ID: 1141494137

View in Genome Browser
Species Human (GRCh38)
Location 16:84395274-84395296
Sequence CAGTGACACTGGAGGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 517
Summary {0: 1, 1: 1, 2: 2, 3: 39, 4: 474}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141494137 Original CRISPR CAGTGACACTGGAGGGGAGA GGG (reversed) Intronic
900506370 1:3031587-3031609 CAGAGACAATGGTGGGGAGGGGG - Intergenic
900634908 1:3658161-3658183 CAGGGACCGTGGAGGGGACATGG + Intronic
901678436 1:10900036-10900058 CAGTGCTACTGGATGGGAAAGGG + Intergenic
902057316 1:13612317-13612339 CAGTGCCATTGGGAGGGAGATGG + Intronic
902399647 1:16150956-16150978 CAGTACCACTGAAAGGGAGAAGG + Exonic
903178831 1:21595389-21595411 AGGTGACAATGGAGGGGACAGGG - Intergenic
904002733 1:27348040-27348062 CAGTGTCCCTGGAGGGGAGGTGG + Intronic
904246829 1:29193982-29194004 GAGTGACATGGGAGGGGAGGCGG - Exonic
904389335 1:30171521-30171543 GAGGGAAACTGGAGGGGGGAGGG - Intergenic
904862168 1:33546569-33546591 CAGTGGCACAGGAGAGGAGATGG - Intronic
905312927 1:37063091-37063113 CAGTGACACTGGAGGTGAGAGGG - Intergenic
906288112 1:44601578-44601600 CACTGAAACTGGAGGGAACAGGG + Intronic
906299738 1:44673391-44673413 CAGTGAGACAGGAGGCGTGAAGG + Intronic
906935410 1:50210066-50210088 CAGTGACTCAGCAGTGGAGAGGG + Intergenic
907279827 1:53340112-53340134 CTGTGACACTGCAGAGGAGAGGG + Intergenic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907886487 1:58596886-58596908 CAGTGACATTGGAGGAATGAAGG - Intergenic
908453581 1:64280391-64280413 CAGTGACTTTGAAGGGGACAAGG + Intergenic
909579490 1:77218390-77218412 CAGTGGAACTGGAGAGGTGAGGG + Intronic
909812305 1:79945272-79945294 CATGGACACTGCAGGGAAGATGG + Intergenic
910569981 1:88689059-88689081 CAGTGACACTGGAAAGTGGAAGG + Intronic
911201109 1:95044436-95044458 GAGAGACACTGAAGAGGAGATGG - Intronic
912067403 1:105761235-105761257 CACTGACAGTGGAGGAAAGAAGG + Intergenic
912557428 1:110526294-110526316 CAGAGAGACTAGATGGGAGAAGG - Intergenic
914225245 1:145714577-145714599 CAGTGACAGTGGCTGGGACAGGG + Intergenic
914852059 1:151322120-151322142 CAGTCAGACTGGAAGGGAAATGG + Intronic
915612430 1:157005157-157005179 CAGTAACACAGGAAGGAAGAAGG - Intronic
915676008 1:157531813-157531835 CAGAGACTGGGGAGGGGAGAGGG + Intronic
916379053 1:164188505-164188527 CCCTGACACTGAATGGGAGAGGG - Intergenic
916431363 1:164732014-164732036 CAGGGACAATGTTGGGGAGAGGG + Intronic
916911663 1:169355534-169355556 CAGTGTAACTGGAGCAGAGAAGG - Intronic
917240362 1:172941449-172941471 CAGTCACACAGGAGGTAAGAGGG - Intergenic
918715753 1:187784232-187784254 TTGTCACACTGGAGGGGAAAAGG - Intergenic
920381130 1:205535095-205535117 CAGTGATAGAGGTGGGGAGATGG - Intergenic
920657562 1:207887969-207887991 GTGAGACACTGGATGGGAGAGGG + Intronic
920730743 1:208481728-208481750 CAGTGACAGTGGGGAGAAGAAGG - Intergenic
922447521 1:225710044-225710066 CAGTGACATTGGAGAGGCCATGG + Intergenic
923305503 1:232684672-232684694 GAGTGGCAGTGGACGGGAGAGGG - Intergenic
924205996 1:241711868-241711890 GATTGTCACTGGAGGTGAGAGGG + Exonic
924416183 1:243859136-243859158 CACTAACACTGGAGGGCAAAAGG + Intergenic
1063501964 10:6563430-6563452 CAGTGACAAGGTAGGAGAGATGG - Intronic
1063604672 10:7512214-7512236 CACAGACAGTGGAGGGGAGATGG + Intergenic
1064103818 10:12484816-12484838 CAGTGACTCTGGGGGGGAGGGGG + Intronic
1064227575 10:13500892-13500914 CAGTTACGCTGCAGGGGAGGTGG - Intronic
1064577456 10:16760743-16760765 CAGTGACAGTGGAGGTGGGGGGG - Intronic
1064583411 10:16816433-16816455 CAGTGAAACTGAAGGCAAGAGGG + Intronic
1065488259 10:26255343-26255365 CAGTTTCAGTGGAGGGGTGAGGG + Intronic
1067778608 10:49180427-49180449 CACTGACACCTGATGGGAGAAGG - Intronic
1068607639 10:59023865-59023887 CAGAAACCCTGGAGTGGAGATGG - Intergenic
1068931058 10:62590754-62590776 CAGTGACAGTTGAGGGAACAAGG - Intronic
1069707155 10:70466030-70466052 CGGGGAGGCTGGAGGGGAGAGGG + Intergenic
1069959772 10:72072832-72072854 GAGGGACACAGGAGGGGAGGGGG + Intronic
1070756084 10:78994108-78994130 CAGAGACTCTAGAGGGGAAATGG - Intergenic
1070961392 10:80502467-80502489 CAGAGACACTGGAGGAAAGCTGG + Intronic
1071300386 10:84252101-84252123 CAATGACACTGCAGCAGAGAGGG + Intronic
1072044584 10:91642196-91642218 GAGTGACAAGGGAGTGGAGAAGG - Intergenic
1072556250 10:96516137-96516159 CAGTTACTCTGGGTGGGAGATGG - Intergenic
1072816615 10:98515906-98515928 CAGTGGAGCTGGTGGGGAGAGGG - Intronic
1073180448 10:101579984-101580006 CTGTGACACTATGGGGGAGATGG - Intronic
1074058883 10:109946827-109946849 GAGTGAGAGTGGAGTGGAGAAGG + Intronic
