ID: 1141500147

View in Genome Browser
Species Human (GRCh38)
Location 16:84438488-84438510
Sequence TGCTCTCTTGGAAATGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141500147_1141500149 -4 Left 1141500147 16:84438488-84438510 CCAGTCTCATTTCCAAGAGAGCA 0: 1
1: 0
2: 1
3: 22
4: 218
Right 1141500149 16:84438507-84438529 AGCATCTCACCAGCTCAGCTTGG 0: 1
1: 0
2: 1
3: 19
4: 164
1141500147_1141500150 -3 Left 1141500147 16:84438488-84438510 CCAGTCTCATTTCCAAGAGAGCA 0: 1
1: 0
2: 1
3: 22
4: 218
Right 1141500150 16:84438508-84438530 GCATCTCACCAGCTCAGCTTGGG 0: 1
1: 0
2: 1
3: 12
4: 139
1141500147_1141500152 30 Left 1141500147 16:84438488-84438510 CCAGTCTCATTTCCAAGAGAGCA 0: 1
1: 0
2: 1
3: 22
4: 218
Right 1141500152 16:84438541-84438563 TCCTCGAATCCAGCCAACCCTGG 0: 1
1: 0
2: 0
3: 8
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141500147 Original CRISPR TGCTCTCTTGGAAATGAGAC TGG (reversed) Intronic
901448992 1:9324895-9324917 TGCTTTCTTGGAAAAGCGAGTGG + Intronic
902825826 1:18973562-18973584 TCCTCTGTTGGGAGTGAGACTGG - Intergenic
903227055 1:21899838-21899860 TGCTCACCAGGAAATGAGGCAGG + Intronic
906197539 1:43938272-43938294 TTCTTTTTTGGAAATGAGATGGG + Intergenic
908399360 1:63755908-63755930 TGCTCTATAGAAAATGACACAGG - Intergenic
912679580 1:111720593-111720615 TGCTCTCTTGAAAGTGACTCTGG + Intronic
913597559 1:120393381-120393403 TCCTCTCTTGGAGATAAGAGAGG - Intergenic
913669968 1:121088169-121088191 TGCTTTCTTGTAAAGGGGACTGG - Intronic
914021733 1:143875567-143875589 TGCTTTCTTGTAAAGGGGACTGG - Intergenic
914089771 1:144485933-144485955 TCCTCTCTTGGAGATAAGAGAGG + Intergenic
914308838 1:146448283-146448305 TCCTCTCTTGGAGATAAGAGAGG - Intergenic
914434085 1:147644885-147644907 TAGACTGTTGGAAATGAGACTGG + Exonic
914512486 1:148346207-148346229 TCCTCTCCTGGAGATAAGACAGG + Intergenic
914593270 1:149124848-149124870 TCCTCTCTTGGAGATAAGAGAGG + Intergenic
914660219 1:149783518-149783540 TGCTTTCTTGTAAAGGGGACTGG - Intronic
917147299 1:171905975-171905997 TTCCCTCTGGGAAATGAGTCTGG - Intronic
920692123 1:208155056-208155078 TGCTCCCTTGGAAAGGACAGAGG - Intronic
1064652513 10:17523712-17523734 TGCTCTGTGGAAAATGGGACAGG - Intergenic
1065120837 10:22529259-22529281 TAGTCTCTTGTAAAAGAGACTGG - Intergenic
1065920938 10:30392432-30392454 TCCTCTCTACAAAATGAGACAGG + Intergenic
1067111361 10:43403309-43403331 AGATCTCTTGAAAATGACACAGG - Intronic
1067254873 10:44627603-44627625 TGCTCTCCTAGAAATGAGACTGG + Intergenic
1068092287 10:52447613-52447635 TCCTCTCTTGTGAATAAGACAGG + Intergenic
1070261269 10:74858139-74858161 TGCTCTCCTGGAAATGACTCAGG - Intronic
1070827931 10:79401936-79401958 TGCTCTCTGGGAAGGTAGACTGG - Intronic
1072002929 10:91215562-91215584 TGCTGTCTTTGAAAAGAGATGGG + Intronic
1073065265 10:100754896-100754918 TGGTCTCATGGCAAAGAGACAGG + Intronic
1073153800 10:101330456-101330478 TTCTCTCTTGTAGCTGAGACAGG - Intergenic
1073163867 10:101426425-101426447 TGCTATTTTGGAAATCACACCGG + Intronic
