ID: 1141500757

View in Genome Browser
Species Human (GRCh38)
Location 16:84442734-84442756
Sequence CACCACCAACAGATGGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141500757_1141500765 25 Left 1141500757 16:84442734-84442756 CCTTGGGCCATCTGTTGGTGGTG 0: 1
1: 0
2: 2
3: 15
4: 167
Right 1141500765 16:84442782-84442804 GGGACTTCAGCAAGTTCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 179
1141500757_1141500762 4 Left 1141500757 16:84442734-84442756 CCTTGGGCCATCTGTTGGTGGTG 0: 1
1: 0
2: 2
3: 15
4: 167
Right 1141500762 16:84442761-84442783 AGGTGAGCTCTGAGATTCCACGG 0: 1
1: 0
2: 2
3: 22
4: 231
1141500757_1141500763 5 Left 1141500757 16:84442734-84442756 CCTTGGGCCATCTGTTGGTGGTG 0: 1
1: 0
2: 2
3: 15
4: 167
Right 1141500763 16:84442762-84442784 GGTGAGCTCTGAGATTCCACGGG 0: 1
1: 0
2: 1
3: 18
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141500757 Original CRISPR CACCACCAACAGATGGCCCA AGG (reversed) Intronic
900434762 1:2624177-2624199 CACCACTCACAGAAGGACCAGGG + Intronic
902541516 1:17158924-17158946 CTCCACCACCATGTGGCCCAAGG - Intergenic
902716574 1:18276836-18276858 GACCACCAAACGATGGCCCCAGG - Intronic
902854139 1:19187724-19187746 CCCCATCCACAGATGGCCTAAGG + Intronic
902926426 1:19698742-19698764 CTCCATAAAGAGATGGCCCAGGG + Intronic
903201250 1:21741353-21741375 CAGCAACAACGGATGCCCCAAGG + Intronic
908520418 1:64935963-64935985 CCCCACAAACAGACGGTCCAGGG + Intronic
910771154 1:90834016-90834038 CACAGCCCACAGATGGCCCAGGG - Intergenic
913063116 1:115225952-115225974 CCCTACCCATAGATGGCCCATGG - Intergenic
913109005 1:115641615-115641637 CACTATAAACACATGGCCCAGGG - Intergenic
914917017 1:151825131-151825153 GCCCACCAACTGTTGGCCCAGGG + Intronic
915528776 1:156491510-156491532 ACCCCCCAACAGATGGCCAAGGG + Intronic
916064818 1:161127824-161127846 CACAATCAACAGCTGGCCCAAGG - Intronic
917454489 1:175174356-175174378 CAATACAAACAGCTGGCCCAAGG + Intronic
917488873 1:175480239-175480261 CAGCACCAACAAGTGGCTCAGGG + Intronic
918046614 1:180945371-180945393 CACCTCCACCAGGCGGCCCACGG - Exonic
918181052 1:182086322-182086344 CACTGCCCACAGATGGCCCTGGG + Intergenic
919910226 1:202106580-202106602 CCACACCCACAGATTGCCCAAGG + Intergenic
920437945 1:205960346-205960368 CACAACCAAATGATAGCCCAAGG - Intergenic
922709423 1:227815908-227815930 CAGCACCGACAGACGCCCCAAGG - Intronic
1063049340 10:2429819-2429841 CACCACCAGCACAGGGCCCAGGG - Intergenic
1064211814 10:13366200-13366222 CACCACCAACAAATGGTCAGGGG - Intergenic
1066058336 10:31701480-31701502 CAAAAGCAACTGATGGCCCATGG + Intergenic
1070207136 10:74275096-74275118 CAGCTCCAACAGATTACCCAGGG - Intronic
1076846264 10:133070995-133071017 CACCAGGCACAGATGGCGCACGG + Intronic
1077416853 11:2427970-2427992 CATCACTCACAGCTGGCCCACGG - Intergenic
