ID: 1141500147

View in Genome Browser
Species Human (GRCh38)
Location 16:84438488-84438510
Sequence TGCTCTCTTGGAAATGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141500147_1141500152 30 Left 1141500147 16:84438488-84438510 CCAGTCTCATTTCCAAGAGAGCA 0: 1
1: 0
2: 1
3: 22
4: 218
Right 1141500152 16:84438541-84438563 TCCTCGAATCCAGCCAACCCTGG 0: 1
1: 0
2: 0
3: 8
4: 110
1141500147_1141500150 -3 Left 1141500147 16:84438488-84438510 CCAGTCTCATTTCCAAGAGAGCA 0: 1
1: 0
2: 1
3: 22
4: 218
Right 1141500150 16:84438508-84438530 GCATCTCACCAGCTCAGCTTGGG 0: 1
1: 0
2: 1
3: 12
4: 139
1141500147_1141500149 -4 Left 1141500147 16:84438488-84438510 CCAGTCTCATTTCCAAGAGAGCA 0: 1
1: 0
2: 1
3: 22
4: 218
Right 1141500149 16:84438507-84438529 AGCATCTCACCAGCTCAGCTTGG 0: 1
1: 0
2: 1
3: 19
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141500147 Original CRISPR TGCTCTCTTGGAAATGAGAC TGG (reversed) Intronic