1073217125 10:101842630-101842652 AGGTCTCTTGGAAACCAGACTGG + Intronic
1073936795 10:108641895-108641917 TGATCTCAGGGAAATGATACTGG - Intergenic
1077058847 11:609017-609039 TCCTCTCTGGGGAATGGGACCGG - Exonic
1077907079 11:6543017-6543039 TGCTCTATGGGATATGAGGCAGG - Intronic
1083827285 11:65210949-65210971 TCCTTTCCTGGAAATGAGCCTGG + Intronic
1085811330 11:79684618-79684640 TACTCTCTTGGAAATGATGAAGG - Intergenic
1086895486 11:92307260-92307282 TGCTGTTTTGAAAATGAGCCAGG - Intergenic
1087242425 11:95794284-95794306 TTCTTTCTTGAAAATGATACGGG - Intronic
1087731409 11:101782388-101782410 AGCTCACTTGGAAATGAAACTGG - Intronic
1087815472 11:102653604-102653626 TATTCTGTTGGAAATGAGAATGG - Intergenic
1089422114 11:118339789-118339811 TGCTTTGCTGGACATGAGACTGG - Exonic
1090457333 11:126861388-126861410 TACTCTCTTAGAAGTGATACGGG + Intronic
1092388865 12:8057515-8057537 TTATCTCTGGGAAATGAGAGTGG + Intergenic
1092494011 12:8973505-8973527 TGCCATCTTGGAACAGAGACTGG + Intronic
1093218732 12:16393343-16393365 TACTCTTTTGGAAATGAGGAAGG - Intronic
1094364858 12:29669403-29669425 TGCACTATTGGAAATCAGATGGG - Intronic
1097957333 12:65499553-65499575 TGCTCTCTTGATAACAAGACAGG + Intergenic
1098121431 12:67244263-67244285 GGTTCTCTTGGAACTGATACTGG + Intergenic
1098539131 12:71632462-71632484 TGCTTTCTTGGACTTGATACTGG + Exonic
1099018636 12:77375817-77375839 TGCTCCCCTGGAAATGAAGCAGG - Intergenic
1099348509 12:81534510-81534532 TTCCCTCTTGGAAATTATACTGG + Intronic
1102145868 12:110654805-110654827 TCCGCCCTTGGAACTGAGACAGG + Intronic
1102653214 12:114458330-114458352 TGCTCTGTGGCAAATGAGAAAGG - Intergenic
1104104116 12:125642897-125642919 TGCTTCCTTGGAAATGAAACCGG - Intronic
1104257419 12:127151955-127151977 TGTTCTCTTGGGAATGAGAAAGG + Intergenic
1104959630 12:132482375-132482397 TGCTCTCGTGCCAATGGGACCGG - Intergenic
1107483101 13:40801549-40801571 TGGTCTGATGGAAAGGAGACTGG - Intronic
1108354459 13:49617769-49617791 TGCTATCTTGCACATGGGACAGG - Intergenic
1111735713 13:92136909-92136931 TGCTATCTTGGAGATGAGTCTGG - Intronic
1114278677 14:21170122-21170144 GGCTCACTTGGAAGAGAGACTGG - Intergenic
1114496675 14:23137654-23137676 TGCTCCTTTTGAAATGAGACAGG + Intronic
1115292882 14:31792827-31792849 TGCTATCTGTGAAATGACACTGG - Intronic
1117480337 14:56137420-56137442 TGCTGTTTTGGCAATGGGACAGG - Intronic
1120074504 14:80140291-80140313 CTCTCTCTTGGGAAGGAGACAGG - Intergenic
1120288576 14:82537261-82537283 TGGTCTCTGGGAACTGAGAGTGG + Intergenic
1121182198 14:91937593-91937615 GGTTATCTTGGAAATGAAACTGG + Intronic
1121803964 14:96797907-96797929 TGCTTTCTTAGAAACGGGACAGG + Intronic
1121871962 14:97416368-97416390 TGTTGTGTTGGAAATGAGGCTGG + Intergenic
1121993575 14:98584440-98584462 GGCTCTCTTAGAGTTGAGACAGG - Intergenic
1122180547 14:99951181-99951203 TGCTCTCATGGAACTGTGAATGG + Intergenic
1123118130 14:105903952-105903974 TTCTGTCTTGGAAATGACCCAGG + Intergenic
1123120412 14:105913814-105913836 TTCTGTCTTGGAAATGACCCAGG + Intergenic
1123403137 15:20005392-20005414 TTCTGTCTTGGAAATGACCCAGG + Intergenic