1079370854 11:19850939-19850961 CACAACCCACAGCTGGCCCCTGG - Intronic
1083460462 11:62807528-62807550 CACCTCCAACCGGTGGCTCATGG - Exonic
1083783890 11:64932992-64933014 AAGCATCAAAAGATGGCCCAGGG + Intronic
1085496847 11:76978122-76978144 CACCATCAATGTATGGCCCATGG - Intronic
1085806563 11:79642222-79642244 TACCACCACGAGATGGCCAAAGG - Intergenic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1089183773 11:116600973-116600995 CAACAACAACAACTGGCCCAAGG + Intergenic
1091163907 11:133453609-133453631 CACCAGCCACAGATTTCCCAAGG - Intronic
1091284897 11:134403143-134403165 CACCACCGACATGTAGCCCAAGG + Intronic
1097189348 12:57212130-57212152 CAGCACCAACGGATGACCAACGG + Exonic
1099492838 12:83307496-83307518 CTCCACCAACAGCTGGCACTGGG + Intergenic
1099507559 12:83498374-83498396 CACCACAAACTGAAGGCCAAAGG + Intergenic
1103713550 12:122930020-122930042 CACCAGCAGCTGCTGGCCCAGGG - Exonic
1108595954 13:51949627-51949649 CACAACCACCATATAGCCCAAGG + Intronic
1113074493 13:106454547-106454569 CACCCCAGACAGATGGGCCATGG - Intergenic
1113427951 13:110225250-110225272 CACTTCGAACAGATGGCACAGGG + Intronic
1114286443 14:21248580-21248602 TACCAACAAAAAATGGCCCAAGG + Intronic
1115851006 14:37590549-37590571 CTCTACCCACAGATGGCCCTGGG - Exonic
1118956700 14:70489267-70489289 CACCACCATCACATGCCACAAGG - Intergenic
1119039742 14:71262573-71262595 CACACCCAACAGATGGCTTAAGG + Intergenic
1122942815 14:104990024-104990046 CACCACACACAGAGGGCACACGG - Intronic
1122948946 14:105030092-105030114 CACCACCCAGAGATAGCCCCTGG - Intergenic
1124011367 15:25842046-25842068 CAACAGCAACAGGTGGCCCAGGG - Intronic
1124573555 15:30887332-30887354 CACAACCAAAAGATGGCCATTGG - Intergenic
1126804090 15:52328522-52328544 TACCAGCTACAGATGTCCCATGG + Intronic
1127962090 15:63897532-63897554 CAACCCCAACAGATGGCCACTGG + Intergenic
1129118781 15:73382221-73382243 CACCACCAGCAGAAAGCCCATGG - Intergenic
1129152435 15:73697331-73697353 CACCCCCAGCAGCTGGGCCAAGG - Intronic
1129245403 15:74276167-74276189 CATCACCAGCAGATGGCCCTTGG - Intronic
1129887499 15:79048920-79048942 CACCACCACAGGGTGGCCCATGG + Intronic
1130231393 15:82099969-82099991 CCCCACGAACAAATGGTCCAGGG + Intergenic
1132561155 16:594725-594747 CAACACCAACAGTAGGCACAGGG - Intronic
1132951207 16:2563417-2563439 CACCATCAACAACTGGCACAGGG - Intronic
1132963143 16:2636753-2636775 CACCATCAACAACTGGCACAGGG + Intergenic
1134773421 16:16830810-16830832 CCCCACCTACAGCTGGCCCTGGG + Intergenic
1136222154 16:28835708-28835730 CACCACCAGCAGCTGCCCCACGG + Exonic
1137729932 16:50681762-50681784 CACCACCAACAGAAAGTCCCAGG + Intergenic
1139420479 16:66846636-66846658 CACCAACACCAAATTGCCCAAGG + Intronic
1140480895 16:75262372-75262394 CCCCACCAACAAATGGACAATGG + Intronic
1140788346 16:78365302-78365324 CATAACCAACAGCTGGCTCACGG - Intronic