1074203352 10:111259230-111259252 CAGGCACAGTGGAGGAGAGAAGG - Intergenic
1075489251 10:122852514-122852536 CACTGACACTGCAGTGGAGGTGG + Intronic
1075912366 10:126135653-126135675 CAGTGACCCTAAAGGGGAGGAGG + Exonic
1076027774 10:127130443-127130465 CAGTTAAACTGGAGGGAAGAGGG + Intronic
1076359735 10:129879099-129879121 CAGTGACATTGCAGGAGAGCTGG + Intronic
1077048986 11:558311-558333 CAGTGGCGAAGGAGGGGAGAAGG + Intronic
1077098722 11:811521-811543 CTGTGACTCTGGGAGGGAGAGGG + Intronic
1077114420 11:876924-876946 CAGGACCACTGGAGGGGAGCAGG - Intronic
1077395708 11:2320090-2320112 CAGTGCTAGTGGAGGGGAGTGGG + Intergenic
1077506125 11:2930713-2930735 CAGTGACCCTGAAGGGCAGGTGG - Intergenic
1078664422 11:13312965-13312987 CAGTGAGACCGGGGTGGAGAGGG + Intronic
1079711234 11:23684630-23684652 CAGTCACACTGGTAGTGAGAGGG + Intergenic
1080015896 11:27506643-27506665 CTGTGTCGCTGGAGGGGAGGAGG - Intronic
1080896394 11:36451970-36451992 CAGTGACACTGCAGTCTAGATGG + Intronic
1081651500 11:44827122-44827144 CAGTGACCTTGGAGGCGGGAAGG - Intronic
1082098484 11:48151332-48151354 CATAGACACATGAGGGGAGATGG - Intronic
1083149187 11:60781181-60781203 CAGGAACACAGGAGGGGAAATGG - Intergenic
1083764855 11:64836812-64836834 CAGGGCCTCTGGAGGGGAGGTGG + Exonic
1083803291 11:65058747-65058769 CAGGGACACTGAAGCCGAGAGGG + Intergenic
1084923035 11:72487328-72487350 CACTGACACTGCAGTGGGGAGGG - Intergenic
1087953454 11:104254580-104254602 GAAGGACACTGGAGGAGAGAGGG + Intergenic
1088088641 11:106011334-106011356 CAGTGCAATTGGAGGAGAGAGGG - Intronic
1088598701 11:111457586-111457608 CAGGGGCACTGGAGTAGAGATGG - Intronic
1089184297 11:116604240-116604262 GAATGCCACTGGAGGGGAGGTGG - Intergenic
1089278417 11:117355501-117355523 CACTGGCCCTGGAGGGGACAAGG + Intronic
1089567415 11:119379014-119379036 CAGGGGCACTGGATGGGAGCTGG + Intronic
1089628761 11:119770412-119770434 ATGTGACACTGGAGGGCAGGGGG - Intergenic
1090246072 11:125216744-125216766 AAGGGACAGTGGAGGGGAGGAGG - Intronic
1090421455 11:126578266-126578288 CAGAGAAGCTGGAGGGGAGAGGG - Intronic
1090439810 11:126716113-126716135 TAGGGAGACAGGAGGGGAGAAGG + Intronic
1091038644 11:132256342-132256364 GATGGACACTGGAGGGGTGAGGG - Intronic
1091199418 11:133762588-133762610 CACTGACAGTGCAGTGGAGATGG - Intergenic
1091308588 11:134557002-134557024 CTGAGAGACAGGAGGGGAGAAGG + Intergenic
1091364309 11:135004983-135005005 TAGTGACAGCAGAGGGGAGAAGG - Intergenic
1091555836 12:1572840-1572862 CAGTGGCGGTGGAGGGGGGATGG + Intronic
1092194782 12:6542627-6542649 CAGTGACATTTGGGGTGAGATGG + Intronic
1094573404 12:31662050-31662072 CAGTGTCCCTGGAGAGGAGCTGG + Exonic
1095177250 12:39107171-39107193 CAGGGAAACTGGAGAGGAAATGG - Intergenic
1095281969 12:40362600-40362622 CAGTGACACCAGTGGGGAAAAGG + Intronic
1095644704 12:44529801-44529823 AAGTGTCACTGGAAGGAAGAAGG + Intronic
1095648233 12:44575593-44575615 CAGTGAAACTGTAGGGGATGTGG + Intronic
1095966517 12:47870736-47870758 CTGTGACAGTGCAGTGGAGATGG - Intronic
1097228181 12:57491520-57491542 CAGTGACAACAGAGAGGAGAAGG - Intronic
1101376001 12:104172209-104172231 CAGTGCTCCTGGAGGGGAGCAGG + Intergenic
1101908559 12:108846006-108846028 CTCTGACACTGTAGGGGAGGGGG + Intronic
1102477156 12:113196030-113196052 CAGTGACATGGATGGGGAGAGGG + Intronic
1102543390 12:113638204-113638226 CGGTGACAATGGCGGGGTGACGG - Intergenic
1102991833 12:117321540-117321562 CAGGGACACAGATGGGGAGAGGG + Intronic
1103767604 12:123292428-123292450 AAATGAAAGTGGAGGGGAGAGGG + Exonic
1105806366 13:23953741-23953763 CATTGCCAGTGGTGGGGAGATGG - Intergenic
1106144840 13:27041242-27041264 CAGGGAGACTGCAGGGCAGATGG - Intergenic
1106199320 13:27523333-27523355 CAGTAACCCTGGAGGGGACAGGG - Intergenic
1106333067 13:28756945-28756967 CAGTGAGAGTAGAGGAGAGAAGG - Intergenic
1106501879 13:30336684-30336706 TGGAGGCACTGGAGGGGAGAAGG - Intergenic
1106857843 13:33872228-33872250 CAAAGGCACTGGAGGGGAGAAGG + Intronic
1107023559 13:35776781-35776803 CAGTGAAACTGAAGGAAAGAGGG - Intronic
1107058236 13:36129773-36129795 CACAGACACTGGAGGTAAGAAGG + Intronic
1110560551 13:76906892-76906914 CAGGGACACTGGCGGTGACAAGG + Intergenic
1111260903 13:85738442-85738464 GAGTACTACTGGAGGGGAGAGGG + Intergenic
1111340627 13:86881428-86881450 TAGGGACTCTGGAGGGGATATGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1113035477 13:106043096-106043118 CAGTTTCACTGGAGGTTAGAAGG + Intergenic
1113435235 13:110286237-110286259 ACTTGACACTGGAGGGGAAATGG + Intronic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1113745445 13:112741393-112741415 CAGCCACACTGGGGTGGAGAAGG + Intronic