1123512476 15:21012046-21012068 TTCTGTCTTGGAAATGACCCAGG + Intergenic
1123675368 15:22705883-22705905 TGCTATCTCGGAGATGAGTCTGG - Intergenic
1124327361 15:28778836-28778858 TGCTATCTCGGAGATGAGTCTGG - Intergenic
1124495778 15:30185973-30185995 TACTCTCTTGGGAATGAGCCAGG - Intergenic
1124529371 15:30490781-30490803 TGCTATCTCGGAGATGAGTCTGG - Intergenic
1124747795 15:32352673-32352695 TACTCTCTTGGGAATGAGCCAGG + Intergenic
1124769285 15:32516909-32516931 TGCTATCTCGGAGATGAGTCTGG + Intergenic
1124903037 15:33842279-33842301 TGCTCTCCTGGTAAGGAAACAGG - Intronic
1127598934 15:60515448-60515470 TGCTGTTTGGGAAATGAGAGGGG + Intronic
1127979305 15:64022909-64022931 TGCTATCTTAGAATTTAGACTGG - Intronic
1128159962 15:65417156-65417178 TGTTCTCTGGGAAAGGAGAATGG - Intronic
1128783715 15:70379602-70379624 TGCCCTCTTGGAACTGACATTGG + Intergenic
1129286581 15:74530153-74530175 TTCTCTCTTGGGACTGAGAAGGG + Intergenic
1130624910 15:85504268-85504290 TGCTCTCTGGGAGAGGAGAGAGG + Intronic
1131972836 15:97909377-97909399 TGCTCTCTTTGAAGTGAGGTGGG - Intergenic
1133746542 16:8691387-8691409 TGCTCTCCAGGAAATGTGGCAGG - Intronic
1134852712 16:17494474-17494496 TGCTCTCCTGGAAAAGATTCTGG + Intergenic
1138552087 16:57753684-57753706 TGCTCTGATGGAACTGAGAGGGG + Intronic
1139224782 16:65223652-65223674 TGCTTTCTTGGAAATGGAAGTGG + Intergenic
1141500147 16:84438488-84438510 TGCTCTCTTGGAAATGAGACTGG - Intronic
1141753764 16:85977638-85977660 TGCTGGCATGGAAATGAGAAGGG - Intergenic
1143622416 17:8088062-8088084 TCCTCTCTGGGAAATGGGACAGG + Intergenic
1143949863 17:10623945-10623967 TGCCCTCCTGGAGCTGAGACTGG + Intergenic
1147677663 17:42219102-42219124 TGCTGTCCTGGAGATGGGACAGG - Intronic
1148665445 17:49371357-49371379 AGCTCTCATGGAGATGAGATGGG + Intronic
1149756213 17:59188309-59188331 TGCTCTCTTGTTATTGAGAATGG + Intronic
1150282295 17:63935778-63935800 AGCTCTATTAGAAATGACACTGG - Intergenic
1151154102 17:72112445-72112467 AGCTCCCTTTGAAATGTGACTGG - Intergenic
1152168023 17:78723581-78723603 TGCATTCATGGAAATGAGCCTGG - Intronic
1152291523 17:79442659-79442681 TCCTCTCTGGGAAATGAGGTTGG - Intronic
1153661597 18:7330984-7331006 TGCACTCATCCAAATGAGACAGG - Intergenic
1156026799 18:32664024-32664046 TTCTCTCTTGGAAGAGAGAATGG + Intergenic
1156815288 18:41303196-41303218 TGGAATCTTGGAAATGAGATTGG - Intergenic
1158069222 18:53450909-53450931 CGCTCACTTGAAAATGAGAAGGG - Intronic
1158849867 18:61484891-61484913 TGCTGTTTTGTAAATGAGACTGG - Intronic
1159025913 18:63182078-63182100 TACTCTCTGGGAAAAGAGAAAGG - Intronic
1167759691 19:51438096-51438118 TGTTGTCTTGGAAATCAGAGGGG + Intergenic
1168070690 19:53949589-53949611 CTCTCTCTGGGAAATGAGGCTGG - Intergenic
926694562 2:15762207-15762229 TACTATCATGAAAATGAGACGGG - Intergenic
928159607 2:28909995-28910017 TCCTCTCTGGGAAATGTAACTGG - Intronic
928874784 2:36025177-36025199 TACTCTGTTGGAAATGAGGTAGG - Intergenic
930396053 2:50826011-50826033 TGCTCTCATGGAAATTACAGTGG + Intronic
