ID: 1141497006

View in Genome Browser
Species Human (GRCh38)
Location 16:84417152-84417174
Sequence GGTGATGCCCATAGGGTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 68}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141496996_1141497006 18 Left 1141496996 16:84417111-84417133 CCTCTCTGTGCCTCAGTTTTCTC 0: 67
1: 630
2: 2405
3: 5746
4: 10578
Right 1141497006 16:84417152-84417174 GGTGATGCCCATAGGGTACTTGG 0: 1
1: 0
2: 1
3: 6
4: 68
1141496997_1141497006 8 Left 1141496997 16:84417121-84417143 CCTCAGTTTTCTCATCTGCAAAA 0: 81
1: 868
2: 3936
3: 9869
4: 17692
Right 1141497006 16:84417152-84417174 GGTGATGCCCATAGGGTACTTGG 0: 1
1: 0
2: 1
3: 6
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141497006 Original CRISPR GGTGATGCCCATAGGGTACT TGG Intronic
903292614 1:22324347-22324369 TGGGAAGCCCACAGGGTACTTGG + Intergenic
912566913 1:110594048-110594070 GATGATGCCGAAAGGGAACTGGG - Intronic
923065733 1:230515739-230515761 GGTGATGCGCACAGGTTATTTGG + Intergenic
1063557378 10:7093716-7093738 AGCGATGCCCATAGGGTCTTAGG - Intergenic
1064528073 10:16278832-16278854 TGTCATGCAAATAGGGTACTGGG + Intergenic
1069841803 10:71344460-71344482 GGTGATGCCCCCAGGGAGCTGGG + Intronic
1070933307 10:80275586-80275608 GGTGTTGCCCAGAGGACACTTGG - Intronic
1073150488 10:101308052-101308074 GGGGTTGCCCATAGAGCACTTGG + Intergenic
1073488104 10:103834436-103834458 GGTGATGGCTAAAGGGTACAGGG + Intronic
1078894851 11:15588963-15588985 GTTAATGCCCCTAGGGTATTAGG - Intergenic
1085242744 11:75072026-75072048 GGGGATGCCCATAAGGTAGAAGG + Intergenic
1089494007 11:118899438-118899460 GTTCATGCCCATAGGGCTCTGGG + Exonic
1091265898 11:134270753-134270775 GGTGATGCCCATACTGAAGTTGG - Intergenic
1095481444 12:42640305-42640327 CACGATGCCCATAGGGTGCTGGG + Intergenic
1097184934 12:57191465-57191487 GATGATGCCCATGGGCTGCTGGG - Exonic
1100466462 12:94849743-94849765 GGTGATCCCTATAGGCCACTGGG - Intergenic
1102229937 12:111255627-111255649 GGTGATGGCCACATGGTGCTGGG - Intronic
1102798621 12:115711593-115711615 GGTGATGGTCATAGTGTAGTGGG - Intergenic
1103010599 12:117455565-117455587 GGTGCTGCCTTCAGGGTACTAGG - Exonic
1104075104 12:125381818-125381840 GGTGATGTGCATAGGTTACTGGG + Intronic
1120647650 14:87092677-87092699 GCTGATGCCTATAGGTTACCTGG + Intergenic
1123995972 15:25718331-25718353 GGTGGTGCCCAGAGGGGGCTCGG - Exonic
1124898211 15:33797349-33797371 GGTGAATCCCATAGGAGACTGGG + Intronic
1125368276 15:38942536-38942558 TCTGATGCCTATTGGGTACTTGG - Intergenic
1127195617 15:56582652-56582674 GGAAATGACCATAGGGAACTAGG - Intergenic
1131881729 15:96869220-96869242 GATGATGCCCTTAGGGTTGTGGG - Intergenic
1136347349 16:29684681-29684703 GGTGGTGCCCAGAGGGTGGTAGG - Intronic
1138143206 16:54586203-54586225 CGTGTTGCCCATATGGTCCTCGG + Intergenic
1140291044 16:73657567-73657589 GGTGATTGCTAAAGGGTACTAGG - Intergenic
1141324170 16:83039858-83039880 GGTGCTGACCATAGGGTAGGTGG - Intronic
1141497006 16:84417152-84417174 GGTGATGCCCATAGGGTACTTGG + Intronic
1142958987 17:3540583-3540605 GGTGAGACCCTAAGGGTACTGGG + Intronic