1113969020 13:114174392-114174414 CAGGCACACTGGAGGGGCCAGGG - Intergenic
1114321518 14:21550608-21550630 CAGTGACAGTTGATGGCAGAAGG + Intergenic
1114450322 14:22821283-22821305 CAGTGAAGCTGGAGTGGAGTGGG - Intronic
1115583762 14:34788753-34788775 CAGTGCCACTGCAGGAGAGTTGG - Intronic
1115785250 14:36818207-36818229 CAGAGACAATGGAAGGGAAAGGG + Intronic
1115856392 14:37633735-37633757 CATTGACACCAGAGGGAAGAGGG - Intronic
1118373277 14:65155689-65155711 TGGTGACACTGGAAGTGAGATGG + Intergenic
1119068163 14:71551748-71551770 CAGTGTGGCTGGAGGGGAAAGGG - Intronic
1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG + Intergenic
1119435797 14:74597129-74597151 CAGGGACACAGGAGGGGACCAGG + Intronic
1119467824 14:74873327-74873349 CAGAGAAACTGAAGGGGAAAAGG - Intergenic
1119666558 14:76489199-76489221 CAGACAGACTGGAGGGGAGATGG - Intronic
1121255915 14:92530280-92530302 CAATGTCACTGAAGGTGAGAGGG - Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1122067138 14:99181653-99181675 CCTTGACCCTGGAGAGGAGAAGG + Intronic
1122132771 14:99614771-99614793 TAGTGACGCTGGAGGGGACGAGG + Intergenic
1124195365 15:27621369-27621391 CAGTGACACTTGATTGGAGGAGG - Intergenic
1125329186 15:38565210-38565232 GAGAGGCCCTGGAGGGGAGAAGG - Intronic
1126066123 15:44827639-44827661 AAGGGACACTGCTGGGGAGAGGG + Intergenic
1126093713 15:45072925-45072947 AAGGGACACTGCTGGGGAGAGGG - Intronic
1126653907 15:50955729-50955751 CACTGACACTGCAGGGGAGTAGG + Intronic
1126750021 15:51867096-51867118 CAGTGTGACTGGAATGGAGAGGG + Intronic
1127599258 15:60518784-60518806 CAGGGTCAGTGAAGGGGAGAGGG - Intronic
1127815896 15:62608622-62608644 CAGCGACACAGGAGGGAAGCAGG + Intronic
1128058777 15:64720145-64720167 CTGTGCCACTGGAAGGTAGAAGG - Intergenic
1128110530 15:65073197-65073219 CACAGACAGCGGAGGGGAGATGG + Intronic
1128135796 15:65262532-65262554 CAGGGACACAGTAGGGGAGTGGG + Intronic
1129331726 15:74831328-74831350 CAGCTTCACAGGAGGGGAGAAGG + Exonic
1129405473 15:75313982-75314004 GAGTTACACTGGAGGGGAACAGG + Intergenic
1129703716 15:77782776-77782798 CAGGGACCCTTGAGGGGAGGTGG - Intronic
1130552284 15:84897787-84897809 CAGAGACTCTGAAGGGGAGGAGG - Intronic
1131024780 15:89130998-89131020 CAGAGGCACTGAAGGAGAGATGG - Intronic
1131878668 15:96838814-96838836 CAGTGTCCTTGGTGGGGAGAGGG + Intergenic
1132411009 15:101578297-101578319 CAGTGATGCTGACGGGGAGAGGG - Intergenic
1132413054 15:101600083-101600105 CAGTGTCAATGGAGGCCAGAAGG - Intergenic
1133293878 16:4740548-4740570 CAGTGACAAAGGTGGGGTGAAGG + Exonic
1133790292 16:9004450-9004472 CAGTGACTCTGGAAGTGGGAGGG - Intergenic
1135235748 16:20754177-20754199 CAGTGAAATAAGAGGGGAGAAGG + Intronic
1138116056 16:54361624-54361646 CAGTGGCACTGAAGGGGAGGAGG + Intergenic
1138794198 16:59947950-59947972 CAGTCACACTAGCTGGGAGATGG - Intergenic
1139278305 16:65748462-65748484 CAGTGAAGCTGGAGAGGAAAGGG - Intergenic
1139588218 16:67917887-67917909 CAGAGGCACTGGAGTGGAGAGGG + Intronic
1139601771 16:67991717-67991739 CACTGACTCTGGAGTGGGGAGGG - Intronic
1139868957 16:70088283-70088305 CAGTGAGAATAGGGGGGAGATGG - Intergenic
1140386430 16:74543889-74543911 CAGTGAGAATAGGGGGGAGATGG + Intronic
1140658811 16:77167460-77167482 CAGACACAATGGAGGGGAGGAGG + Intergenic
1140955917 16:79865161-79865183 CAGAGGCACTGGAAGGGAGATGG - Intergenic
1141494137 16:84395274-84395296 CAGTGACACTGGAGGGGAGAGGG - Intronic
1142332120 16:89461891-89461913 GAGTGCCAGAGGAGGGGAGAGGG - Intronic
1142498216 17:317621-317643 CAAAAATACTGGAGGGGAGATGG - Intronic
1142521491 17:507890-507912 CAGTGTCACTGGGATGGAGAAGG - Intergenic
1142809495 17:2388648-2388670 CAGGGAGTCTGGAGGGGAGTGGG - Intronic
1142953469 17:3504012-3504034 GAAGGACACTGGAGTGGAGATGG - Intronic
1143092228 17:4455674-4455696 CAGTGTCGTGGGAGGGGAGAGGG - Intronic
1143386877 17:6536198-6536220 CAGAGACAATGGAGGGGCCAGGG + Intronic
1143576770 17:7798380-7798402 CAGTGACAAGAGAGGAGAGATGG + Intronic
1143881786 17:10035500-10035522 CAGTGCCAGGGGAAGGGAGATGG - Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144155139 17:12492997-12493019 CAGAGACAAGGGAGGGGAGCTGG + Intergenic
1144329448 17:14211120-14211142 CAGTGGCAGTGGAGGGGGGGTGG - Intergenic
1144637032 17:16916691-16916713 CAATGACAATGGGGGGGATAGGG - Intergenic
1144795393 17:17887952-17887974 CAGTGACAAAGGAGGGGTGCTGG + Intronic
1145252216 17:21302853-21302875 CTCTGCCACGGGAGGGGAGATGG + Intronic
1146678217 17:34788352-34788374 CAGAGAAACTGGGGAGGAGATGG + Intergenic