1141500757 16:84442734-84442756 CACCACCAACAGATGGCCCAAGG - Intronic
1141612820 16:85192770-85192792 CCCTTCCAACAGCTGGCCCAGGG - Intergenic
1142103049 16:88285722-88285744 CACCACTCAGAGAGGGCCCAGGG - Intergenic
1142497386 17:313531-313553 CACAAGCAACAGCTGGCCCTGGG - Intronic
1144454342 17:15406648-15406670 CCCCACCACCAGCTGGTCCATGG + Intergenic
1144623893 17:16834635-16834657 CAGCACCAAGGGATGCCCCACGG - Intergenic
1144882536 17:18438081-18438103 CAGCACCAAGGGATGCCCCACGG + Intergenic
1145149698 17:20506305-20506327 CAGCACCAAGGGATGCCCCACGG - Intergenic
1146005746 17:29159611-29159633 CACCACCACCAGAAGGCCCTAGG + Intronic
1147897348 17:43759232-43759254 CCCCACCAACAAATGGCCCAAGG + Intergenic
1149667881 17:58378648-58378670 CACTCCCATCAGATGGCCCGAGG - Intronic
1149792453 17:59491176-59491198 CAGCACCAAAAGATAGCCTACGG - Intergenic
1150030032 17:61723387-61723409 CACCACCAGCAAAAGGCCCAAGG + Intronic
1151527822 17:74682973-74682995 CAAAAACAACAGATGTCCCATGG + Intronic
1152457040 17:80422541-80422563 GATCACCAAAAGATGTCCCAGGG + Intronic
1152578969 17:81157678-81157700 CATCAGCATCAGATGCCCCAGGG + Intronic
1152668553 17:81586914-81586936 CACCACCACCACATTTCCCATGG + Intronic
1152715464 17:81898254-81898276 CACCACCCACATCTGGCCCACGG - Intronic
1155862266 18:30917862-30917884 CACCACCCATAGATTACCCAAGG + Intergenic
1156111225 18:33729865-33729887 TAACACCAAGAGATGTCCCAGGG + Intronic
1156219566 18:35037996-35038018 GACCACCAGCAGAGTGCCCATGG - Intronic
1157581365 18:48776043-48776065 CACCTGCAAAAGACGGCCCAAGG - Intronic
1157682741 18:49619604-49619626 CACCACTCAGAGATGGCCCCAGG - Intergenic
1160195791 18:76754060-76754082 CTCCACCCACAGGTGCCCCAAGG - Intergenic
1160780794 19:877133-877155 CACCTCCAGCGGGTGGCCCATGG + Exonic
1161076316 19:2287504-2287526 CACGATGTACAGATGGCCCAGGG - Intronic
1163578032 19:18122039-18122061 GACCACCACCAGACGGGCCAGGG - Intronic
1164630264 19:29757513-29757535 GACCACTTAGAGATGGCCCAGGG + Intergenic
1164853164 19:31501204-31501226 CAGCACCAACACATGGCTGAGGG - Intergenic
1165059554 19:33198456-33198478 GACCACCTGCAGGTGGCCCAAGG + Intronic
1165638575 19:37364554-37364576 CACCTCCAGCAGCAGGCCCAGGG + Intronic
1165665249 19:37622286-37622308 AAGCACCACCAGATGGCTCAAGG + Intronic
1165805907 19:38580380-38580402 GACCACCGCCAGAAGGCCCACGG - Exonic
925801378 2:7605221-7605243 CACTACCAATCCATGGCCCAGGG + Intergenic
926113330 2:10196272-10196294 CCCCACCAACTGCAGGCCCACGG + Intronic
926892216 2:17648677-17648699 CACCACCTACTGATTCCCCATGG + Intronic
928389345 2:30897344-30897366 CACCCCAAACAGATGCCCCCTGG + Intergenic
929594966 2:43170112-43170134 CGCCCCCTAGAGATGGCCCAAGG - Intergenic
930403297 2:50919768-50919790 TTCCTCCAACAGATGGCACAAGG + Intronic
931894756 2:66716456-66716478 CACTCACCACAGATGGCCCAGGG - Intergenic
