ID: 1141496142

View in Genome Browser
Species Human (GRCh38)
Location 16:84411012-84411034
Sequence AGAGTCACTCCTGCTACCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141496142 Original CRISPR AGAGTCACTCCTGCTACCTG TGG (reversed) Intronic
905274917 1:36811167-36811189 AGAGTGACTCCGGCCACCTATGG - Intronic
905511237 1:38522140-38522162 CCAGTCTCTCCTGCTACCTGTGG - Intergenic
905696906 1:39981167-39981189 AGATTCTCTCCTTCTGCCTGTGG - Intergenic
906956250 1:50377323-50377345 AAAGTGACTACTGCTCCCTGAGG - Intergenic
909437181 1:75655642-75655664 AGAGACACTCCTTCCAACTGGGG + Intergenic
910082770 1:83361134-83361156 AAAATCAATGCTGCTACCTGGGG + Intergenic
911303679 1:96206913-96206935 ACCATGACTCCTGCTACCTGGGG + Intergenic
912388128 1:109282865-109282887 ACAGCTACTCCTGCTACCTCCGG + Intronic
914876923 1:151519013-151519035 AGTGTCAATGGTGCTACCTGGGG - Exonic
915640003 1:157217454-157217476 AGAGTCACTGTTCCTACCTGTGG + Intergenic
915924412 1:160005018-160005040 ACAGTCACTCCTGACAGCTGGGG - Intergenic
920854722 1:209653144-209653166 TGAGTCACTCCTCCCACCTGTGG + Intergenic
922329946 1:224565676-224565698 AGATTCACTGTTGCTTCCTGTGG + Intronic
1065812616 10:29456147-29456169 AGAGTCACTAGGGCAACCTGAGG - Intergenic
1069120212 10:64560460-64560482 AGAGTCAATGCTCCTACATGTGG - Intergenic
1071252655 10:83836831-83836853 AGAGTCCCTCATTCTGCCTGTGG - Intergenic
1072160351 10:92760483-92760505 AGAGGCAATCCTTCTACCTTTGG - Intergenic
1073863102 10:107770242-107770264 GGAGGAACACCTGCTACCTGAGG + Intergenic
1076332234 10:129678521-129678543 AAAGTCTTTCCTGCTGCCTGAGG - Intronic
1083180605 11:60982405-60982427 AGAGTCACTTCTGGTCACTGGGG + Intronic
1084568184 11:69943521-69943543 AGGGTCCCTCCTGCCTCCTGGGG + Intergenic
1084877355 11:72142969-72142991 GGAGTGAGACCTGCTACCTGAGG - Intergenic
1084882513 11:72181772-72181794 GGAGTGAGACCTGCTACCTGAGG - Intergenic
1085415245 11:76315324-76315346 AGAGCCTCTCCTGCTGCCTCTGG - Intergenic
1092155689 12:6280225-6280247 TGAGTCACTCTTGCTGCCTAGGG - Intergenic
1096042403 12:48528972-48528994 AGAGACACTGCAGCAACCTGAGG + Intronic
1096239828 12:49953913-49953935 AGAGTCAGTTTTGCTACCTCTGG + Intronic
1097032866 12:56102049-56102071 AACGTAACTCCTGCTCCCTGTGG + Exonic
1097792857 12:63833033-63833055 AGAATCACTGCTGGTACCTCAGG + Intergenic
1101850944 12:108401817-108401839 AGTGTCACTCCTCCTCCCAGGGG - Intergenic
1102281876 12:111624874-111624896 AGAGTCTCTTCTGCTATATGAGG + Intergenic
1104735137 12:131131891-131131913 ATAGCCACTCCTGCCTCCTGTGG + Intronic
1104847563 12:131854363-131854385 AGAGTCACTGCTTATACCTCAGG + Intergenic
1106506191 13:30372620-30372642 ATAGTTACACCTGCTCCCTGGGG + Intergenic
1106715370 13:32382895-32382917 ACAGTCTCTCCTGCTAGCTAAGG - Intronic
1107337309 13:39368861-39368883 ATAGTCATTCCTGAGACCTGTGG - Intronic
1114754834 14:25247193-25247215 AGAGTCCATCCTCCTACCTCTGG - Intergenic
1115190588 14:30743727-30743749 AAAGTCACACCTGCTTCCTGGGG - Intergenic
1116095156 14:40358565-40358587 AGAGTCCCTCCTACTACATGTGG - Intergenic
1117145671 14:52834994-52835016 AAAGTAACATCTGCTACCTGGGG - Intergenic