930805681 2:55487015-55487037 TGCTATCTTGGAAAGGATCCTGG - Intergenic
930927050 2:56830761-56830783 TGCTCTCCAGGGAATGAGAGGGG + Intergenic
931456684 2:62414998-62415020 TGCTCTCTGGGAAAAGATCCGGG - Intergenic
931459326 2:62436614-62436636 TGGTGTCCTGTAAATGAGACTGG + Intergenic
935816574 2:106851930-106851952 TGTTTTCTTGGATATGTGACGGG - Intronic
936294650 2:111258324-111258346 GCCTCTCTGGGAAGTGAGACTGG + Intergenic
936536208 2:113313436-113313458 TACTGTCTGGGAAATGAGAATGG - Intergenic
939534334 2:143407589-143407611 TGCTTTGATGGAAATGTGACAGG + Intronic
939582251 2:143964607-143964629 TGCTCTGATGAAAATGAGACAGG + Intronic
940206305 2:151205833-151205855 TCCTTTCTTTGAAATGACACCGG - Intergenic
942968108 2:181921899-181921921 TTCTCTCTTGGAATTAAGATTGG - Intronic
943667647 2:190626963-190626985 TGATTTTCTGGAAATGAGACAGG - Intergenic
944032384 2:195251184-195251206 TTCTTTCTTGAAATTGAGACTGG + Intergenic
944505199 2:200403848-200403870 TGCCCTTATGGAAATGAGATAGG - Intronic
945104504 2:206297350-206297372 TGCTCTCTTGACAATGATATGGG - Exonic
947406878 2:229787534-229787556 TGCTATCTTGAGAATCAGACTGG + Exonic
1168976706 20:1971713-1971735 CACTCTCTAGGAGATGAGACAGG - Intergenic
1170846911 20:19969958-19969980 TGCTTTCTTGGAAATGGCAAAGG - Intronic
1172808296 20:37629197-37629219 TGCTCTCAAGGAAAGGAGAGAGG + Intergenic
1172968809 20:38858609-38858631 TGCTCTTCTGGCAATGAGATTGG + Intronic
1174772808 20:53317148-53317170 TTCACTCTGGGAAATCAGACTGG - Intronic
1175318924 20:58071795-58071817 TGCTCTCTTTTAAATAAGAGAGG - Intergenic
1175762474 20:61571035-61571057 TGCCCCCTTGGAGATGAGCCAGG - Intronic
1177749919 21:25268356-25268378 AGCTCACTTAGAAATGAAACTGG + Intergenic
1178772893 21:35522025-35522047 TGCTGCCTTGGAACTGAGACAGG + Intronic
1178939262 21:36891316-36891338 TTCTCTCCTGCAAATGAGATAGG - Intronic
1180567694 22:16689158-16689180 AGCTCTCTTTGAAATGACATCGG + Intergenic
1182780751 22:32865620-32865642 TGAGCTGTTGGAAATGAGAGGGG - Intronic
1184368657 22:44068742-44068764 TGCTCTCTGGGCCCTGAGACAGG - Intronic
1184369070 22:44071062-44071084 TGCTCTCTGGGAAATGTCGCTGG - Intronic
950779417 3:15378527-15378549 TTGTCTCTTGGAAATGAGGTAGG - Intergenic
951463693 3:22978593-22978615 TGGTCTCCTGGAAAAGAGGCAGG + Intergenic
951519358 3:23596992-23597014 TGCTCTCCTGAATATGAGGCTGG - Intergenic
953532142 3:43748429-43748451 TTCCCTCTTGGAAATGAATCAGG - Intergenic
957433188 3:80140490-80140512 TGCTCAATTGGGAATGAAACGGG + Intergenic
957503984 3:81096141-81096163 TACACTCTTTGGAATGAGACTGG - Intergenic
958774993 3:98471706-98471728 TGCTTTCTGGGAATTTAGACAGG - Intergenic
960046943 3:113208307-113208329 TGCTTTCTTGGAAATGTTATGGG - Intergenic
961022987 3:123525212-123525234 TGGTCTCTTGGAAAGGAAAAAGG + Intronic
961539820 3:127591670-127591692 TGCTCGGAAGGAAATGAGACTGG - Intronic
962626812 3:137233864-137233886 TGCTCTCTGGCAGATGGGACTGG - Intergenic
963640132 3:147850764-147850786 TGCTCACTCAGAAATGAGCCTGG - Intergenic
964747234 3:160023820-160023842 TGCAGTCTTAAAAATGAGACTGG + Intronic
