGAGTCCCAGTGG + Intronic
1152377318 17:79925513-79925535 CACGGTCCCCTCAGCCCCTGGGG - Intergenic
1152597845 17:81246548-81246570 CCCTGTCCTCAGAGCTCCTGGGG - Exonic
1152608792 17:81305746-81305768 GGCTCTGCCCAGAGCCTCTGGGG + Intergenic
1152747718 17:82048974-82048996 AGCTGATGCCAGAGCCCCTGCGG + Intronic
1155260767 18:24039753-24039775 TGCTCTCCCCAGACCCCATGTGG - Intronic
1155979494 18:32165736-32165758 AGCTGTCCTCAGTTCCCCTGTGG + Intronic
1157662729 18:49460212-49460234 CGCTGTCAGCACAGCCCCTCCGG + Intronic
1159743807 18:72207645-72207667 TGCTGTCCCTAGAGCTCCTGTGG + Intergenic
1160729967 19:637186-637208 CGCTCCCTCCAGAGGCCCTGGGG + Intergenic
1160912842 19:1482823-1482845 GGCTAGCTCCAGAGCCCCTGGGG + Intronic
1161408001 19:4101193-4101215 CGCCCTCCCCAGAGCCCCGGGGG - Intronic
1161574650 19:5048832-5048854 CCCTGTGCAGAGAGCCCCTGTGG + Intronic
1161582097 19:5086658-5086680 CTCTGCCCACAGAGGCCCTGGGG - Intronic
1162496483 19:11025982-11026004 TGCTGCCCCGAGAGCCCCTGGGG + Intronic
1162502096 19:11059921-11059943 CGCTGGCCCGAGAGCCCCCAAGG + Intronic
1163152224 19:15422366-15422388 CCAGGGCCCCAGAGCCCCTGAGG + Exonic
1163325332 19:16599850-16599872 TCCTGTCCTCAGAGCACCTGTGG - Intronic
1165116773 19:33533435-33533457 CCCTGCTCCCAGAGACCCTGAGG + Intergenic
1165152475 19:33769159-33769181 CACTGTCCCCACAGCCTCGGAGG - Intronic
1165156278 19:33790654-33790676 CTCTGTCCCCAGGGCCCTTGTGG - Intergenic
1165246593 19:34501485-34501507 AGATGTCCCCTGAACCCCTGGGG - Exonic
1165423253 19:35732597-35732619 AGCTGTCCCCCGGGCCCCCGTGG - Exonic
1165424769 19:35739753-35739775 CCCTGTCTCCAGGGCGCCTGGGG + Exonic
1165894295 19:39132144-39132166 GGCTGTACCCAGAGACCCTGAGG + Intronic
1166393511 19:42423350-42423372 CGCTGTCCCCACTGCCCCGTAGG + Intronic
1166805762 19:45485962-45485984 CGCTGTCCGCAAATCTCCTGGGG - Intronic
1167270040 19:48501372-48501394 ACCTGACCCCAGAGCGCCTGTGG - Exonic
1167486996 19:49768321-49768343 GGCTGACCCCAGAGCCCATGCGG - Intronic
1167627946 19:50604861-50604883 CCCAGTCCCCAGAGCCAGTGAGG - Intergenic
1168291512 19:55359808-55359830 TGCTGCCCCCAGAGTCCATGAGG + Exonic
925090904 2:1155561-1155583 GGCTGAGCTCAGAGCCCCTGGGG + Intronic
925205191 2:2000163-2000185 GGCAGTCCCCTGAGCCTCTGTGG + Intronic
925230950 2:2233423-2233445 TGATGTACCCAGTGCCCCTGCGG + Intronic
925644119 2:6018476-6018498 TGAAGTCCCGAGAGCCCCTGGGG - Intergenic
926075603 2:9940692-9940714 CTCCGGCCCCAGAGCCCCCGGGG + Intergenic
926095705 2:10079870-10079892 CGCCGTCCCCCGAGGCCCTGCGG + Intronic
926130862 2:10302639-10302661 CCCTGTCCCGAAAGCCACTGGGG + Intergenic
927554616 2:24023159-24023181 TGCTGTGCCCACAGCACCTGTGG + Exonic
928114211 2:28535377-28535399 CACTTACCCCAGAGGCCCTGTGG + Intronic
928719543 2:34103253-34103275 AGATGTCCACAGAGCCACTGAGG - Intergenic
929049053 2:37819143-37819165 CGATGCCCCCAGAGTCCTTGGGG + Intergenic
932776177 2:74529685-74529707 CGCCTTCCCAAGAGCCCCTGCGG - Exonic