1146728631 17:35175400-35175422 CAGCCAGACTGGAGGGGAGGTGG + Intronic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1148356166 17:46977402-46977424 TGGGGACACTGGAGGAGAGAAGG - Intronic
1148868904 17:50643977-50643999 CAGGGGCACTGGAGGGCAGAGGG + Intronic
1150020034 17:61602219-61602241 TAGTGACACTTTAGGTGAGACGG - Intergenic
1150675757 17:67245052-67245074 CCGGGACACCGGAGGGGAGTCGG + Intronic
1151341606 17:73474766-73474788 GGGTGACCCTAGAGGGGAGATGG + Intronic
1151553335 17:74834490-74834512 CAATGACACTGGGAGTGAGATGG - Intronic
1152066151 17:78113497-78113519 CTCTGAGCCTGGAGGGGAGAGGG - Intronic
1152627010 17:81392530-81392552 CAGGGACATGGGAGGGCAGAGGG - Intergenic
1153344501 18:4011270-4011292 AAGTGCCACCGGAAGGGAGAGGG + Intronic
1155203244 18:23535693-23535715 AAAACACACTGGAGGGGAGAGGG + Exonic
1155744413 18:29334344-29334366 AATTGATACTGGAGGAGAGAGGG + Intergenic
1155957038 18:31962931-31962953 CAGGGACAGTGCAGGGCAGAAGG + Intergenic
1156164649 18:34403627-34403649 TAGTGACTCTTGAGGGAAGAAGG - Intergenic
1157172283 18:45418885-45418907 CAGTGTCAGAGGAGGGGAGAGGG + Intronic
1157191506 18:45586027-45586049 CGGTGCCACAGGAGGGCAGAGGG - Intronic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157486469 18:48090795-48090817 CAGTGGAACTGGAAGGTAGATGG - Intronic
1157557155 18:48620318-48620340 CCCTGACCTTGGAGGGGAGATGG + Intronic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1158204668 18:54979469-54979491 CAATGACACAGGAGTGGGGAGGG + Intergenic
1158244285 18:55413330-55413352 GAGAGAAACTGGAGGGGAGTGGG + Intronic
1159662250 18:71112552-71112574 CAGTGACTCTGGAGAAGACAAGG + Intergenic
1159784689 18:72698814-72698836 CTGTGACTCTGGAGGCAAGAAGG + Intergenic
1160227214 18:77020423-77020445 CAGGGAAACTGGAGGGGTCACGG - Intronic
1160534877 18:79586449-79586471 CCGTGGCACTGGGGGGGAAAAGG + Intergenic
1160579472 18:79875400-79875422 CAGTGAAGCTGGAGTGGAAATGG - Intronic
1160915863 19:1496221-1496243 CTGTGCCCCTGGTGGGGAGAGGG - Intronic
1163566546 19:18055208-18055230 CAGAGACAGAGGAGGGGAGGTGG + Intergenic
1163686246 19:18713572-18713594 CAGTAACATTGGAGGGAGGAGGG - Intronic
1164431852 19:28195911-28195933 CAGTCACACAGTAGAGGAGAGGG + Intergenic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1164571939 19:29380934-29380956 CAGTGACACAGGAGGGGTGGTGG - Intergenic
1165120474 19:33555578-33555600 CAGTGACACTGGGGTGGGGAGGG - Intergenic
1165388406 19:35524998-35525020 CAGTCACCCTGGAGGGGACCAGG - Intronic
1165749603 19:38251990-38252012 CAGTGACAGGGGAGGACAGAGGG + Intronic
1165789519 19:38483183-38483205 CAGAGCCACTGAAGGGGAGGGGG + Intronic
1166081747 19:40447997-40448019 CAGTGACCCTGGATGGACGAGGG - Exonic
1166356504 19:42230476-42230498 AAGGGACACAGGAGGGGAGGGGG + Exonic
1166422819 19:42652021-42652043 CAGTGTCAGGGGAGGAGAGAGGG - Intronic
1166559032 19:43719812-43719834 CAGTGACAATGGCGTGGAAAAGG + Exonic
1166868349 19:45854645-45854667 GACAGACCCTGGAGGGGAGAGGG - Intronic
1166885911 19:45960888-45960910 CAGTGACAGTGGTGGGGAGGGGG - Intronic
1167201658 19:48069507-48069529 CAGAGACACTGAAGAGGAGGTGG - Intronic
1167399485 19:49255468-49255490 CAGTGTCACTGGTGAGGAGAGGG - Intergenic
1167423509 19:49417354-49417376 GAGTGACTCTGGTGGGGAGGTGG - Exonic
1167506310 19:49872908-49872930 TAGTGATAATGGAGGTGAGAGGG - Exonic
925189521 2:1871494-1871516 CAGTGAAGCCGGAGGGCAGAGGG + Intronic
925502592 2:4522668-4522690 CCGTGTCACTGAAGTGGAGAGGG - Intergenic
925744862 2:7035138-7035160 GAGAGACACAGGAGTGGAGAAGG - Intronic
925923206 2:8651962-8651984 CAGTTACAGTGCAGGGGGGATGG + Intergenic
925947555 2:8879810-8879832 CAGTGACAGGGGCAGGGAGAGGG + Intronic
926106272 2:10153871-10153893 CAGGGACTGGGGAGGGGAGAAGG + Intronic
926110927 2:10183359-10183381 CTGGGACACTGGAGGGGTGGAGG + Intronic
926344747 2:11935052-11935074 CAATGACACTGGAGGGCATGGGG + Intergenic
927378624 2:22450767-22450789 CAGTGATACAGGAGGGGAACTGG - Intergenic
928029439 2:27766174-27766196 CAGTGACAGGGGTGGGGAGAGGG - Intergenic
928129500 2:28639517-28639539 CACGGTCACTGGAGGGGACATGG + Intronic
929164761 2:38870535-38870557 CAGAAACAATGGAGGGCAGAAGG + Intronic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
929829425 2:45335057-45335079 CACTGACACTGCAGGGGATGTGG + Intergenic
929898739 2:45983595-45983617 CTGTGACACTGGGTGGGACAGGG + Intronic
930036765 2:47090624-47090646 CAGGGACCCTGGCAGGGAGAAGG - Intronic
930313045 2:49766091-49766113 CATTGAAAGTGGAGGGGAAATGG - Intergenic
930936214 2:56955240-56955262 CAGTTACACTGGTGGGAAGGTGG - Intergenic
931287605 2:60845830-60845852 CTGTGCCAATGGAGTGGAGAGGG - Intergenic
931418972 2:62108281-62108303 CACTGAAACTAGAGGGCAGAGGG - Intronic