933231201 2:79809611-79809633 CCCCACCAAAAGATGGGCAAAGG - Intronic
933598688 2:84308042-84308064 CACCACCAGCTGAGGGACCACGG + Intergenic
934659168 2:96134013-96134035 AACCAGCAACAAATGGCCCATGG - Exonic
935562337 2:104572207-104572229 CACCCCCAGAAGACGGCCCAAGG + Intergenic
940512892 2:154641660-154641682 CACCACCAACAAATGAAACAGGG + Intergenic
940562302 2:155313850-155313872 CACCACCAACAATTAGCCCCAGG + Intergenic
944155164 2:196600026-196600048 CCCCACCAAATGATGGCTCAGGG - Intergenic
945022995 2:205592882-205592904 CACCTGCAGCAGATGCCCCATGG + Intronic
945049979 2:205814436-205814458 CAGCAACAATAGATGGCACAAGG + Intergenic
1170561193 20:17559993-17560015 CACCAAAAACAGATAGCCAAAGG - Intronic
1173284168 20:41655362-41655384 CACCCCCAGCAACTGGCCCAGGG + Intergenic
1173932514 20:46832650-46832672 CAGCCCCAGCAGATGACCCAGGG + Intergenic
1178417378 21:32414763-32414785 CACCACCTACTGCTGGCTCAGGG - Intronic
1180580036 22:16825642-16825664 CAGCAGCAAAAGATGGGCCATGG - Intergenic
1181061207 22:20282910-20282932 CACTAACAAAAGATGGGCCAGGG - Intronic
1181688107 22:24543152-24543174 CACCACCGACACAGTGCCCAGGG + Intronic
1184115821 22:42421580-42421602 CACCACCAAGTCATGGGCCAGGG + Intronic
1184856648 22:47150019-47150041 CACCAGGAGCAGATGGGCCAGGG + Intronic
1185271618 22:49932111-49932133 CACCACCACCAGACGGCCTGTGG - Intergenic
950716217 3:14849419-14849441 AACCACAAGCAGATGGCCCATGG - Intronic
951255768 3:20447678-20447700 CACCTCCAGCAGCAGGCCCAGGG - Intergenic
952180424 3:30910968-30910990 CAATAGCAACACATGGCCCAGGG - Intergenic
955028851 3:55197174-55197196 CACCACCAAGACATTTCCCAAGG + Intergenic
960804385 3:121568874-121568896 CAATAACAACAGATGGCCTAAGG - Intergenic
961217217 3:125168928-125168950 CACCTCCCACAGATGGCAGAGGG + Intronic
962520532 3:136194710-136194732 CACCACCACCAGATGAACCGAGG + Intronic
963890531 3:150631551-150631573 CACCACCAGTCCATGGCCCAAGG - Intergenic
977586903 4:98784261-98784283 CTCCACCAAATTATGGCCCAGGG + Intergenic
978249096 4:106609868-106609890 CAGCTGCACCAGATGGCCCATGG - Intergenic
978661896 4:111137180-111137202 CACCACCAACACAGGCCACAAGG + Intergenic
982543650 4:156707384-156707406 AAACACCAAAAGATGTCCCAGGG + Intergenic
983263189 4:165478832-165478854 TACCCCCGACAGATGGGCCATGG + Intronic
985159711 4:187031811-187031833 CCCCATCAACAAGTGGCCCAAGG - Intergenic
985921115 5:2975536-2975558 CTCCTCCAACTGATGACCCAGGG + Intergenic
988078301 5:26382080-26382102 CACTACCAAGGGAGGGCCCAGGG + Intergenic
988448810 5:31318857-31318879 CACCAAGAACAGAATGCCCAGGG + Intronic
992227717 5:74635207-74635229 CACAATCAACAAATGGACCATGG - Exonic
994309131 5:98246137-98246159 CTCCATCTACAGATGACCCAAGG + Intergenic
997845392 5:137281559-137281581 ACCCACCAACACATAGCCCATGG + Intronic
1003367081 6:5485002-5485024 CTCCACCAACTGAGTGCCCAGGG - Intronic