934717701 2:96552992-96553014 GGCTGTTACCAGTGCCCCTGGGG + Intergenic
936062090 2:109301588-109301610 CACCGTCCCCAGGGCCTCTGTGG + Intronic
937237604 2:120440235-120440257 CGCTGCACCCAGAGTCCCTGAGG + Intergenic
937316113 2:120933079-120933101 CCCTCTCCCCAGGGCCACTGTGG - Intronic
937915815 2:127098228-127098250 CCCCATCCTCAGAGCCCCTGGGG - Intronic
938692858 2:133808260-133808282 CCTTGTCCCCAGAGGCCTTGGGG - Intergenic
940838485 2:158552192-158552214 AGCTGTCCCCAGAGCCTGTAAGG + Intronic
946002276 2:216492481-216492503 TGCTCTCCACAAAGCCCCTGGGG - Intergenic
946023521 2:216657823-216657845 CAGGCTCCCCAGAGCCCCTGTGG + Intronic
947637050 2:231685484-231685506 CACTGCCCCCAGAGCCCAGGAGG - Intergenic
947750575 2:232529982-232530004 CGTGGACCCCAGAGCCCCTCTGG + Exonic
948273148 2:236689007-236689029 CCCTGTCTCCTGAGTCCCTGCGG - Intergenic
948461664 2:238132664-238132686 CGCAGCACCCAGAGCCCCCGAGG - Exonic
948566123 2:238887587-238887609 CACACTCCTCAGAGCCCCTGTGG + Intronic
948939838 2:241190238-241190260 CCCTGGGCCCAGAGCCTCTGGGG + Intronic
948939985 2:241190791-241190813 CTCTGTCCTCAGGGCCCCTTTGG + Intronic
949026942 2:241770717-241770739 CCCAGTCCCCAGAGGCCCAGCGG - Intergenic
1169130875 20:3165913-3165935 CGCCCTCCCCAGAGCCCAGGTGG + Exonic
1169289500 20:4336677-4336699 GGTTCTCCCCAGAGCCCTTGAGG - Intergenic
1171192230 20:23166771-23166793 GGCTCTTCCCAGAGCCACTGGGG - Intergenic
1171349540 20:24492149-24492171 GGCTCTCCCCAGCGTCCCTGCGG - Intronic
1172113047 20:32558757-32558779 CTTTGTCCTAAGAGCCCCTGGGG + Intronic
1172623602 20:36335065-36335087 AGCTGGCACCTGAGCCCCTGGGG + Intronic
1172770889 20:37381984-37382006 GCCTGTCCCCTGTGCCCCTGGGG - Intronic
1173201233 20:40956731-40956753 CACTCTCCCCATTGCCCCTGCGG + Intergenic
1173839271 20:46146558-46146580 CACTATCCCTAGAGCCCTTGAGG - Intergenic
1175213379 20:57375738-57375760 AGCTGTACTCAGAGTCCCTGTGG + Intronic
1175231659 20:57477256-57477278 CGCAGTTACCAGAGCCCCTGTGG - Intergenic
1175337587 20:58206259-58206281 AGCTGGCCACACAGCCCCTGAGG + Intergenic
1175926323 20:62473310-62473332 AGGTGACACCAGAGCCCCTGGGG - Intronic
1176078194 20:63258688-63258710 AGCTGTCCGCAGAGCCTGTGCGG + Intronic
1176121901 20:63457808-63457830 TGCAGCTCCCAGAGCCCCTGGGG - Intronic
1176179642 20:63743233-63743255 CGCTGTCCCCTTAGCCCCAAGGG + Exonic
1176179650 20:63743247-63743269 GGCTGCCCCCAGGGCCCTTGGGG - Exonic
1179618927 21:42599705-42599727 AGCAGTCCCCACAGCCCCAGTGG - Intergenic
1179732633 21:43376134-43376156 CGCTGACCTCAGTGCCTCTGTGG - Intergenic
1179953215 21:44723525-44723547 AGCCGTCCCCAGGGCCCCGGGGG + Intergenic
1180004388 21:45013339-45013361 CTCTGTCCCCAGAGGGCCGGTGG - Intergenic
1180141188 21:45894119-45894141 CTCAGTGCCCAGAGCCCCAGAGG - Intronic
1180213993 21:46313444-46313466 AGCTGGACTCAGAGCCCCTGAGG - Intronic
1181009982 22:20034616-20034638 CAATGTCCCCATAACCCCTGGGG + Intronic
