ID: 1141500771

View in Genome Browser
Species Human (GRCh38)
Location 16:84442835-84442857
Sequence GAATCCTATGAGCTTCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 135}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141500769_1141500771 -8 Left 1141500769 16:84442820-84442842 CCAGCGATTCCAAAAGAATCCTA 0: 1
1: 0
2: 0
3: 8
4: 146
Right 1141500771 16:84442835-84442857 GAATCCTATGAGCTTCCCTGTGG 0: 1
1: 0
2: 1
3: 14
4: 135
1141500767_1141500771 -2 Left 1141500767 16:84442814-84442836 CCTCCACCAGCGATTCCAAAAGA 0: 1
1: 0
2: 2
3: 9
4: 138
Right 1141500771 16:84442835-84442857 GAATCCTATGAGCTTCCCTGTGG 0: 1
1: 0
2: 1
3: 14
4: 135
1141500766_1141500771 -1 Left 1141500766 16:84442813-84442835 CCCTCCACCAGCGATTCCAAAAG 0: 1
1: 0
2: 2
3: 16
4: 142
Right 1141500771 16:84442835-84442857 GAATCCTATGAGCTTCCCTGTGG 0: 1
1: 0
2: 1
3: 14
4: 135
1141500768_1141500771 -5 Left 1141500768 16:84442817-84442839 CCACCAGCGATTCCAAAAGAATC 0: 1
1: 0
2: 0
3: 3
4: 89
Right 1141500771 16:84442835-84442857 GAATCCTATGAGCTTCCCTGTGG 0: 1
1: 0
2: 1
3: 14
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141500771 Original CRISPR GAATCCTATGAGCTTCCCTG TGG Intronic
900854428 1:5169583-5169605 AATTCATATGAGCTTCCCTTTGG - Intergenic
903400004 1:23036219-23036241 GAATCCTATCATCTTCCCTGTGG - Intronic
909589870 1:77335681-77335703 GAATCCCATGAGCATCCTTATGG + Intronic
910630463 1:89348080-89348102 TAATCCTAAGAGATTCCCTAAGG - Intergenic
914313803 1:146489695-146489717 GACACATATAAGCTTCCCTGAGG - Intergenic
917741382 1:177964794-177964816 GAGTCCTGTGAGGTTCCTTGAGG - Intronic
919774842 1:201187711-201187733 GAAGACTATGAGCTGCCCTGTGG - Intergenic
923377313 1:233377547-233377569 GAACCCTGTGCTCTTCCCTGTGG - Intronic
1062803969 10:401249-401271 GAATCCTATGATTTTACATGTGG + Intronic
1062934484 10:1375543-1375565 GAATACCATGTGCTTCCCTGTGG - Intronic
1068455959 10:57254272-57254294 ACATCCTATGAGTTGCCCTGTGG + Intergenic
1074321797 10:112410276-112410298 AAATCTTATGCTCTTCCCTGGGG + Intronic
1074408211 10:113199505-113199527 GAATCTCAAGAGCTTGCCTGTGG + Intergenic
1075576661 10:123582697-123582719 GAATTCCATGAGCTGCCCAGTGG - Intergenic
1076619799 10:131779900-131779922 GAATCCACTGAGGTTCTCTGTGG + Intergenic
1077276006 11:1708855-1708877 GAATACACTGAGCTTCCCCGGGG - Intergenic
1077499065 11:2901051-2901073 GATTTCTATGACCTGCCCTGGGG + Intronic
1078804162 11:14680015-14680037 TACTACTATGAGCTTCCCTTTGG - Intronic
1081636099 11:44723289-44723311 GAAGCCTAAGAGCTTCCTAGGGG + Intergenic
1083157533 11:60833859-60833881 GAATGCTATGAGCTTCCACCTGG - Intergenic
1083653645 11:64218892-64218914 GGCTCATGTGAGCTTCCCTGTGG + Intronic
1087524076 11:99285409-99285431 GAATCCTGTGAGATTTCATGAGG + Intronic
1090146133 11:124325085-124325107 TTATCCTATCAGCTTCACTGAGG - Intergenic
1090858715 11:130634236-130634258 GAATCCTCTGGGCATCCCTGTGG + Intergenic
1091561313 12:1616148-1616170 GAATGCTAGGTGCTTCCCAGAGG + Intronic
