ID: 1141492861

View in Genome Browser
Species Human (GRCh38)
Location 16:84386590-84386612
Sequence GAGTGTGACACCAGCGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141492861_1141492864 9 Left 1141492861 16:84386590-84386612 CCTTGCTCGCTGGTGTCACACTC 0: 1
1: 0
2: 0
3: 13
4: 151
Right 1141492864 16:84386622-84386644 ATGCACACACAGACGCACACAGG 0: 1
1: 3
2: 47
3: 314
4: 2785
1141492861_1141492865 24 Left 1141492861 16:84386590-84386612 CCTTGCTCGCTGGTGTCACACTC 0: 1
1: 0
2: 0
3: 13
4: 151
Right 1141492865 16:84386637-84386659 CACACAGGTACTACCTAGAAAGG 0: 1
1: 0
2: 0
3: 11
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141492861 Original CRISPR GAGTGTGACACCAGCGAGCA AGG (reversed) Intronic
900075006 1:807272-807294 CAGTGAGACACCAGCCAGCATGG + Intergenic
900116472 1:1031318-1031340 GAGTGTGAGATCAGGGACCAGGG + Intronic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
900977221 1:6025408-6025430 GAGTGAGTCACCAGAGAGCCTGG + Intronic
902359736 1:15935891-15935913 GAAGGTGCCACCAGCCAGCAAGG + Exonic
902726638 1:18340525-18340547 GAATGTGAGTCCAGGGAGCAAGG - Intronic
904052145 1:27646199-27646221 AAATGTGACACCAGGGATCATGG + Intergenic
909271240 1:73626645-73626667 TAGTGAGACACCAGCCAGGATGG + Intergenic
912415854 1:109508026-109508048 AAGTGTGACACCAAGCAGCAAGG - Exonic
913210172 1:116575814-116575836 CAGGGTGACACCAGCCATCATGG + Exonic
914403103 1:147342366-147342388 CAGTGTGACAGAAGCTAGCATGG + Intergenic
914448781 1:147772641-147772663 GCATGTGAAACCAGCGAGGAAGG - Intronic
918128748 1:181606741-181606763 GATTCTGACACAAGCCAGCATGG - Intronic
918191916 1:182183933-182183955 GAGTGTCACAGCAGCCATCATGG - Intergenic
918526694 1:185472585-185472607 GAGTGTTAGAGCAGCGAGAAAGG - Intergenic
921885932 1:220305828-220305850 GAGTTTGAGACCAGCCAACATGG + Intergenic
922270845 1:224032171-224032193 CAGTGAGACACCAGCCAGCATGG + Intergenic
922620963 1:226987851-226987873 GACAGTGACACCTGCCAGCACGG + Intergenic
923164059 1:231342629-231342651 GAGTTTGAGACCAGCCAACATGG - Intronic
924012170 1:239677101-239677123 GAGGGTGACATCACAGAGCAGGG - Intronic
1064737580 10:18398457-18398479 GAGTTTGAGACCAGCCAGCCTGG + Intronic
1065726502 10:28672345-28672367 GAGTTTGAGACCAGCAAGCCCGG - Intergenic
1067551409 10:47238870-47238892 GAGGGTGTCACCTGCGAGGATGG + Intergenic
1070169924 10:73925272-73925294 GAGTTTGAGACCAGCCAGCCTGG - Intergenic
1076797432 10:132805088-132805110 GTGTGTGACCCCAGTGAGTATGG + Intergenic
1077036784 11:499234-499256 GGGTGTGATACCAGGGAGCACGG + Intronic
1077917041 11:6618198-6618220 CAGTGTGACACTAGTGTGCATGG - Intronic
1082046049 11:47728448-47728470 GAGTTTGAGACCAGCCAACATGG - Intronic
1083279551 11:61618358-61618380 GAGTTTGAGACCAGCCAACATGG - Intergenic
1084639794 11:70418399-70418421 GTGTGTGACTCCAGGGAGCCAGG + Intronic
1088742654 11:112779580-112779602 CAGTGTGACACAAGATAGCAAGG + Intergenic
1089352631 11:117830113-117830135 GAGTTTGAGACCAGCCAACATGG - Intronic
1089665303 11:120014217-120014239 GAGTGTGGCAGCAGCTGGCAGGG - Intergenic
1090364540 11:126194858-126194880 GAGTTTGAGACCAGCCTGCATGG + Intergenic