1181112665 22:20611099-20611121 CGCTCTCCCCAGTGACTCTGAGG + Intergenic
1181172775 22:21019218-21019240 AGCTGTCCCCTGAGCCCTGGTGG + Intronic
1181264973 22:21625642-21625664 TGCTGCCCCCACAGCCCCTGTGG + Intergenic
1181560425 22:23696715-23696737 CCCTGTCCTCTGATCCCCTGCGG - Intronic
1183230383 22:36578445-36578467 AGGTCTCCCCAGAGCCCCAGTGG - Intronic
1183288729 22:36984573-36984595 CGCTGACCCCAAATCACCTGGGG + Intergenic
1183406004 22:37631004-37631026 CCGTGTCCCCAGAGCCCCCCAGG + Exonic
1184164847 22:42720962-42720984 CCCGGTCCCCAGAGCCCTTGCGG + Intronic
1184257898 22:43297363-43297385 ACCTGACCCCAGAGACCCTGTGG - Intronic
1184675946 22:46043621-46043643 CTCAGCCCCAAGAGCCCCTGAGG - Intergenic
1184904010 22:47466769-47466791 CGTTGTCCCCAGTGACCCTCAGG - Intronic
1185011615 22:48317747-48317769 CTGTCTCCCCAGAGCCCCTCTGG + Intergenic
1185045512 22:48526574-48526596 TGCTGGCCCCGGAGCTCCTGCGG + Intronic
1185097870 22:48821528-48821550 GGCTGCCCAAAGAGCCCCTGGGG + Intronic
1185233914 22:49700092-49700114 CCCTGTCCCCTGAGGCCTTGAGG - Intergenic
1185338273 22:50280423-50280445 CACCAGCCCCAGAGCCCCTGCGG + Intronic
949537833 3:5009646-5009668 GCCTGTCCCCAGAGTCCCTGGGG - Intergenic
950942319 3:16905194-16905216 CGCTGTGCCCACACACCCTGGGG - Intronic
953160167 3:40411846-40411868 AGATGTCCCCAGAGCCTTTGAGG + Exonic
953472022 3:43175774-43175796 TGCTGTTTCCAGAGCCTCTGGGG - Intergenic
953667080 3:44933248-44933270 CCCTGTCCCGGGAGCCCGTGAGG - Intronic
954292749 3:49658297-49658319 CTCTGGCCCCAGAGGCCCAGGGG + Intronic
954747189 3:52793993-52794015 CTCTGCACCCAGAGCTCCTGGGG - Intergenic
956912635 3:73835006-73835028 AGCTGGCCCCTGGGCCCCTGGGG - Intergenic
960998989 3:123359663-123359685 CTCTGCCCCCAGGGTCCCTGAGG - Intronic
961476693 3:127151126-127151148 GGCTGTCCCCAGCCTCCCTGTGG - Intergenic
962344114 3:134607400-134607422 GGGTGGGCCCAGAGCCCCTGGGG - Intronic
962578933 3:136780211-136780233 TGCTGGCCCCAGTGCACCTGTGG - Intergenic
964160120 3:153636528-153636550 GGCTGTCCCCACTGCCTCTGAGG - Intergenic
965825544 3:172725768-172725790 CGCTGTTCGCAGAGGCTCTGTGG + Intergenic
967873562 3:194251521-194251543 CCCTTTCCCCAGGGCCCCTGTGG + Intergenic
968123483 3:196142327-196142349 CTCTGAGCCCAGAGTCCCTGTGG + Intergenic
968360042 3:198140160-198140182 GGCTGTCCCCAGAGGCGATGAGG + Intergenic
969054378 4:4392497-4392519 TGCAGTTTCCAGAGCCCCTGTGG + Intronic
969115443 4:4868119-4868141 CTGTGTCACCAGAACCCCTGTGG - Intergenic
969325356 4:6440966-6440988 CACTGTCCCCAGAGCTCCCATGG - Intronic
969431643 4:7158481-7158503 CGCTGTGCCCGGACCCCCTTGGG + Intergenic
971478737 4:27095625-27095647 CCCTATCCCCTGAGCCCCTGTGG - Intergenic
982657722 4:158170579-158170601 CGCTGTGGCCCTAGCCCCTGTGG - Exonic
985537584 5:473606-473628 CGCTGTCCCGGGACCCCCGGCGG - Intronic
989101396 5:37826581-37826603 AGCAGACCCCAGAGCCCATGAGG + Intronic
