ID: 1141501473

View in Genome Browser
Species Human (GRCh38)
Location 16:84447416-84447438
Sequence TGGTGGGGAGGGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7643
Summary {0: 1, 1: 5, 2: 56, 3: 735, 4: 6846}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141501473_1141501487 9 Left 1141501473 16:84447416-84447438 CCTTCTTCCCTCCCTCCCCACCA 0: 1
1: 5
2: 56
3: 735
4: 6846
Right 1141501487 16:84447448-84447470 AGGTAATTCTATTTTAAGTCTGG No data
1141501473_1141501489 14 Left 1141501473 16:84447416-84447438 CCTTCTTCCCTCCCTCCCCACCA 0: 1
1: 5
2: 56
3: 735
4: 6846
Right 1141501489 16:84447453-84447475 ATTCTATTTTAAGTCTGGGATGG No data
1141501473_1141501488 10 Left 1141501473 16:84447416-84447438 CCTTCTTCCCTCCCTCCCCACCA 0: 1
1: 5
2: 56
3: 735
4: 6846
Right 1141501488 16:84447449-84447471 GGTAATTCTATTTTAAGTCTGGG 0: 1
1: 0
2: 3
3: 33
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141501473 Original CRISPR TGGTGGGGAGGGAGGGAAGA AGG (reversed) Intronic
Too many off-targets to display for this crispr