931557298 2:63519245-63519267 CAGTGGCTCTGCAGGGCAGAGGG - Intronic
932112687 2:69014698-69014720 CTGTTACAGTGGTGGGGAGATGG + Intronic
932476722 2:72011139-72011161 CAGAGACAGCGGTGGGGAGATGG + Intergenic
934856053 2:97731074-97731096 AAGAGACAGAGGAGGGGAGATGG + Intronic
935142802 2:100368855-100368877 GCTTGACACTGAAGGGGAGATGG + Intergenic
935397641 2:102624668-102624690 CAGTGACACTTGAAAGGAGATGG - Intronic
935787723 2:106563925-106563947 AGGTGGCACTGCAGGGGAGATGG + Intergenic
935894804 2:107723662-107723684 CAGTGACTTTGGATGAGAGAAGG - Intergenic
936019014 2:108980793-108980815 CGGTGTCACTGGTGGGGAGGTGG + Intronic
936864018 2:117056339-117056361 TATTGACACAGGAGGGGAGCAGG - Intergenic
937348548 2:121143707-121143729 CAGTGAGGCTGGAGCAGAGAGGG + Intergenic
937539507 2:122931259-122931281 CAGTGAAAAAGGAGGGCAGAAGG + Intergenic
938030162 2:127985622-127985644 CAGTGACATAGAAGGGGAGTAGG + Intronic
938866239 2:135423660-135423682 CAGTCACAGTGGAGGGTAGGGGG + Intronic
939167159 2:138652336-138652358 CAGTGACACTGCAGTGGGCAGGG + Intergenic
939629164 2:144513853-144513875 CACTGACGCTGGAGAGGAGGGGG - Intronic
940534875 2:154928688-154928710 CAGTTACACTGGTGTGTAGAGGG - Intergenic
941509071 2:166383754-166383776 CAGTTACTCAGGAGGCGAGATGG - Intergenic
942008525 2:171734559-171734581 CAGTAACACTGGAGGGATGTTGG - Intronic
943524975 2:189005139-189005161 CAGTGACTCTGGATGGCAAAGGG - Intronic
944362936 2:198879869-198879891 CAGTGCCACTGGAGTGGTGATGG + Intergenic
944851108 2:203720154-203720176 GAGTGAGATTGGAGGTGAGAAGG - Intronic
944987469 2:205193831-205193853 CTGTGACACTGGAGGGGAAAAGG + Intronic
945220902 2:207483385-207483407 TAGTGACAGTGGAGAGGAAAGGG - Intergenic
945896604 2:215489670-215489692 GTGAGACACTGGAGGGCAGAAGG + Intergenic
946156827 2:217812475-217812497 CAGTGATACTGGAAGCCAGAAGG + Intronic
946800374 2:223409204-223409226 TACTTACAGTGGAGGGGAGAAGG - Intergenic
947363527 2:229370502-229370524 CAGTCACGATGGAAGGGAGAAGG + Intronic
947526416 2:230879258-230879280 GAGTGTGGCTGGAGGGGAGATGG + Intergenic
948192199 2:236068380-236068402 CAGTGCCAGAGGAGAGGAGAGGG - Intronic
948335622 2:237204828-237204850 CAGTGACACTGGAGGACAGGTGG + Intergenic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
948647824 2:239419257-239419279 CAGAGATGCTGGAGGGGAGATGG + Intergenic
948678247 2:239611735-239611757 CAGTGTGACTGGAGGTGTGATGG - Intergenic
948916319 2:241036446-241036468 CAGGAACCCTGGAGGGGAGGCGG + Intronic
949046322 2:241874131-241874153 CACTGAGGCTGGAGGGAAGAGGG - Intergenic
1169166230 20:3426494-3426516 TAGTGAAACTGGTGGGGAGCGGG + Intergenic
1169419571 20:5449101-5449123 CAGGGACACTGGAGGAGGGGAGG + Intergenic
1170243485 20:14195414-14195436 CAATGATACGGAAGGGGAGAAGG + Intronic
1170282730 20:14669205-14669227 CTGTAACTCTGGAGAGGAGATGG - Intronic
1170792179 20:19517369-19517391 CAGTGAGTCCAGAGGGGAGATGG - Intronic
1171303898 20:24088480-24088502 CAGTGAAACTGGAGTGAAGGAGG - Intergenic
1172004802 20:31811782-31811804 AAAGGACACTGGAGGGCAGATGG - Intergenic
1172010453 20:31843153-31843175 GAGGGCCTCTGGAGGGGAGAGGG + Intergenic
1172629015 20:36365965-36365987 CTGTAAAATTGGAGGGGAGAGGG + Intronic
1172858227 20:38024930-38024952 CACTGACATTGGAGTGGAGGTGG - Intronic
1173236224 20:41248021-41248043 CAGTGAAACTGGAGAGGCGCAGG - Intronic
1173748827 20:45459841-45459863 CAGTGGCCCAGCAGGGGAGACGG - Intergenic
1174118176 20:48242286-48242308 CATTGTCACTGGAAGGGAGATGG + Intergenic
1175340266 20:58224526-58224548 CAGTGGCCCTGGAGGGAAGCAGG - Intronic
1175716764 20:61260173-61260195 AAGGAACACTGGAGGGTAGAGGG - Intronic
1175723863 20:61303654-61303676 CAATGGCGCTGGAGGTGAGAAGG - Intronic
1176215632 20:63946386-63946408 CACAGGCACTGGAGGGGAGCCGG + Intronic
1176933680 21:14842507-14842529 AAATGATACTGAAGGGGAGAGGG - Intergenic
1178093506 21:29189350-29189372 GAGTGAGACTGAATGGGAGAAGG + Intergenic
1178958698 21:37044764-37044786 CAGTGACAAAGGAGGGCATATGG - Intergenic
1179114196 21:38475220-38475242 CAGTGGCAAGGGATGGGAGATGG + Intronic
1179294089 21:40045052-40045074 CACAGACACAGGAGGGGAGAGGG + Intronic
1179427168 21:41290662-41290684 CAGTGAAACTCGGGGGCAGAGGG - Intergenic
1180634992 22:17257128-17257150 CAGTGACACTGTAGGTGGGTTGG - Intergenic
1180946476 22:19696436-19696458 CACTGACAGTGGAGAGGGGATGG - Intergenic
1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG + Intergenic
1181567131 22:23745895-23745917 GAGTGCGACTGGAGGGTAGAGGG - Intronic
1182766482 22:32761466-32761488 CACTGACCCTGGAAGGGAGTGGG + Intronic