1092147981 12:6227953-6227975 GAATCCTGTGAGGTTCCCAGAGG - Intronic
1094074503 12:26458097-26458119 TAATCATTTTAGCTTCCCTGTGG + Intronic
1094340106 12:29401596-29401618 GATTTCTATGACCTACCCTGGGG - Intergenic
1099401003 12:82203964-82203986 TAATACTAAGAGCTGCCCTGTGG + Intergenic
1103361306 12:120355976-120355998 GGAGCCTATGAGCTTCCTGGGGG + Intronic
1103746749 12:123130165-123130187 GATTCATATGTGGTTCCCTGGGG - Intronic
1103938991 12:124491823-124491845 GGATCCTATGACTCTCCCTGAGG - Intronic
1104150193 12:126074806-126074828 AAATCATATGACCTTCCCTCTGG - Intergenic
1105926204 13:25011207-25011229 GAATCCTCTGGGCTGCTCTGAGG - Intergenic
1106759075 13:32850034-32850056 GGAGCTTATCAGCTTCCCTGTGG - Intergenic
1110276670 13:73648799-73648821 GAATCCCATCAGTTTCCCTCAGG - Intergenic
1113220465 13:108095799-108095821 CAATCCTATTAGATTCCCTCTGG + Intergenic
1114582603 14:23776094-23776116 GAAGCATATGAGCTTAACTGCGG - Intergenic
1115069300 14:29301816-29301838 GTATCCTCTGAGCTTTTCTGTGG + Intergenic
1115258167 14:31424801-31424823 GAATACTATCTCCTTCCCTGAGG + Intronic
1115750308 14:36482815-36482837 GAATCATCTGACCTTGCCTGGGG - Intronic
1116334320 14:43638436-43638458 GAAACCTATGTCCTTGCCTGAGG - Intergenic
1117901256 14:60535740-60535762 GATTCCTAGGAGCTTCGGTGGGG - Intergenic
1118558090 14:67048776-67048798 GAATGCTATGATCTTCTCAGTGG + Intronic
1120308058 14:82795653-82795675 GAATTGTATGAGTTTCCATGTGG + Intergenic
1124597192 15:31101271-31101293 AAACCCTCTGAGCTTCCCTCAGG - Intronic
1128637938 15:69315091-69315113 GAATCCCTTGGGCTTCCCAGGGG + Intronic
1129746221 15:78023395-78023417 GAATGTTATGATCCTCCCTGTGG + Intronic
1130053296 15:80502081-80502103 CAGAGCTATGAGCTTCCCTGTGG - Intronic
1135233278 16:20729716-20729738 GAATCCTAATAGCTCCCCTTTGG - Intronic
1137930229 16:52580146-52580168 GATTCCAATGAGCTTCCAGGTGG - Intergenic
1139017216 16:62704892-62704914 GAATCAAATGAGCTTCCATTGGG + Intergenic
1141500771 16:84442835-84442857 GAATCCTATGAGCTTCCCTGTGG + Intronic
1141650245 16:85388907-85388929 GACACCTATGATTTTCCCTGGGG - Intergenic
1146469633 17:33113547-33113569 GAAGCCAAAGAGCCTCCCTGTGG - Intronic
1149334013 17:55616870-55616892 GAATCCCCTGGTCTTCCCTGAGG - Intergenic
1149553429 17:57556590-57556612 CAATCCTATGAGCTTGCCTCAGG - Intronic
1151259330 17:72904453-72904475 AAATCCTATCAGCTTCACTCTGG + Intronic
1156720429 18:40062801-40062823 GAATAGTGTTAGCTTCCCTGAGG + Intergenic
1157159516 18:45300704-45300726 TAATCCTCTGAGCATCTCTGAGG + Intronic
1158007255 18:52686726-52686748 GAATGCCATGAGCTTACATGGGG + Intronic
1158203203 18:54962441-54962463 GATTCTCCTGAGCTTCCCTGTGG - Intergenic
1160143108 18:76343402-76343424 GACTTCTGTGGGCTTCCCTGAGG + Intergenic
1163939397 19:20478346-20478368 GATTCCTAGGGGCTTCCATGTGG + Intergenic
1165128955 19:33620735-33620757 GGATGCTCTGAGCTTACCTGGGG + Intergenic
925145470 2:1580658-1580680 GGATCCTATGAGATTCCTGGAGG + Intergenic
926957122 2:18313747-18313769 GAAGACTATGAGCTTCTCTGGGG - Intronic