1117422932 14:55565266-55565288 AGAGTCCCTCCCGCAACATGCGG - Intronic
1118289042 14:64503949-64503971 AGAGTCACAACTGCGAACTGTGG - Intronic
1122214412 14:100193579-100193601 TGAGCCACTCCTGCTTACTGGGG - Intergenic
1126302110 15:47208877-47208899 AGAGTCCCTCATACTGCCTGTGG + Intronic
1127536635 15:59895904-59895926 AAAGGCACTTCTGCTTCCTGGGG + Intergenic
1128254653 15:66187785-66187807 AGAGTCCCACGTGCTTCCTGAGG + Intronic
1130812797 15:87398732-87398754 ATAGTCACTCCAGCTTCCTTTGG - Intergenic
1131642483 15:94307427-94307449 AGGGACACTCCTGCTACCCTGGG - Intronic
1131881186 15:96864017-96864039 GGAGTCATTCGTTCTACCTGGGG + Intergenic
1132248370 15:100315242-100315264 AGGGGCACTGCTGCTTCCTGCGG + Intronic
1132769177 16:1551464-1551486 AGGGTCTCCCCTGCTACCTGCGG - Intronic
1133028634 16:2999288-2999310 AGACTCACACCTGCTTTCTGAGG - Intergenic
1133424597 16:5676956-5676978 AGAGTCATACTTGCTACCTCAGG - Intergenic
1133857933 16:9566994-9567016 AAAGTCACTCTACCTACCTGGGG - Intergenic
1134395592 16:13860011-13860033 AGAGTTACTCTTTCTAACTGTGG + Intergenic
1136612849 16:31377777-31377799 AGAGTCACACCTGCCATGTGTGG - Intronic
1137365776 16:47858310-47858332 AGAGACGCTCCTGCTTCCTAAGG - Intergenic
1137493152 16:48949845-48949867 TGAGTCACTCCCTCTCCCTGGGG - Intergenic
1139590062 16:67928487-67928509 AGCCCCACTGCTGCTACCTGGGG + Exonic
1141496142 16:84411012-84411034 AGAGTCACTCCTGCTACCTGTGG - Intronic
1141604860 16:85146938-85146960 AGAGTCACTGCAGCTGCCAGGGG + Intergenic
1143002016 17:3800546-3800568 GGAGGCACTTCTGCTGCCTGGGG - Intronic
1144936950 17:18907238-18907260 ACAGCCACTCCTGATTCCTGGGG - Intronic
1147335820 17:39726556-39726578 AGAGTCAATCATCCAACCTGGGG - Exonic
1147861132 17:43524201-43524223 ACAGTAGCTCCTGCTAGCTGGGG - Exonic
1148388707 17:47254561-47254583 AGAGGCACCGCTGCCACCTGGGG - Intronic
1148633539 17:49130319-49130341 AGAGGCACTCCTGGGACTTGGGG - Intergenic
1153235137 18:2978965-2978987 GGAGTCATTCCACCTACCTGTGG - Intronic
1153585506 18:6616210-6616232 AGACTCACTCCTTCTACATGTGG - Intergenic
1154054835 18:11002977-11002999 AGAGGCGCTCCTGCTACCAGAGG + Intronic
1154168795 18:12035977-12035999 AGAGATACACCTGCCACCTGAGG - Intergenic
1160006630 18:75073312-75073334 GGAGTCCCTCCTGGAACCTGAGG + Intergenic
1160705226 19:526404-526426 AGAGTCCCTTTTGCCACCTGAGG + Intergenic
1161256628 19:3313524-3313546 GCAGTCCCTCCTGCTACCTGCGG + Intergenic
1163455222 19:17402666-17402688 AGAGCCTCTCCTGATTCCTGGGG - Intergenic
1164294631 19:23898974-23898996 AGAGTCACATCTGCTAGGTGAGG - Intergenic
925001539 2:406874-406896 AAAATTACTCCTGCTTCCTGAGG + Intergenic
925286423 2:2718765-2718787 AGAGTTACTCTTGGTAGCTGTGG - Intergenic
928306835 2:30177330-30177352 AGACTGGCTCCTGTTACCTGAGG + Intergenic
928910730 2:36418242-36418264 AGAGTCTGTCGTGTTACCTGGGG - Intronic
929149035 2:38731480-38731502 AGACTCACTCCTGCCAGCTGGGG - Intronic
932173403 2:69577780-69577802 TGAGTCCCTCCTGCCTCCTGTGG - Intronic
932778366 2:74543144-74543166 GGAGTCAGCCCTGCTCCCTGGGG - Intronic
934083858 2:88492908-88492930 ATAGTGACTCCTGCTCCCAGTGG + Intergenic
934756445 2:96827922-96827944 GGAGTCCCTCCTGCTTCCTCAGG + Intronic