1183309359 22:37101121-37101143 AAGGGACACTGGGGGAGAGAGGG + Intronic
1183645577 22:39124222-39124244 CTGTGAAGCTGGAGGGGAGGGGG - Intronic
1183709498 22:39494546-39494568 CAGTGAGACTGGAGGGGCTTGGG + Intergenic
1183875242 22:40774939-40774961 TGGTGGCACTGGAGAGGAGAGGG - Intronic
1183983544 22:41556649-41556671 GAGTCCCACTGTAGGGGAGATGG + Intergenic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1185108780 22:48889340-48889362 CGGGGGCACTGGAGGGGAGAGGG - Intergenic
1185308708 22:50140251-50140273 CAGTGCCACTGGAGGGGCTGCGG + Intronic
1185370519 22:50458878-50458900 CAGTGACACTGGGAGGGAACAGG + Intronic
1185373092 22:50469866-50469888 CTGTAACCCTGGAGGGCAGATGG - Intronic
949926428 3:9045957-9045979 CAGTGAGAATGGAGGAGAAAGGG - Intronic
950021371 3:9789978-9790000 AAGTGTCACTGAGGGGGAGAAGG + Intronic
950262345 3:11552417-11552439 CAGTGCAACTGGTGTGGAGAAGG - Intronic
950625366 3:14242731-14242753 CAGTGAGACTGCTGGGGAGCAGG - Intergenic
952188830 3:31000457-31000479 CAGGGACACTGGAGGCTAAAAGG - Intergenic
952281120 3:31924273-31924295 CATTGACTCTGGAGTGGAAAAGG + Intronic
952573678 3:34748213-34748235 GAGTGAAACAGGAGGAGAGAAGG + Intergenic
952951888 3:38532388-38532410 CAGTCACCCTGGTGGGAAGATGG + Intronic
953407507 3:42666729-42666751 CAGAGACACTGGTGGGGAGCTGG + Intergenic
953512352 3:43554949-43554971 CACTGACACTGTAGCAGAGAGGG + Intronic
953512817 3:43560063-43560085 CAGTTACACTCCAGGGGAGAGGG - Intronic
953788525 3:45929228-45929250 CAGTGACACCAGGGGGCAGAAGG - Intronic
954036310 3:47852942-47852964 CAGTGACATGGGAGGAGGGAAGG + Exonic
954130711 3:48559334-48559356 CAGGGCCATGGGAGGGGAGATGG - Intronic
954215945 3:49124549-49124571 CAGTGGCACTGGTCAGGAGATGG + Exonic
954904655 3:54050359-54050381 CAGTGACACACGAGGGGATGAGG - Intergenic
959126071 3:102291386-102291408 CACTGCCACAGGAAGGGAGAGGG + Intronic
959495456 3:107045832-107045854 CATTTACACTACAGGGGAGAAGG - Intergenic
960462599 3:117954896-117954918 AAGTGAAACTTGAGGGGAAAGGG + Intergenic
961026519 3:123563144-123563166 CAGTGGTACTGGTGGGGACATGG + Intronic
961094380 3:124142061-124142083 AATTGAGAATGGAGGGGAGAGGG - Intronic
962017307 3:131454905-131454927 CAGAGAAACTGGTGTGGAGATGG - Intergenic
965240176 3:166187220-166187242 CTCTGACACTTGAAGGGAGAGGG + Intergenic
965341165 3:167493076-167493098 GAGAGACACTGGAGGAGAAATGG + Intronic
965829698 3:172771541-172771563 CAGTGACAGTTGAGATGAGATGG + Intronic
966567872 3:181403277-181403299 AAATGAGCCTGGAGGGGAGAGGG + Intergenic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967127697 3:186439899-186439921 CAGTGGGACAGGAGGGGAGGCGG - Intergenic
967888943 3:194351401-194351423 CAGGGTCACAGGACGGGAGAGGG + Intergenic
967909059 3:194526136-194526158 CAGGGACAGTGGTAGGGAGAAGG - Intergenic
968033362 3:195523201-195523223 TAGTGTCACAGGAAGGGAGATGG - Intronic
969208685 4:5669610-5669632 CAGGGAGACAGAAGGGGAGAAGG - Intronic
969280990 4:6170670-6170692 GGGTGACAGTGGAGGTGAGAAGG - Intronic
971051706 4:22869455-22869477 GAGCCACACCGGAGGGGAGAAGG + Intergenic
972256143 4:37357855-37357877 AGGTGACTCTGAAGGGGAGATGG + Intronic
972812816 4:42609186-42609208 CAGTGACACTGCTGGTGAGGGGG - Intronic
973628819 4:52799186-52799208 CTGTGCTACTGGAGAGGAGAAGG + Intergenic
976320590 4:83710162-83710184 CAGGGACCATGGAGGGGAAATGG - Intergenic
977601617 4:98939404-98939426 CAGTGAGAATGAAGAGGAGAGGG - Intergenic
981345490 4:143672027-143672049 CAGTGACAATGGGAGAGAGAGGG - Intronic
983521371 4:168712399-168712421 CAATGAAACTGGAGGGAAGCAGG + Intronic
984981615 4:185287433-185287455 CAGTGGGGCTGCAGGGGAGAGGG + Intronic
985083609 4:186291647-186291669 CAGTCACTCTGGTGGGGTGAAGG - Intergenic
985170015 4:187138815-187138837 CAGAGACAGTGAAGGAGAGAGGG + Intergenic
985261430 4:188118364-188118386 GAGTCACACTGGAGGGGATGGGG - Intergenic
986591426 5:9374838-9374860 CAGTGAGCCTGGAGGGCAGGAGG - Intronic
987053398 5:14167223-14167245 CAGTAACTCTGGGGGGAAGATGG + Intronic
988621658 5:32829635-32829657 CATTTAGACTGGAGAGGAGAAGG + Intergenic
989109142 5:37890250-37890272 CAGTGACTCTGCAGGGGAATAGG + Intergenic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
990972480 5:61524273-61524295 TAGTGAAACTGCAAGGGAGAAGG - Intronic
991169431 5:63604025-63604047 CAGTGACAGTGGACTGGGGAGGG - Intergenic
991980426 5:72224789-72224811 AAGTGAAAGTAGAGGGGAGAGGG - Intronic
994410613 5:99403147-99403169 GAGGGACACTGGAGGTGATAGGG - Intergenic
994483219 5:100362122-100362144 GAGGGACACTGGAGGTGATAGGG + Intergenic
994531733 5:100981601-100981623 TATTGATACTGGAGGGGAGCAGG + Intergenic
994802051 5:104390979-104391001 CATTGAGGTTGGAGGGGAGATGG + Intergenic