966265830 3:178042004-178042026 TGCTGTGTTTGAAATGAGAGTGG + Intergenic
967322303 3:188206649-188206671 TCATCTCTTAGAAATGAGACGGG + Intronic
967505096 3:190244926-190244948 TGCTCTCTTTGAAGAGAGAAAGG - Intergenic
967706564 3:192658001-192658023 TGCTCTTTTGGAAAACAGAAAGG + Intronic
972126380 4:35771724-35771746 AATTCTCTTGGAAATGAGCCTGG - Intergenic
974017533 4:56662284-56662306 TTCTCTCTTAGAAATCAGAATGG + Intronic
974871038 4:67642389-67642411 TGATCTCATGGAAAGCAGACTGG - Intronic
975212549 4:71718089-71718111 TGCTCTCAAGGAAATAAGAGAGG - Intergenic
975296335 4:72738526-72738548 TGCTCTCTTGCCCATGAAACTGG + Intergenic
975790270 4:77941720-77941742 TGCTCAATTAGAAATGAAACAGG - Intronic
976508136 4:85873378-85873400 TGCTCACTTGGAAAGGAAATAGG - Intronic
977791262 4:101106352-101106374 TTCTCTCTTTTAAATGAGACAGG - Intronic
978656423 4:111070530-111070552 TGTTCTCCTGGAAATGGGCCTGG - Intergenic
984040966 4:174733442-174733464 TGCTATCTTTGAAATTTGACTGG - Intronic
984311970 4:178072896-178072918 TACACTCTTGGATATGAGCCAGG - Intergenic
985366646 4:189237816-189237838 TGCTCTCAGGGAAAGGAGACAGG - Intergenic
988707874 5:33743292-33743314 AGCACTATTCGAAATGAGACTGG + Intronic
991405512 5:66297548-66297570 TGCTCACATGGTGATGAGACTGG + Intergenic
996401573 5:123068832-123068854 TGTTCTTTTGCAAATGTGACTGG + Intergenic
997087154 5:130815211-130815233 TATTCTCTTGGATATGAGTCTGG - Intergenic
997765305 5:136497226-136497248 AGCTCACTTTGAAATGAAACAGG - Intergenic
1002098999 5:176848153-176848175 TGCTAACGTGGAAATGAGGCGGG - Intronic
1002872201 6:1177158-1177180 AGCTCTCTTGCAAGGGAGACTGG + Intergenic
1002881569 6:1257038-1257060 TGCTCTCTTGCAAAGGAAGCTGG - Intergenic
1004555815 6:16696839-16696861 CTTTCTCTTGGAAATGAGAAGGG - Intronic
1004886365 6:20054916-20054938 TGCTCTGTCAGAAATGAGACAGG + Intergenic
1005242797 6:23851884-23851906 TGCTCTCTTGCTAATCAGACAGG + Intergenic
1006280097 6:33045350-33045372 AGCTCAATTAGAAATGAGACAGG - Intergenic
1006523574 6:34586310-34586332 TGTTCTCTTGGCAATCAGACAGG + Intergenic
1006961334 6:37933731-37933753 TCCTCTCTTTGAAATGAGAGAGG + Intronic
1009450479 6:63794105-63794127 TTCTCTCTGGGAAATAAGAAGGG + Intronic
1015373608 6:132484478-132484500 TGCTGTCTGACAAATGAGACTGG + Intronic
1015603388 6:134932658-134932680 TGCTTTCTCGGAAATGGCACTGG + Intronic
1016289695 6:142515467-142515489 TGCTCAATTAGAAATGAAACAGG - Intergenic
1016664559 6:146621406-146621428 TGCTCCCCTGGAAAGGAGTCAGG + Intronic
1017915704 6:158830125-158830147 GGTTTTCTTGAAAATGAGACAGG - Intergenic
1018543646 6:164912408-164912430 TCCTCTCTTGGAAAAGAGTGTGG + Intergenic
1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG + Intronic
1022148272 7:27570052-27570074 TGCTGTCTTTGAATTCAGACTGG + Intronic
1022482142 7:30751369-30751391 TCTTCTCTTTGAAATGGGACTGG - Intronic
1022787310 7:33651420-33651442 TGCTGTTTTGCAAATGAAACTGG + Intergenic
1028804259 7:95006749-95006771 TGGTCTCCTGGAGGTGAGACAGG + Intronic