989996019 5:50832627-50832649 GGCTGTGCCCTTAGCCCCTGAGG - Intronic
990023643 5:51159618-51159640 CCCTGTCCCCAGAGGCTCAGGGG + Intergenic
995657522 5:114443637-114443659 TGCTTTCCTGAGAGCCCCTGAGG - Intronic
996994021 5:129672476-129672498 TTCTGTCCACAGAGTCCCTGTGG - Intronic
997978525 5:138454426-138454448 GGCTGTGCCCAGAGCCAGTGTGG + Intergenic
998726220 5:145017695-145017717 CTCTCTCCCCAAAGCCTCTGTGG - Intergenic
999251545 5:150185344-150185366 AGCTGGCACCAGAGCCCCCGGGG - Intergenic
999735257 5:154508312-154508334 CCCTGTGGCCAGAGCCTCTGAGG + Intergenic
1001130660 5:169060929-169060951 CTCTGACCCCACAGCCCCTGTGG - Intronic
1002029337 5:176416443-176416465 CGCTGTCACCCGAGCCGCGGGGG + Exonic
1002310810 5:178312667-178312689 GGCTGTCCCCAGTGCGGCTGAGG - Intronic
1007421947 6:41724802-41724824 CGCTTCCCCCACAGTCCCTGCGG - Intronic
1008777728 6:55061753-55061775 CCCTGTCCTCAGACACCCTGAGG + Intergenic
1009598770 6:65771459-65771481 CTCTTCCCCCAGAGCCCCCGGGG - Intergenic
1011622669 6:89257481-89257503 CCCTGACCCCAGACCCCGTGGGG - Intronic
1014449333 6:121565349-121565371 GGCTGGGCCCAGAGTCCCTGTGG + Intergenic
1017788037 6:157772562-157772584 TGCTCTCCCCAGAGGCTCTGGGG - Intronic
1018808323 6:167278341-167278363 GGGTGTCCCCAGGGCCCGTGAGG + Intronic
1018837458 6:167496074-167496096 AGATGTCCCCAGGGTCCCTGTGG - Intergenic
1019137860 6:169922385-169922407 CCCTCCCCCCACAGCCCCTGTGG - Intergenic
1019444641 7:1065018-1065040 CGCTTTCTGCAGAGCCCCTTGGG + Intronic
1019840676 7:3439858-3439880 TGCTGTCCTCAGATGCCCTGAGG + Intronic
1020278577 7:6638380-6638402 CGCTGCCCTCAGAGCCCTTCGGG - Intronic
1023058462 7:36308201-36308223 GACTGTCCCCAGAGACTCTGGGG + Intergenic
1024059922 7:45690090-45690112 TGCTTTCCTCAGGGCCCCTGTGG - Intronic
1024561065 7:50645805-50645827 AACTGTCACCAGAGCCCCAGTGG + Intronic
1024675241 7:51632248-51632270 CGCTGTTCCAAGAGCCACTTAGG - Intergenic
1025012405 7:55407906-55407928 CGCTGTCCTCAGTGCACCGGAGG - Intronic
1026133101 7:67636636-67636658 GGCTGTCTCCAGAACCCATGAGG - Intergenic
1026866380 7:73826572-73826594 CCCTGTCCCCAGAGTTCCAGGGG - Intronic
1026869061 7:73839939-73839961 CACAGGCCCCAGAGCCCCTCAGG - Intronic
1026944539 7:74307243-74307265 CGCTGTCCCCAGAGGCCAGGGGG + Intronic
1027247959 7:76379986-76380008 GGATGTCCCCAGAAGCCCTGAGG + Intergenic
1027708556 7:81567400-81567422 CTGTGACCCCAGAGCCCCAGAGG - Intergenic
1028035258 7:85973044-85973066 CGCACTCCTCAGAGCCACTGGGG - Intergenic
1029110011 7:98208966-98208988 GCCTGTCCCCAGGGCCCCGGTGG + Exonic
1029124492 7:98287196-98287218 CGCTCTCCCCAGAGACCCGGGGG + Intronic
1029250532 7:99233020-99233042 TGCTGTCTCTACAGCCCCTGGGG - Intergenic
1029582735 7:101448101-101448123 CGATGCACCCAGAACCCCTGGGG + Intronic
1029600168 7:101558679-101558701 CCCTGGCCCCAGAGGCCTTGAGG - Exonic
1029606526 7:101602534-101602556 CGCCTTCCCCAAAGCCTCTGGGG - Intergenic