1093393837 12:18656076-18656098 GAGAGTGACACCAGCAAAAATGG + Intergenic
1095330174 12:40950829-40950851 GAGAGTGACATCAGCTAACATGG - Intronic
1096752935 12:53774196-53774218 GAGTTTGAGACCAGCAAACATGG - Intergenic
1101257036 12:102988809-102988831 AAGTGTGACACCAGCTTGCTGGG - Intergenic
1102512607 12:113425785-113425807 GAGTTTGAGACCAGCCAACATGG + Intronic
1108884519 13:55164100-55164122 GAGTTTGACCACAGCGTGCAAGG - Intergenic
1111300428 13:86342281-86342303 TAGTGAGACACCAGCTGGCATGG - Intergenic
1116085777 14:40236323-40236345 TAGGGAGACACCAGCGGGCATGG - Intergenic
1117404259 14:55386605-55386627 GAGTGTGGCAGCAACCAGCAGGG + Intronic
1119474676 14:74920235-74920257 GGGTGTGACAGCCGCCAGCAAGG - Intronic
1121537974 14:94704180-94704202 GTCTGTGACACCACTGAGCAGGG + Intergenic
1121900854 14:97692297-97692319 GGAAGTGACACCAGCAAGCAAGG - Intergenic
1122043189 14:99004801-99004823 GAATGGGACAGCAGGGAGCAGGG + Intergenic
1124633650 15:31351632-31351654 GAGTGTGCTACCCGCAAGCAAGG + Intronic
1129614188 15:77084776-77084798 GACTGGGACACCAGAGAGCTGGG + Intergenic
1132630403 16:914545-914567 GAGTGTGTCACCAGTGGTCATGG - Intronic
1132630413 16:914585-914607 GAGTGTGTCACCAGTGGTCATGG - Intronic
1132630463 16:914779-914801 GAGTGTGTCACCAGTGGTCATGG - Intronic
1135466235 16:22687625-22687647 GAGTGTGACACCATCTTGAAGGG - Intergenic
1135669978 16:24367017-24367039 GAGTTTGAGACCAGCCAACATGG - Intergenic
1135739079 16:24957862-24957884 GAATGTGACACCAGAGTCCACGG + Intronic
1135918266 16:26625329-26625351 GAGTTTGAGACCAGCCAACAGGG - Intergenic
1139803285 16:69542057-69542079 GAGTTTGAGACCAGCCAACATGG - Intergenic
1140166598 16:72558788-72558810 GAGTTTGAGACCAGCTAACATGG + Intergenic
1140246100 16:73251356-73251378 GATAATGACAACAGCGAGCACGG + Intergenic
1140783891 16:78321650-78321672 GAGTGGTACACCAGAGTGCATGG + Intronic
1140928021 16:79601095-79601117 GAGTGAGCCCCCAGCGAGCTGGG - Intergenic
1141492861 16:84386590-84386612 GAGTGTGACACCAGCGAGCAAGG - Intronic
1141960918 16:87407834-87407856 GAGTTTGCCAGCAGCGAGCTCGG - Exonic
1142105544 16:88300487-88300509 GAGTATGGCAGCACCGAGCATGG - Intergenic
1142522846 17:517288-517310 GAGAGTCAAACCAGCTAGCAAGG + Exonic
1144021362 17:11241747-11241769 GAGTGTAACAACAGCGAGAGCGG + Exonic
1146662579 17:34674480-34674502 GAGTGGGACACCAGGGAGGATGG - Intergenic
1148411568 17:47471754-47471776 GAGTTTGAGACCAGCCAGCCTGG + Intergenic
1148803352 17:50247954-50247976 GAGTTTGAGACCAGCCAACATGG - Intergenic
1149591163 17:57830934-57830956 GAGTGTGACATCAGGGACAAGGG - Intergenic
1149696011 17:58616627-58616649 GACTTTGACACCAGCCAACATGG - Intronic
1152448068 17:80357764-80357786 GAGTTTGAGACCAGCCAGCTAGG + Intronic
1157418102 18:47522845-47522867 GAGTGTGACACCAGTGCATAAGG + Intergenic
1158981909 18:62771011-62771033 GAGTTTGAGACCAGCCAACATGG + Intronic
1159816399 18:73078990-73079012 GAGGGTGATACCACAGAGCACGG - Intergenic
1160821861 19:1062647-1062669 GACCGTGACCCCAGCGAGAAAGG - Intronic
1161942803 19:7416190-7416212 GAGTTTGAGACCAGCCAGCCTGG + Intronic