994807705 5:104472966-104472988 CAGAAACAATGGAGGTGAGAAGG - Intergenic
996003842 5:118396923-118396945 CAGTGACACAGCAGTGGAGATGG - Intergenic
997467658 5:134099071-134099093 GAGAGACACTGTAGGAGAGAAGG + Intergenic
998445824 5:142197681-142197703 CAGTGCCAGTGGTTGGGAGATGG - Intergenic
998649425 5:144101397-144101419 TAGTGACAGGGGAGGGGAAATGG - Intergenic
999078190 5:148817481-148817503 CAGTCACACAGCAGGTGAGAAGG + Intergenic
1000932999 5:167274607-167274629 CAGTGACTCTGGAAGGCAGTTGG - Intergenic
1001219867 5:169891249-169891271 GAGGGACACGGAAGGGGAGAGGG - Intronic
1001567942 5:172712735-172712757 CAGAGACGCTGGATGGGAGGAGG - Intergenic
1001639463 5:173234706-173234728 AAGCGACCCAGGAGGGGAGAAGG + Intronic
1001983194 5:176050848-176050870 GAGTGATACTGGGGGGGAGGAGG - Intronic
1002234271 5:177793204-177793226 GAGTGATACTGGGGGGGAGGAGG + Intronic
1002332624 5:178455085-178455107 AAGTCAGACTGGAGGGGAGCAGG - Intronic
1003317329 6:5024466-5024488 CAGAGGCTCTGGAGGAGAGAGGG + Intergenic
1003516171 6:6820892-6820914 CAGGGGCAATGCAGGGGAGAGGG + Intergenic
1004516936 6:16328317-16328339 CAGTCACCGTGGAGGGGGGACGG - Exonic
1004613644 6:17269212-17269234 CAGAGTCACTGGGGGGGTGATGG - Intergenic
1005934742 6:30512321-30512343 CAGTAACAATGGAGGTTAGAAGG + Intergenic
1006547248 6:34790485-34790507 CAGTCCTACTGGAGGGGAGTGGG + Intergenic
1006634169 6:35450411-35450433 CAGTGACACAGCTGGGGACATGG + Intergenic
1007209980 6:40185662-40185684 CAGTCACACAGCAGGGCAGAGGG + Intergenic
1007788807 6:44297421-44297443 CAGTGACTGTGGTGGGGAGGAGG + Intronic
1008547189 6:52593616-52593638 CAGTGAAACTGGATGGGTCAGGG - Intergenic
1010824297 6:80453862-80453884 GAATGAAAATGGAGGGGAGAAGG - Intergenic
1012365777 6:98437776-98437798 TAGGGAGAGTGGAGGGGAGATGG + Intergenic
1013033218 6:106356411-106356433 CAGTGATGCTGGAGAAGAGAGGG - Intergenic
1014848727 6:126313507-126313529 CAGTGTCAGAGGAGGGAAGAGGG - Intergenic
1014878707 6:126694651-126694673 GAGAGAGAGTGGAGGGGAGAGGG + Intergenic
1016880886 6:148911055-148911077 CAGAGACCCTGGAGGGGTCAGGG - Intronic
1018362716 6:163087742-163087764 GACTGACACTGGAGGAGAGGAGG + Intronic
1018517060 6:164594875-164594897 AAGAGACACTGAAGGAGAGATGG + Intergenic
1018992275 6:168683234-168683256 CACTGTCTCTGGAGGGGAGGAGG - Intergenic
1019103272 6:169649433-169649455 GAGAGACACAGGAGGGGAGGAGG - Intronic
1019943205 7:4307463-4307485 CATTGACACAGAATGGGAGAAGG - Intergenic
1022882047 7:34598242-34598264 CAATGACACTGGGGGTGAGGGGG + Intergenic
1023139909 7:37091579-37091601 CAGTGAGAGTGGAGGGGGCAGGG - Intronic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1024175078 7:46831320-46831342 CAGTGACACTGTTTGGGTGATGG + Intergenic
1024492666 7:50003421-50003443 CTGTGCCACTGGAGGTGAGGTGG - Intronic
1027853043 7:83473297-83473319 CATTGACACTGGACTGGAAAAGG - Intronic
1029163169 7:98567389-98567411 CCGTGACCCTGGCAGGGAGATGG + Intergenic
1029429267 7:100519226-100519248 CATTGACACTTGGAGGGAGAGGG - Intergenic
1030478523 7:110071296-110071318 CAGTGTCACTGGAGGGAATTTGG - Intergenic
1031140762 7:117940507-117940529 GAGGGCGACTGGAGGGGAGAAGG + Intergenic
1032490107 7:132318141-132318163 CAGGGGGACTGGAGCGGAGAGGG + Intronic
1032836886 7:135682916-135682938 CAGTAAGATGGGAGGGGAGAGGG + Intronic
1033588640 7:142792609-142792631 CACAGACACTGGAGGGTGGAGGG + Intergenic
1036126424 8:6067186-6067208 CAGTGACTCTCGGGGGGATACGG - Intergenic
1036429710 8:8678833-8678855 CAGAGACAGAGAAGGGGAGAAGG - Intergenic
1036630831 8:10513716-10513738 CAGTGACATTTGAGGAAAGATGG + Intergenic
1036638919 8:10569899-10569921 CAGAGACACTGGAGTCAAGAGGG + Intergenic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037747551 8:21659043-21659065 CAGTGGAGCTGGAGTGGAGAGGG - Intergenic
1037759411 8:21732158-21732180 TAGAGACACAGCAGGGGAGATGG + Intronic
1038298387 8:26318217-26318239 CAGTAACACTGGAAGGAGGAAGG - Intronic
1038328575 8:26590456-26590478 CAGTGACACCTGAGGGTGGATGG - Intronic
1038328585 8:26590516-26590538 CAGTGACACCTGAGGGTGGATGG - Intronic
1038328595 8:26590576-26590598 CAGTGACACCTGAGGGTGGATGG - Intronic
1038328605 8:26590636-26590658 CAGTGACACCTGAGGGTGGATGG - Intronic
1038772197 8:30493380-30493402 CAGTGAGACAGGAGAGGAAAAGG + Intronic
1040387087 8:46921016-46921038 CAGTTACAGGGGAGGGGAGGAGG + Intergenic
1042114352 8:65414791-65414813 GACTGTCACAGGAGGGGAGAAGG - Intergenic
1043451027 8:80367077-80367099 CATTCACACTGGAGGAGAAAAGG + Intergenic
1044693565 8:94901318-94901340 CAGGGAGACTGGATAGGAGATGG + Intronic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045015995 8:98002447-98002469 CAGTGACATTGGACGGCACAAGG - Intronic