1029952347 7:104600463-104600485 TGCTGTCACCAGAGCCACTGGGG + Intronic
1030018286 7:105246229-105246251 CACCGACCCCAGAGCCCCTAAGG + Intronic
1030048893 7:105521520-105521542 AGCAGTCCCCAGAGCCCGCGTGG + Intronic
1032781032 7:135165433-135165455 CCATGTCCCCAGAGACACTGAGG - Exonic
1035019709 7:155793781-155793803 GGCTGCCACCAGAGCCACTGGGG - Intergenic
1035312829 7:157980908-157980930 CCCTGTCCCCAGTGCCCGTGTGG - Intronic
1035312849 7:157980968-157980990 ACCTGTCCCCAGAGCCCGTGTGG - Intronic
1035909822 8:3554406-3554428 GGCTCTCCCCAGACCCCCAGAGG - Intronic
1036171548 8:6490381-6490403 CAATGTCCCCAAAGTCCCTGAGG - Intronic
1036387716 8:8296323-8296345 TGGTGTCCCCAGTGCCCCTGCGG - Intergenic
1037776000 8:21835993-21836015 CGATGTCCCCTGAGGCCTTGTGG - Intergenic
1040311178 8:46237621-46237643 CAATGTCCCCTGAGTCCCTGTGG - Intergenic
1046915243 8:119672495-119672517 GGCTGTGCCCACTGCCCCTGCGG + Intronic
1047928283 8:129701993-129702015 AGCTGTCCACAGAGCTCCAGGGG - Intergenic
1048860620 8:138722227-138722249 CCCTGTCTCCAGAGCGACTGTGG + Intronic
1049018368 8:139937472-139937494 CGCTGTCCCCGCAGCGCCTTGGG - Intronic
1049216203 8:141409497-141409519 GGCGATGCCCAGAGCCCCTGAGG + Intronic
1049216459 8:141410501-141410523 CGGTGTCCTCACAGCCCCTGTGG + Intronic
1049420270 8:142513378-142513400 CCCTGGCACCAGAGCCCCTTGGG + Intronic
1049575957 8:143389742-143389764 CCCGGTGCCCAGAGCCCCTGGGG + Intergenic
1049654100 8:143790211-143790233 CGGTGAACCCGGAGCCCCTGAGG + Intergenic
1049685642 8:143938232-143938254 TGCTGTCCCCACAGGCCCAGAGG - Exonic
1049813944 8:144589386-144589408 TCCTGTCCCCTGAGCCCCTCTGG - Intronic
1056378748 9:86038394-86038416 CGCATTACCCAGAGCTCCTGCGG + Intronic
1057361139 9:94374720-94374742 CGCGGGCCGCAGAGCCCATGAGG + Exonic
1057662222 9:97013444-97013466 CGCGGGCCGCAGAGCCCATGAGG - Exonic
1057860242 9:98635249-98635271 GGCTGTCCCCAAATGCCCTGTGG - Intronic
1058561970 9:106239956-106239978 CTCGTTCCCCAGGGCCCCTGGGG - Intergenic
1059362171 9:113753461-113753483 CCCTGTCCCCTGAGCCCTTCTGG - Intergenic
1060001378 9:119961983-119962005 CGCTGTGGCCAGCGCGCCTGCGG + Intergenic
1060945554 9:127568062-127568084 AGCTGTCCCCAAGGCTCCTGGGG - Intronic
1061661958 9:132136307-132136329 TGGAGTCCCCAGATCCCCTGGGG + Intergenic
1061947246 9:133915173-133915195 TGATGTCCCCAGAGCCAATGAGG - Intronic
1062046444 9:134426682-134426704 CACTGCCCCGAGAGCCCCTGAGG - Intronic
1062075067 9:134583450-134583472 GTCTGTCCCCAGGGCCCCGGTGG - Intergenic
1062151302 9:135020575-135020597 CCCTGTCCCCATGGCCCCAGGGG + Intergenic
1062310250 9:135931562-135931584 TTCAGTCCCCAGAGGCCCTGAGG - Intergenic
1062457557 9:136646691-136646713 CCCTGGCTCCACAGCCCCTGGGG + Intergenic
1189567673 X:42260206-42260228 AGCTTTACCCAGAGGCCCTGAGG - Intergenic
1199718664 X:150525882-150525904 CTCTGGCACCAGAGCCCCCGGGG + Intergenic
1200097440 X:153670815-153670837 CTGTGTCCCCAGAGATCCTGGGG + Exonic