1163000547 19:14363923-14363945 GAGAGAGACACCAGGGAGCCTGG - Intergenic
1165063364 19:33215742-33215764 GTGTGGGGCACCAGCGGGCAGGG - Intronic
1166081882 19:40448884-40448906 GAGTTTGAGACCAGCCAACATGG + Intronic
1167049562 19:47070088-47070110 GTGTGTGACACATGTGAGCATGG + Intronic
1167297661 19:48661369-48661391 GAGTGTGCCAGCATCGATCAGGG + Intergenic
1167962873 19:53121626-53121648 GAGTTTGAGACCAGCAAACATGG - Intronic
924986991 2:281052-281074 CAGTGAGACACCAGAGGGCAGGG - Intronic
925269206 2:2590338-2590360 GAGGGGGACACCTGGGAGCAAGG - Intergenic
926804503 2:16694014-16694036 GAGTGTGAAGCCAGCTGGCAAGG - Intergenic
927101282 2:19789454-19789476 GAGGGTGAAAGCAGGGAGCAGGG + Intergenic
928892433 2:36219388-36219410 GAGTTCGACACCAGCGTGCAGGG - Intergenic
932396414 2:71451861-71451883 GAGTGTGAGAACAGAGAGCAGGG - Intergenic
934993455 2:98936805-98936827 GGGTGTGACACCGGCGAGTGTGG + Intergenic
942906187 2:181183784-181183806 GAGGCTGTCACCAGCAAGCATGG + Intergenic
943041763 2:182812698-182812720 GCTTGTGAAACCAGCGAGCTGGG - Intergenic
949082717 2:242117512-242117534 CAGTGAGACACCAGCCAGCATGG - Intergenic
1170455487 20:16529000-16529022 GAGTGTGACGCCACTGAACAAGG + Intronic
1172232595 20:33347158-33347180 GAAGGTAACACCAGTGAGCAGGG + Intergenic
1172455199 20:35066001-35066023 GAGTGTGACATCTGCATGCATGG - Intronic
1173694537 20:44997484-44997506 GAGTTTGAGGCCAGCCAGCATGG + Intronic
1174019292 20:47517015-47517037 GAGTTTGAGACCAGCCAGCATGG + Intronic
1175964319 20:62652874-62652896 GAGTGCCACACGAGCGTGCACGG + Intronic
1176186408 20:63782339-63782361 GAGGGTGACAGAAGCGAGGATGG + Intronic
1179460348 21:41530623-41530645 GAATGTGCCACTAACGAGCAGGG + Intronic
1180034342 21:45236067-45236089 GAGTGTGGCAGCAGCCAGGAGGG + Intergenic
1181762573 22:25068202-25068224 GACTGTGCCATCAGGGAGCAGGG + Intronic
1184227475 22:43137410-43137432 GTGTCTGCCACCAGCCAGCAGGG + Intronic
954369714 3:50163759-50163781 CAGTGTGGCACCAGGGAGCTGGG + Intronic
955037879 3:55286423-55286445 GACTGTGACACAAGCAAGAAAGG + Intergenic
956261599 3:67349403-67349425 GACTGTGAAACCAGACAGCATGG + Intergenic
957851055 3:85807975-85807997 GCCTTTGACACCAGCCAGCAGGG + Intronic
959190544 3:103104891-103104913 GAGTGGGACAGCAGAGAGCCTGG - Intergenic
959248193 3:103902771-103902793 GAGTTTGATACCAGCGGGCATGG - Intergenic
965484789 3:169265593-169265615 GTGTGTGACATCAGAGAGCTGGG + Intronic
968840777 4:3003922-3003944 GAGTTTGAGACCAGCCAACATGG - Intronic
969616413 4:8255471-8255493 GAGTTTGAGACCAGCCAACATGG - Intergenic
970054171 4:11951972-11951994 GAGTTTGAGACCAGCCAACATGG + Intergenic
971347016 4:25820931-25820953 GAGTTTGAGACCAGCCAACAAGG - Intronic
973735536 4:53868014-53868036 GAGTGAGACACCATGGAGTATGG - Intronic
979266597 4:118710445-118710467 GTGTGTGACAACTGCAAGCAAGG - Exonic
979656190 4:123197438-123197460 TAGAGTGACACTAGAGAGCATGG - Intronic
980103816 4:128567724-128567746 GAGCCTGACTCCAGGGAGCAGGG - Intergenic
982288394 4:153757746-153757768 GAGTGTGAGAGCAGAGACCATGG - Intronic
984688106 4:182694317-182694339 GAGTGTGAGACCAGCCCGCCTGG - Intronic