927997566 2:27496700-27496722 GAAGCCCAGGAGTTTCCCTGGGG + Intergenic
928500609 2:31890623-31890645 GAACCCTGAGAGCTTCTCTGGGG + Intronic
928562051 2:32499582-32499604 GAATTCTAAGAGCTTCACTTGGG - Exonic
929824431 2:45299318-45299340 GGATCCTCTGACCTTCCTTGAGG + Intergenic
930067669 2:47340167-47340189 GAATCCTATGAGCTCCCGTAAGG - Intergenic
931340334 2:61395371-61395393 GAATCCTATTAGCTTCAGTTAGG - Intronic
935808482 2:106772275-106772297 TAACACTATGAGCTTTCCTGGGG - Intergenic
939551084 2:143616750-143616772 GACTCCTAAGAGCTTCCTGGGGG + Intronic
944076694 2:195740338-195740360 AAATGCTATGAGCTTCGTTGAGG - Intronic
944569152 2:201025532-201025554 GAATCAAAAGAGCTTCTCTGAGG + Intronic
945285482 2:208077782-208077804 GGGTTCTCTGAGCTTCCCTGGGG - Intergenic
1170624592 20:18021574-18021596 GAATCCTCAGAGCACCCCTGGGG - Intronic
1170870370 20:20200395-20200417 GAAGCATATGAGCTGCCCTGGGG + Intronic
1173704505 20:45100114-45100136 TAATCCTGTGTACTTCCCTGTGG + Intronic
1175252117 20:57616125-57616147 GAAACCTGTGAGCTCCCATGTGG + Intronic
1176120790 20:63453681-63453703 TAATCCTGTGGGCTTCCCGGAGG + Intronic
1179423466 21:41254251-41254273 GAAACCTTAGAGCTCCCCTGTGG - Intronic
1179927501 21:44544674-44544696 GAATGCTATGTGCTGCCCGGGGG + Intronic
1181445399 22:22968780-22968802 TAGTCTGATGAGCTTCCCTGTGG - Intergenic
1182639016 22:31752053-31752075 GAATCCTATTAGCTTCCCCAGGG + Intergenic
1183596916 22:38818357-38818379 GTCTCCTCTGCGCTTCCCTGTGG + Intergenic
1184098253 22:42328313-42328335 GCATCCTGTGGGCTCCCCTGAGG + Intronic
1185040546 22:48501642-48501664 GCATCCCATCAGATTCCCTGGGG - Intronic
950194350 3:10998732-10998754 GAGTTCTAGGAGCTTCCCTCTGG + Intronic
950510970 3:13426544-13426566 GAATCCTTTGAGCTTGCTTTGGG - Intergenic
950712934 3:14826433-14826455 AAAGCCTATGAGCTTAGCTGTGG - Intronic
950790469 3:15467588-15467610 GACTCCTAAGAGCAACCCTGAGG - Intronic
952212493 3:31242292-31242314 TAATCCTTTCAGCTGCCCTGTGG + Intergenic
954864899 3:53719924-53719946 GAATCCTATGAGCCTGGCTTAGG + Intronic
956000512 3:64724996-64725018 GAATTCCATCAGCTCCCCTGGGG + Intergenic
962284877 3:134077208-134077230 GCAGCCTGTGAGCTGCCCTGTGG - Intronic
967233196 3:187360400-187360422 GAATCCTGTGAACTGTCCTGGGG + Intergenic
967467661 3:189826107-189826129 GAATCTTTTGAGCTTCCATGGGG + Intronic
968588446 4:1445834-1445856 GGATCCCATGAGCTTAGCTGTGG + Intergenic
968925704 4:3546685-3546707 GAATCCTCAGAATTTCCCTGTGG + Intergenic
969599518 4:8167635-8167657 GAGTACTATGAGCTTCTCTGAGG + Intergenic
969966228 4:10999413-10999435 GAGTCCTGTGAGCTTGGCTGTGG - Intergenic
970419805 4:15895163-15895185 GGATTATAAGAGCTTCCCTGTGG - Intergenic
970943559 4:21663681-21663703 GAACCCAATAAGCTTCCCTCAGG + Intronic
977017930 4:91717370-91717392 GGTTCCTTTGAGATTCCCTGAGG + Intergenic
977876880 4:102160631-102160653 GAATCAGATGAGCTTCTTTGAGG - Intergenic
984492860 4:180457607-180457629 GAATCCTGTTAGCTTTGCTGAGG + Intergenic