1045649731 8:104330314-104330336 CAGGGACGCTGGGGCGGAGACGG - Intronic
1046906889 8:119583069-119583091 CAGTGGCACTTCAGGGGACAGGG - Intronic
1047412533 8:124636006-124636028 CATTCACACTGGAGGGTGGAGGG + Intronic
1047798527 8:128284249-128284271 CAATGCCAATGCAGGGGAGAAGG + Intergenic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1048451913 8:134540978-134541000 CACTGGCACCAGAGGGGAGAGGG + Intronic
1048571870 8:135663362-135663384 GAGTGACACTGCAGGTGAGGAGG - Intergenic
1048958677 8:139557794-139557816 CAGTGACACTTGAGGGATAAGGG + Intergenic
1048972046 8:139650605-139650627 CAGGGACCCTGGAGTGGAGAGGG - Intronic
1049031835 8:140043863-140043885 GAGGGCCACTGGAGGGGAGAGGG - Intronic
1049611862 8:143559582-143559604 CAGGGAGGCTGGATGGGAGAGGG + Intronic
1049640619 8:143713512-143713534 CTGTGACACTGGAGGGGACAGGG + Intronic
1052531281 9:29687581-29687603 CAGAAACAATGGAGGGCAGAAGG + Intergenic
1052792706 9:32890776-32890798 CAGGGTCACTGGAGGTGTGATGG - Intergenic
1055070136 9:72157586-72157608 CAGAGACACTAAAGGGTAGATGG - Intronic
1055682003 9:78724865-78724887 CCCTGCCACTGGAGGGGATAAGG - Intergenic
1056251308 9:84751125-84751147 GAGTGGCACTGGAAGGGAGCAGG - Intronic
1057043428 9:91864412-91864434 CAGAGACAGGGGAGGGGATAAGG + Intronic
1057277995 9:93686429-93686451 CAGGGACCCTGGAGGAGAAAAGG + Intergenic
1057523944 9:95783525-95783547 CAGTGAGACTTAAGGGGAGGGGG + Intergenic
1059205213 9:112458081-112458103 CAGTGGCACTAGAAGGTAGATGG - Intronic
1059236665 9:112766230-112766252 AAGTAACACTGGAGGGGTGGAGG - Intronic
1059484112 9:114613801-114613823 CAGTCACACTAGAGTGCAGAGGG + Intronic
1059953870 9:119495903-119495925 CAGTGAGGCTGGGGGAGAGAGGG + Intronic
1060072082 9:120558719-120558741 CAGTGACATTGGAGCTGAGGTGG - Intronic
1060206876 9:121687311-121687333 CAGGGACACTGGATGGAACAAGG + Intronic
1060267333 9:122120055-122120077 CAGGGACAAGGGAGAGGAGAGGG - Intergenic
1060423647 9:123487018-123487040 CACAGACACTGGAGTTGAGAGGG + Intronic
1060439859 9:123628313-123628335 CAGTGACATGGGAGGGAGGAAGG + Intronic
1060521642 9:124297457-124297479 CAGTGAGGCTGGCGGGGAGCTGG - Intronic
1060673931 9:125495271-125495293 CAGTGACTCTGAATGGGAGGTGG - Intronic
1060797776 9:126524388-126524410 CACAGAGACTGGAGGGGCGAGGG - Intergenic
1060856471 9:126917645-126917667 AAATGAGACGGGAGGGGAGAAGG + Intronic
1061064511 9:128269004-128269026 TTGTGCCACTGCAGGGGAGAAGG - Intronic
1062051350 9:134448678-134448700 CAGTGTCACTGGAGGGCATGTGG + Intergenic
1062091456 9:134680708-134680730 CGGTGACACTGGTGAGGAGATGG + Intronic
1062541801 9:137044857-137044879 CAGTGCCCCTGGATGGGAGGTGG - Intronic
1062654861 9:137598552-137598574 CAGTGCCAGTGGAGGGGTGAGGG + Intergenic
1062719801 9:138033991-138034013 CACTGACATTCTAGGGGAGAAGG + Intronic
1186047440 X:5551917-5551939 CAGTGATATGGGAGGGGAGCAGG + Intergenic
1186835609 X:13434425-13434447 CATTGAAACTGGAGAGGAAAGGG + Intergenic
1186924816 X:14321971-14321993 CAGTTGACCTGGAGGGGAGAAGG - Intergenic
1187518350 X:19991750-19991772 CAGTGACAAGGGAGGGCAAAAGG - Intergenic
1188586832 X:31786798-31786820 CAGGGACACTGGAGCTGGGATGG - Intronic
1190262326 X:48805267-48805289 CAGTGGCAGTGGTGAGGAGAGGG + Intronic
1190375155 X:49782132-49782154 CAGTAAGGCTTGAGGGGAGATGG - Intergenic
1190378028 X:49810036-49810058 CACTGACCTTGGAGGGGAGAAGG - Intergenic
1191027943 X:55936215-55936237 GAGTGATACTGAAGGGGAGATGG - Intergenic
1191626991 X:63280335-63280357 CAGGGACACAGGAAAGGAGAAGG - Intergenic
1192163193 X:68803982-68804004 CAGTGAGAATGGAGAGGAGGGGG + Intergenic
1193360432 X:80573569-80573591 CTCAGACACTGAAGGGGAGAAGG - Intergenic
1193790213 X:85808149-85808171 GAGTGGCACTGGAGGGGGCAGGG + Intergenic
1194872917 X:99154947-99154969 CAGTGTCACTGCAAGTGAGATGG - Intergenic
1195423883 X:104705714-104705736 CAGCTAAACTGGAGGCGAGAGGG + Intronic
1195486577 X:105414681-105414703 GAGTGACACTTGAGCTGAGAGGG - Intronic
1195613814 X:106896947-106896969 CCTTGACACTTGAGGGGAGTGGG + Intronic
1195941207 X:110169394-110169416 CAGTGAGGCTGGAGGAGAGTGGG - Intronic
1196271352 X:113715973-113715995 TAGTGATACGGGAGGGGACAGGG + Intergenic
1196931185 X:120683578-120683600 CAGTGAAAGAGGTGGGGAGATGG + Intergenic
1197461889 X:126752854-126752876 CAGGAACACTGGAAGGTAGACGG + Intergenic
1199595406 X:149502971-149502993 CAGGTACCCTGCAGGGGAGAGGG + Intronic
1199598473 X:149526242-149526264 CAGGTACCCTGCAGGGGAGAGGG - Intronic
1200079105 X:153566765-153566787 CAGTGGCACAGGCGGGCAGAGGG - Intronic