935010051 2:99125937-99125959 AGAGGCACTCCTTCTTGCTGTGG - Intronic
935271879 2:101441706-101441728 ATAGCCACTCCTGCTATCTGTGG + Intronic
937353644 2:121184704-121184726 AGGGCCACTGCTGCCACCTGTGG + Intergenic
943505102 2:188745502-188745524 AGAATCACTCCTTTTATCTGGGG - Intronic
945157637 2:206856307-206856329 AGAGTCAGTGTTGCTACCTTAGG - Intergenic
946538351 2:220657140-220657162 AGACACACTCCTGTTACCTAGGG + Intergenic
946772439 2:223102255-223102277 AGAGCCACGCCTACTCCCTGTGG + Intronic
1170460865 20:16575100-16575122 CGGGTCACTCCGGCCACCTGGGG + Intergenic
1174842520 20:53913519-53913541 TGAGTCACTGCTGCTTCATGGGG - Intergenic
1175444505 20:59010735-59010757 GGAGTCATTCCTGCTCCCAGTGG + Intergenic
1176522109 21:7832072-7832094 AAAGTCCCTCCTGCAACATGTGG + Intergenic
1178656129 21:34462084-34462106 AAAGTCCCTCCTGCAACATGTGG + Intergenic
1178862290 21:36299506-36299528 AGAGTCCCTCCCTGTACCTGAGG - Intergenic
1181426724 22:22848692-22848714 ATAGTCCCTCCTGTCACCTGGGG + Intronic
1182041077 22:27239458-27239480 AGGGTCACTGCTGATTCCTGGGG - Intergenic
1184178779 22:42805490-42805512 AGAGGCACTCCGGCCACCTTTGG - Intronic
950109215 3:10407780-10407802 GGAGTGACACCTGCTTCCTGAGG + Intronic
950453084 3:13076454-13076476 CGGCTCACTCCTGCAACCTGCGG + Intergenic
950528883 3:13540865-13540887 TGACTCACTCATGCTGCCTGGGG + Intergenic
952784435 3:37138923-37138945 AGAGTCACTCTTGCTCTTTGGGG + Intronic
952852617 3:37741347-37741369 AGAGTCAGTCTTCCTAGCTGAGG - Intronic
959391231 3:105776887-105776909 AGAGTGACTATTTCTACCTGGGG + Intronic
959447098 3:106453968-106453990 CAAGTCACACCTGCTTCCTGGGG - Intergenic
960022490 3:112970834-112970856 AGAGTATCTCCTCCTACATGAGG + Intronic
960325416 3:116289829-116289851 AGAGTCACTCACGCTATCTTAGG + Intronic
962194347 3:133347764-133347786 ATAGTCACTCCTGCTATATAGGG - Intronic
962392711 3:134986160-134986182 AGAGTCACTCCCGGTGCTTGTGG - Intronic
962482146 3:135807013-135807035 AGGCTGACTTCTGCTACCTGGGG + Intergenic
964349752 3:155791056-155791078 AGATTCCTTCCTTCTACCTGAGG + Intronic
965648543 3:170909263-170909285 AGAGTCAGCACTGCTCCCTGGGG + Intergenic
969429467 4:7145713-7145735 GGAGTCCCTCCTGCTTCCCGAGG - Intergenic
970811074 4:20094641-20094663 AGAGTCACTACTGTTACCGGTGG - Intergenic
970947384 4:21711009-21711031 AGAGGCACGCCTACTACCTATGG + Intronic
971881305 4:32377336-32377358 TGTGTCTCTCCTGCTACTTGAGG - Intergenic
974882489 4:67776929-67776951 AGAGGCACTGCTGTTATCTGGGG - Intergenic
983842766 4:172478016-172478038 AGAGGCACTCTTTGTACCTGTGG + Intronic
985543873 5:499680-499702 CCAGTCACTCCTGCTCCCTGGGG + Intronic
985571123 5:645874-645896 AGCGTCACTCCTGCTCCCGTCGG + Intronic
985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG + Intronic
987296024 5:16552059-16552081 AAAGTCCCTCCTGCCATCTGAGG + Intronic
987393508 5:17399058-17399080 TCAGTCAGTCCTGCTTCCTGAGG - Intergenic
990345638 5:54868352-54868374 AAATTCACTCCTGATACCAGGGG + Intergenic
990393782 5:55355397-55355419 AGTCTCACTGCTGCTACCTGGGG - Intronic
991544789 5:67769992-67770014 AGAGTCCCTCCTACAACATGTGG + Intergenic
992893545 5:81226934-81226956 AGGGTTAGTCCTGCTACCTGAGG + Exonic