987305082 5:16629910-16629932 CATTGTGACACCACTGAGCAGGG + Intergenic
987382882 5:17302197-17302219 AAGTGTGACAGCAGTGAGCAAGG - Intergenic
988608596 5:32703851-32703873 TAGTGAGACACCAGCCAGGATGG - Intronic
997427580 5:133814456-133814478 GAGAGTGACACCACCCAGCCCGG + Intergenic
999447091 5:151648797-151648819 GAGTTTGAGACCAGCCAACATGG - Intergenic
1001501712 5:172241807-172241829 GAGTTTGAAACCAGCCAGCCTGG + Intronic
1002072230 5:176686897-176686919 GAGTCTGAGACCAACCAGCATGG - Intergenic
1006998798 6:38288724-38288746 GAGTTTGAGACCAGCCAACATGG + Intronic
1008091586 6:47299283-47299305 GAGTTTGAGACCAGCCAACATGG + Intronic
1010632550 6:78216060-78216082 GAGTTTGACACTATTGAGCATGG + Intergenic
1014990304 6:128067156-128067178 AAGTGTGCCACCACTGAGCAAGG + Intronic
1016428505 6:143958867-143958889 GAGTGGAACACTAGCAAGCAGGG + Intronic
1017760409 6:157563636-157563658 GAGTGTGTCCCCAGCCAGCAGGG + Intronic
1018194795 6:161345860-161345882 GAGGATGAGATCAGCGAGCATGG + Intergenic
1019255236 7:45633-45655 GAGTGTGAGCCCTGCGAGGAAGG - Intergenic
1022720302 7:32936588-32936610 GAGTTTGAGACCAGCCAGCCTGG - Intergenic
1023982876 7:45079961-45079983 TATTGGGACACCAGAGAGCAGGG + Intergenic
1026593791 7:71717444-71717466 GAGTTTGAGACCAGCCAACATGG - Intergenic
1027223965 7:76232593-76232615 GAGGGTGACACCAGCCAGAGGGG + Intronic
1032181249 7:129680804-129680826 GAGAGTGACGCCAGTGGGCATGG + Intronic
1032386361 7:131528099-131528121 GAGTTTGAGACCAGCCAACATGG - Intronic
1033202153 7:139382596-139382618 GAGTGTGAGACCAGCCAGCCAGG - Intronic
1034107992 7:148507503-148507525 GAGTTTGAGACCAGCCAACATGG - Intergenic
1034912902 7:155012031-155012053 GAAAGTGACCCCAGGGAGCAGGG - Intergenic
1035284790 7:157799277-157799299 GAGGCTGACAGCAGAGAGCAGGG - Intronic
1035415381 7:158679604-158679626 GACTCTGACCCCAGAGAGCAGGG + Intronic
1035540640 8:434215-434237 CGGTGAGACACCAGCCAGCATGG - Intronic
1035543566 8:460677-460699 GTGTGTGACACCAGTGTTCACGG - Intronic
1039880516 8:41622514-41622536 GACTGTGCCACGAGGGAGCATGG - Exonic
1043569277 8:81584144-81584166 GAGAGTGACACCAGCAAGTTGGG + Intergenic
1049124944 8:140778260-140778282 GAGTTTGAGACCAGCTAACATGG + Intronic
1051711744 9:19937387-19937409 GAGTGTGACACCAGCAATCTGGG - Intergenic
1051983389 9:23051629-23051651 GAGTTTGAAACCAGCCAACATGG + Intergenic
1056013514 9:82357449-82357471 GAGTTTGAGACCAGCCAACAAGG + Intergenic
1056771764 9:89482581-89482603 GAGGGTGACACCAGCAGGAACGG + Intronic
1058724090 9:107785528-107785550 GAGTTTGAGACCAGCCAGCCTGG + Intergenic
1060356278 9:122911478-122911500 GAGTCTGACATCAGAGAGAAAGG - Exonic
1060907584 9:127321320-127321342 GAGTTTGAGACCAGCTAACATGG - Intronic
1061863272 9:133478714-133478736 GACTGAGGCCCCAGCGAGCAGGG - Intronic
1185660629 X:1726080-1726102 GAGTTCGACACCAGCCAACATGG - Intergenic
1189172378 X:38922221-38922243 GAGGGTGATCCCAGGGAGCAGGG + Intergenic
1190319694 X:49172669-49172691 GAGAGTGACACCAGAGAGGCAGG - Intronic
1193700723 X:84757354-84757376 GAGCTTTACACCAGAGAGCAGGG - Intergenic
1196735737 X:118979493-118979515 GAGTTTGAGACCAGCCAACATGG - Intronic