1006505873 6:34488244-34488266 GAGCACCAAGAGATGTCCCAGGG + Intronic
1007384265 6:41510124-41510146 CACCACCAGCACTGGGCCCAAGG + Intergenic
1012982218 6:105842884-105842906 GACCACCAACAGTCAGCCCATGG + Intergenic
1013947018 6:115733607-115733629 CTGCAATAACAGATGGCCCAAGG - Intergenic
1016908177 6:149171851-149171873 GGCCACCAACATATGGCTCATGG - Intergenic
1017227018 6:152033462-152033484 CACCATCAACAAATGGGCGAAGG + Intronic
1018872597 6:167795123-167795145 CACCACCAACAGCTTCTCCATGG - Intronic
1019017109 6:168888026-168888048 CCCCACCCCCAGATGGGCCAGGG - Intergenic
1019588536 7:1817392-1817414 CATCACCAACAGATGGAACGCGG + Intronic
1021100607 7:16583983-16584005 CACCACAAGCAGCTGCCCCACGG - Intergenic
1023871013 7:44263099-44263121 CGCCAGCAACTGGTGGCCCAGGG + Intronic
1025724353 7:64043778-64043800 CATCACCACCCGATGGCACAGGG - Intronic
1029221314 7:98992820-98992842 CACCAACCACACACGGCCCACGG - Intronic
1030293168 7:107891754-107891776 CAGCTCCAACAGATAGCCCTCGG + Intronic
1032517088 7:132514657-132514679 CTCCACCAGCAGATGGCCTTTGG + Intronic
1032613734 7:133443638-133443660 CACCACCCACTGATGCCCCCAGG - Intronic
1033971856 7:147050869-147050891 CACCACCAGGAGATGGGCGAGGG - Intronic
1034193709 7:149229938-149229960 GACCACCAGCAGCTGGTCCACGG - Intergenic
1034453140 7:151148602-151148624 CAGCACCAACAAATGGAGCAGGG - Exonic
1035077384 7:156189853-156189875 CAGTTCCAACAGATGCCCCAGGG + Intergenic
1036821381 8:11942622-11942644 TAGGACCAACAGATGTCCCAAGG + Intergenic
1037662253 8:20937985-20938007 TTCCTCCTACAGATGGCCCATGG + Intergenic
1039306148 8:36265437-36265459 CACCAGCAACAGTTTGCCCCTGG + Intergenic
1039457224 8:37715609-37715631 CGCCACCTACCGAGGGCCCAGGG + Intergenic
1043965376 8:86469030-86469052 CACCACCAGTAAATGGCCCAGGG + Intronic
1044053786 8:87542777-87542799 CACCAACAACATATGATCCATGG + Intronic
1045886479 8:107104272-107104294 CATCATCAACTCATGGCCCAGGG - Intergenic
1049426832 8:142541507-142541529 CCCCACCCACACAAGGCCCAGGG + Intronic
1050605694 9:7298865-7298887 CTCCACCACTAAATGGCCCAAGG - Intergenic
1052823065 9:33154746-33154768 CATGTCCAACCGATGGCCCATGG + Intronic
1055541368 9:77309141-77309163 CACCACCACCAGCTCACCCAAGG + Intronic
1056684700 9:88749912-88749934 AACCACCAACAAATGGCCCAGGG + Intergenic
1059380461 9:113919598-113919620 CACCAGCAGCAGCCGGCCCAGGG - Intronic
1059493660 9:114691422-114691444 CTCCCCCAATAGATGGCCCAAGG + Intergenic
1061409277 9:130409913-130409935 CGCCACCATCAGATGGGCCTGGG - Intronic
1194681476 X:96859471-96859493 CATCACCAAAATATTGCCCATGG - Intronic
1195617851 X:106927305-106927327 CCCCCCTAACAGATGGCCCAGGG + Intronic
1196197502 X:112851532-112851554 CCCCACCCACCGATAGCCCAGGG - Intergenic
1201283651 Y:12361326-12361348 CACCACCTGAAGATGTCCCAGGG - Intergenic