1143576445 17:7796529-7796551 GGTGAAGCCCATTGGGAACGTGG + Exonic
1144485019 17:15657078-15657100 GGTGGTGACCATAGGGTAGGTGG - Intronic
1146575437 17:33987069-33987091 AGTGAGGTCCATAGGGTTCTAGG - Intronic
1147628206 17:41913620-41913642 GGTGATGCCGATAGGGTCATGGG - Intronic
1147817642 17:43221535-43221557 GGGGATGGCCATGGGGTCCTGGG + Intergenic
1150069138 17:62137662-62137684 GGTGATGACCATGGTGTACGGGG - Intergenic
1153956138 18:10097937-10097959 GGTGAGCCCCATAGGATCCTGGG - Intergenic
1158161486 18:54489650-54489672 TGTGATTCCCATAGGGTTCTGGG - Intergenic
1158972060 18:62677720-62677742 GGCGCTGTCCATAGGTTACTAGG - Intergenic
1160422443 18:78756158-78756180 GGTGATGACCACTGGGTACCAGG - Intergenic
925878448 2:8331402-8331424 GGTGATCCCCATAGGTAGCTTGG - Intergenic
948243531 2:236458570-236458592 GGTGATGCCAATAAAATACTTGG - Intronic
1169327471 20:4687030-4687052 CGCGATGCCCAGAGGGTGCTTGG + Intronic
1170576788 20:17669333-17669355 GGTGAAGCCCGTAGGCTTCTTGG - Intronic
1175627503 20:60501195-60501217 GGTGATGCCCTGAGGTTACGGGG + Intergenic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1179476990 21:41653322-41653344 GGTGATGCCTAGAGGGTGCAGGG - Intergenic
1180968049 22:19800767-19800789 GGTGATGCCCACAGGGCACTGGG + Intronic
1185028042 22:48426712-48426734 GGAGATGGCCACAGGGTCCTGGG - Intergenic
953250882 3:41245009-41245031 GGTAACGCCCATGGGGTTCTGGG - Intronic
954124398 3:48520233-48520255 GGAAATGCCCATAGGCTTCTGGG - Intronic
955853574 3:63248062-63248084 GGTGATGCACAGAGGGGCCTTGG + Intronic
956704060 3:71984107-71984129 TGTGATGCCCAGAGGAGACTGGG + Intergenic
967138670 3:186534025-186534047 AGTGATCCCTAAAGGGTACTGGG + Intergenic
992131270 5:73695192-73695214 GGTCATGCCCATAGGTTGGTGGG + Intronic
999207183 5:149857614-149857636 GGTGATGTCAATAGAGAACTGGG - Intergenic
1002949976 6:1800109-1800131 GATGATGCCCATATGGTGGTTGG + Intronic
1007178166 6:39910391-39910413 GGTGATGTCCACAAGGGACTTGG - Intronic
1010548117 6:77183951-77183973 GGTGGTGGCCACAGGGTGCTCGG + Intergenic
1012899257 6:104988293-104988315 GGAGATGACCTTACGGTACTTGG + Intronic
1013178839 6:107700956-107700978 GGAGATGCCCATAGGTGACCAGG - Intergenic
1013463489 6:110398164-110398186 GGTGATGACCAGAGGATGCTGGG - Intronic
1014750770 6:125253405-125253427 GAAGATGCCCATGGGCTACTGGG + Intronic
1014998075 6:128177692-128177714 GGTGAAACCCAAAAGGTACTGGG + Intronic
1031504125 7:122559818-122559840 GGTGGTGCCCAGAGGGTTCTCGG - Intronic
1036056484 8:5260633-5260655 GGAGATGCCCATAGGAAACAAGG - Intergenic
1047297154 8:123581260-123581282 GGGGATTCCCATAGGGTGGTTGG + Intergenic
1047430456 8:124786649-124786671 GGAGATGCCCAAAGCGTACTTGG - Intergenic
1055284721 9:74716283-74716305 GGTGATGTACATAAGGTACTTGG - Intergenic
1059713943 9:116895793-116895815 GGAGATGCCAATAGAGCACTGGG + Intronic
1061561523 9:131407254-131407276 GGGCATGCCCTTAGGGTAATGGG + Intronic
1062254914 9:135616350-135616372 GGCGATGCCCAGGGGGTGCTGGG - Intergenic
1186277156 X:7951942-7951964 GGTGATGCACATTGGATCCTTGG - Intergenic
1188840239 X:35008383-35008405 GATGATAGCTATAGGGTACTGGG + Intergenic