1029034161 7:97501241-97501263 TGGTCTCTGAGAAATGAGGCAGG + Intergenic
1031452042 7:121933929-121933951 TGCTCAATTGGAAATTAGAAAGG - Intronic
1031496395 7:122454281-122454303 TTCTCTTTTGGAAAGGAGACAGG - Intronic
1036130289 8:6103414-6103436 GGCTTTCTTGGAAACGAGATGGG + Intergenic
1036760237 8:11503691-11503713 TGCTCTCTTGGTCACCAGACTGG + Intronic
1037813812 8:22101698-22101720 TGCACTCCTGGAACTGAGACAGG - Exonic
1038513839 8:28166732-28166754 TGCCCTTTTGGAAATGGTACAGG - Intronic
1039122492 8:34162948-34162970 TGGTCTCATTGAAATGAGATGGG + Intergenic
1039593655 8:38771152-38771174 TGCTGTATTGGGAAAGAGACGGG + Intronic
1039794458 8:40900419-40900441 TTCTCTCTGGAAAATGAGGCAGG + Intergenic
1040582639 8:48709591-48709613 TGCTGTCTTGGAAACGAAAGAGG - Intergenic
1042363045 8:67903912-67903934 TGGCATCTTGGAAAGGAGACAGG - Intergenic
1042442601 8:68845537-68845559 TGCTCTCAAGGACATAAGACAGG - Intergenic
1043594954 8:81874328-81874350 GGATCTTTTGGAAATGACACCGG - Intergenic
1046261198 8:111770513-111770535 TACTTTCTAGGAAATCAGACAGG - Intergenic
1047578705 8:126188125-126188147 TGATCTTTTGGATGTGAGACAGG - Intergenic
1047938505 8:129804936-129804958 TCCCCTCTTGGAAGTGAGGCTGG - Intergenic
1053405097 9:37867142-37867164 TGCTCTCTTGTAAATGAACTAGG + Intronic
1055129834 9:72762388-72762410 TGCTACCTTGAAAATGTGACTGG + Intronic
1055592677 9:77833721-77833743 TCCTCTCTAGGAAATTAGTCTGG + Intronic
1055634052 9:78256914-78256936 TGGTCTCTTGGAAATTATAATGG + Intronic
1056094236 9:83234603-83234625 GGCTCTATTGGAACTGAGCCTGG + Intergenic
1058737342 9:107905805-107905827 TGTTCTCTTGGAAGAGAGAATGG + Intergenic
1058855788 9:109060917-109060939 TGATCAATTGTAAATGAGACCGG - Intronic
1059283852 9:113156308-113156330 TCCTCACCTGGAAATGAGAGGGG + Intronic
1059359801 9:113733339-113733361 TGTTCTCTAGGAGATGAGAAGGG + Intergenic
1061822014 9:133234229-133234251 TGCTCTGTTAGAAAAAAGACAGG - Intergenic
1185990195 X:4886258-4886280 TGATCTCTTAGAAATCAGCCAGG + Intergenic
1186964295 X:14771362-14771384 TGCTCTGTCTGAAATAAGACAGG - Intergenic
1187148408 X:16658674-16658696 TGCTCTCTGGGAAGTGAAGCTGG - Intronic
1188682390 X:33026853-33026875 CACTCTCTTGGAAATGAGAAAGG - Intronic
1190758522 X:53421646-53421668 TGCTATACAGGAAATGAGACAGG - Intronic
1191870367 X:65740319-65740341 TGCGGTCTAGGGAATGAGACAGG + Exonic
1192439610 X:71164934-71164956 TGCTCTCTTGGAAGGGTCACTGG - Intronic
1192732977 X:73819590-73819612 TGCTTTGTTGGAAATTAAACTGG - Intergenic
1193460694 X:81788050-81788072 AGCTCAATTAGAAATGAGACTGG - Intergenic
1194125690 X:90013194-90013216 TGCCCTGTTGGATATCAGACTGG + Intergenic
1194860277 X:98990850-98990872 TGCCCTGTTGGACATCAGACTGG - Intergenic
1197318760 X:125002299-125002321 TGCTCTCTAGGAAAGAAGATAGG - Intergenic
1197537019 X:127702733-127702755 TGCTCTGTTTTATATGAGACTGG - Intergenic
1197645690 X:129014005-129014027 TGCTCCCTTGGAAAACAGATAGG - Intergenic
1198168026 X:134076873-134076895 TATTCTCTTGGAAAGGAGAATGG + Intergenic
1198248498 X:134855797-134855819 TGGTCTCTTGAAACTGGGACAGG + Intergenic