987054051 5:14174296-14174318 GAATCCTCTGAGCTAACCCGAGG + Intronic
987467409 5:18288745-18288767 GAAACCTAGGAGCTTCCAAGGGG - Intergenic
988616535 5:32780594-32780616 GAGTCTGATGAGATTCCCTGTGG + Intronic
990702970 5:58495549-58495571 GAATCCTATGTGTATCGCTGTGG + Exonic
995395472 5:111682184-111682206 GAATTTTGAGAGCTTCCCTGAGG - Intronic
995863560 5:116666063-116666085 GAATACTATGAGTTTCTATGAGG - Intergenic
996753409 5:126911967-126911989 AACTTCTCTGAGCTTCCCTGTGG - Intronic
997389116 5:133498929-133498951 GATTCCCAAGAGCCTCCCTGAGG - Intronic
998810545 5:145962096-145962118 GACTCCAATTAGCTTACCTGGGG + Intronic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1006371046 6:33643683-33643705 GCAGGCTCTGAGCTTCCCTGAGG - Intronic
1010834130 6:80565977-80565999 GAATCCTTAGATCTTTCCTGAGG - Intergenic
1014283417 6:119466725-119466747 GAACACTATTAGCTTCCCTGTGG - Intergenic
1015936453 6:138409707-138409729 GAACAATCTGAGCTTCCCTGGGG - Intronic
1017336219 6:153263613-153263635 GAAACCTGTGAGCTTCTCAGTGG + Intergenic
1024210951 7:47203556-47203578 GAATGCTATGGGCTTGCCAGGGG - Intergenic
1024255319 7:47536456-47536478 GAATCCTTACAGGTTCCCTGGGG - Intronic
1026141964 7:67714128-67714150 GGACCCTGTGAGGTTCCCTGGGG + Intergenic
1028583712 7:92432767-92432789 GAATCCTATTGGTCTCCCTGTGG - Intergenic
1030199770 7:106890896-106890918 GAATGCTCTGTGCTGCCCTGTGG + Intronic
1034159928 7:148985944-148985966 GTTTCCCAAGAGCTTCCCTGTGG - Intergenic
1037487734 8:19364355-19364377 GAATTGTATGAGCTGCCATGGGG + Intronic
1038885372 8:31657347-31657369 GAAACCTCTGACCTTACCTGCGG + Intronic
1045127435 8:99107590-99107612 GAATCCTATCATCTCCCATGTGG + Intronic
1049337913 8:142096294-142096316 GGAGCCTCTGAACTTCCCTGGGG + Intergenic
1053800585 9:41761864-41761886 GAATCCTCAGAATTTCCCTGTGG + Intergenic
1054189016 9:61974016-61974038 GAATCCTCAGAATTTCCCTGTGG + Intergenic
1054464292 9:65483929-65483951 GAATCCTCAGAATTTCCCTGTGG - Intergenic
1054649501 9:67614601-67614623 GAATCCTCAGAATTTCCCTGTGG - Intergenic
1055307349 9:74943357-74943379 GAATCCTAAGATCGTCCCTAAGG - Intergenic
1056264272 9:84880416-84880438 GAATCTTATGAGCATCGCAGAGG + Intronic
1058685364 9:107475486-107475508 GATTCCTCTAAGCTTCCCTTGGG + Intergenic
1062475068 9:136722663-136722685 GAAGCCTCAGAGCTTCCCTGAGG - Intronic
1186643381 X:11481262-11481284 GATTCCCATGAGCTTCTCTTAGG + Intronic
1188872475 X:35389952-35389974 CCATCCTATGAGTTTCTCTGTGG + Intergenic
1190656569 X:52617952-52617974 AAATCCTATAAGCGTCTCTGGGG + Intergenic
1192209063 X:69115940-69115962 GAAGGCTATGAGTATCCCTGAGG + Intergenic
1195131597 X:101859194-101859216 GAGTCATGTGACCTTCCCTGTGG - Intergenic
1195958240 X:110357748-110357770 AAATACTATGCTCTTCCCTGTGG + Intronic
1196729045 X:118922651-118922673 GAAGCCTAGGAGCTTCCTTGGGG - Intergenic
1199850997 X:151724864-151724886 TCTTCCTCTGAGCTTCCCTGTGG - Intergenic
1200294025 X:154899783-154899805 GAATCCTTTGAGCTTGCAAGAGG + Intronic