994673116 5:102786236-102786258 AAAGTCACACCTTCTACATGTGG - Intronic
995005202 5:107184284-107184306 TGAGTAACTCCAGCTGCCTGAGG + Intergenic
997918759 5:137956924-137956946 AGATTCTCTCCTGCTAACTCTGG - Intronic
998940644 5:147279426-147279448 AGAGACACTCCTGTTATCGGTGG + Intronic
1000043559 5:157503049-157503071 GCTGTCACTCCTGCTACCCGTGG + Intronic
1001871660 5:175161353-175161375 AGGGACACACCTGCAACCTGGGG + Intergenic
1003244401 6:4371727-4371749 AGAGTCACTCTTCCTATCAGGGG - Intergenic
1012636793 6:101552802-101552824 AAAGTCTCTTCTGCCACCTGAGG + Intronic
1013867534 6:114716745-114716767 AGAGTAACTGCTGCTCACTGAGG - Intergenic
1015317259 6:131830356-131830378 AAAGTCTCTCCTCCTTCCTGGGG - Intronic
1019314411 7:377776-377798 AGATTCTCTCCCGCTTCCTGAGG - Intergenic
1019438318 7:1032957-1032979 AGAGGCCCTCCAGCAACCTGGGG - Intronic
1023614610 7:42006996-42007018 AGAGCCTCACCTGCTGCCTGTGG - Intronic
1024025551 7:45407069-45407091 AGATGCACACCTGCTTCCTGAGG + Intergenic
1024097522 7:45995087-45995109 ATACTCACTGCTGCTGCCTGGGG + Intergenic
1024540736 7:50473364-50473386 ATGGCCACTCCTGCTTCCTGGGG + Intronic
1026606990 7:71824851-71824873 ATAGTAACTCCTGTTATCTGGGG + Intronic
1026793021 7:73346969-73346991 CCAGTCACTCCTGGTACATGGGG - Intronic
1027299605 7:76817341-76817363 AAAATCAATGCTGCTACCTGAGG + Intergenic
1029205489 7:98867290-98867312 TGGGTCACTGCTGCTGCCTGAGG + Intronic
1031013750 7:116550346-116550368 AGAGTCAATACTCCTACCAGAGG + Intronic
1031801811 7:126256494-126256516 AGAGTTATTCCTGGTACCTGAGG - Intergenic
1032255994 7:130297526-130297548 AGAGCCACTCCTGCTGCAGGTGG - Intronic
1034501020 7:151451243-151451265 AGCTTCACTCCTGCTCCCTGTGG - Intergenic
1037861686 8:22409879-22409901 GGGGACACTCCTGCTGCCTGGGG - Intronic
1040847313 8:51857286-51857308 AGAGTCACTCCTATTAACTAGGG + Intronic
1046447580 8:114342608-114342630 AGAGTCACTGATGTTACCAGTGG - Intergenic
1047215238 8:122870764-122870786 AGGGTCACTCCTTCTCTCTGGGG - Intronic
1051436818 9:17042578-17042600 AGTCTCACTTCTGTTACCTGGGG - Intergenic
1054924721 9:70577879-70577901 AAAGTCACTCGTGCCACCTGAGG - Intronic
1057483928 9:95467453-95467475 AGAGTCAGTGGTGCTCCCTGGGG - Intronic
1058218131 9:102260489-102260511 GGAGTCACTCATGCTAAATGTGG + Intergenic
1058646149 9:107133102-107133124 AGAGTTACCCCTCCTAACTGCGG + Intergenic
1058782340 9:108351012-108351034 AAAGTCACTCTGGCTACCTGGGG - Intergenic
1059094717 9:111400053-111400075 AGAGACACTCCCTCTACCTGGGG + Intronic
1059850254 9:118330332-118330354 AGAGTGACTCCTGTTGGCTGAGG + Intergenic
1059876781 9:118644118-118644140 AGCTTCACTCCTGGTATCTGTGG + Intergenic
1062002959 9:134226037-134226059 GGAGTCTTTCCTGCTTCCTGGGG + Intergenic
1062366216 9:136210393-136210415 GGAGCCCCTGCTGCTACCTGTGG - Intronic
1186407557 X:9317219-9317241 TTTGTCTCTCCTGCTACCTGGGG - Intergenic
1187937490 X:24350265-24350287 AGAATCACTCTTACTACCTGTGG + Intergenic
1188046246 X:25428625-25428647 AGTCTCAGTGCTGCTACCTGAGG + Intergenic
1190381157 X:49840847-49840869 AGAGGCACACCTGCTCCCTCTGG - Intergenic
1194938210 X:99977321-99977343 AGATACACTCCAGCTACCTTAGG + Intergenic