ID: 1141502826

View in Genome Browser
Species Human (GRCh38)
Location 16:84455479-84455501
Sequence CGGAGGTGCTCTCTAGGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 63}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141502817_1141502826 7 Left 1141502817 16:84455449-84455471 CCTGGGCAGAAACACCCCCATCG 0: 1
1: 0
2: 1
3: 4
4: 105
Right 1141502826 16:84455479-84455501 CGGAGGTGCTCTCTAGGTTCTGG 0: 1
1: 0
2: 0
3: 3
4: 63
1141502820_1141502826 -7 Left 1141502820 16:84455463-84455485 CCCCCATCGCTGACCACGGAGGT 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1141502826 16:84455479-84455501 CGGAGGTGCTCTCTAGGTTCTGG 0: 1
1: 0
2: 0
3: 3
4: 63
1141502821_1141502826 -8 Left 1141502821 16:84455464-84455486 CCCCATCGCTGACCACGGAGGTG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1141502826 16:84455479-84455501 CGGAGGTGCTCTCTAGGTTCTGG 0: 1
1: 0
2: 0
3: 3
4: 63
1141502822_1141502826 -9 Left 1141502822 16:84455465-84455487 CCCATCGCTGACCACGGAGGTGC 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1141502826 16:84455479-84455501 CGGAGGTGCTCTCTAGGTTCTGG 0: 1
1: 0
2: 0
3: 3
4: 63
1141502823_1141502826 -10 Left 1141502823 16:84455466-84455488 CCATCGCTGACCACGGAGGTGCT 0: 1
1: 0
2: 1
3: 5
4: 73
Right 1141502826 16:84455479-84455501 CGGAGGTGCTCTCTAGGTTCTGG 0: 1
1: 0
2: 0
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141502826 Original CRISPR CGGAGGTGCTCTCTAGGTTC TGG Intronic
903069335 1:20718841-20718863 CGGAGGTGCTCTTTTGGCTGGGG - Intergenic
904039395 1:27575484-27575506 CGGAGGCGCCCCCTAGGGTCGGG + Intronic
912446776 1:109742341-109742363 CGGAGCTGCTCTGAGGGTTCTGG + Intronic
912955791 1:114153505-114153527 GGGGAGTTCTCTCTAGGTTCTGG + Intronic
915727842 1:158031448-158031470 CTCAGGTGCCCTCTAGGCTCAGG + Intronic
919213506 1:194519799-194519821 GGGAGGTGCTCCCAAGGTTAGGG + Intergenic
919827019 1:201510280-201510302 CTGTGCTGGTCTCTAGGTTCTGG + Intergenic
921741913 1:218695009-218695031 CTGAGGTGCTTTCTGGCTTCTGG + Intergenic
1065997173 10:31069857-31069879 CGGACCTGCTCACTAGGTTCTGG + Intergenic
1077730022 11:4720708-4720730 GGGAGCTGCTCTTTTGGTTCTGG + Intronic
1078898844 11:15622737-15622759 TGGAGCTGCTCTCTGGGATCTGG - Intergenic
1082955165 11:58863262-58863284 TGCAGGTGCTAGCTAGGTTCTGG + Intronic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1088397959 11:109389430-109389452 CGCAGGTGCTATCCAGTTTCTGG + Intergenic
1090717848 11:129446026-129446048 CAGAGATGCTATCTCGGTTCTGG - Intronic
1093192901 12:16095439-16095461 TTGGGGTGCTCTCCAGGTTCAGG - Intergenic
1109375363 13:61485743-61485765 AGGAGGTGCTCTGCAGGTTTGGG + Intergenic
1109428506 13:62199922-62199944 CTGGGGTGATCTCTAGGGTCTGG + Intergenic
1114554714 14:23555444-23555466 CCCAGGTGCTCTCCAGTTTCTGG + Intronic
1122154356 14:99741593-99741615 CTGGGGTGCTGTCTGGGTTCTGG - Intronic
1129046236 15:72736785-72736807 GGGAGCTGCTCTCCAGGTTGGGG + Exonic
1131389073 15:92032611-92032633 TGGAGGTGCTCTCTGGGTTTTGG + Intronic
1139587980 16:67916596-67916618 GGGAGGAGCCCTCTGGGTTCTGG + Intronic
1141502826 16:84455479-84455501 CGGAGGTGCTCTCTAGGTTCTGG + Intronic
1143319757 17:6060421-6060443 TGCAGATGCTGTCTAGGTTCTGG + Intronic
1161332024 19:3692975-3692997 CGGAGGTGCCCTCAAGGCTGGGG - Intronic
1162728456 19:12703476-12703498 CGGAGATGAACTCTGGGTTCAGG + Exonic
1162887917 19:13710054-13710076 CTGAGGGGCTCTGTAGGTTTGGG + Intergenic
926155994 2:10454335-10454357 GGCTTGTGCTCTCTAGGTTCTGG + Intergenic
926170922 2:10552205-10552227 CAGTGATGCCCTCTAGGTTCTGG - Intergenic
934562393 2:95320076-95320098 GGGAGGTGCTCTCTGGGAGCAGG + Intronic
948003794 2:234590827-234590849 GGGCGGGGCTCTCTAGATTCGGG - Intergenic
948204563 2:236156426-236156448 CGCAGGTGCCCTCTGGGCTCTGG - Intergenic
1173863972 20:46302583-46302605 TTGAGGCGCTCTCAAGGTTCGGG - Intronic
1174407593 20:50312249-50312271 CAGCGGTGCTGTCTAGGTTGGGG - Intergenic
1183211364 22:36453455-36453477 CACAGGTGCCCTCCAGGTTCTGG - Intergenic
1183514916 22:38259581-38259603 TGGAGGTGGTCTCTAGGAGCTGG + Intronic
1183658365 22:39204135-39204157 CTGAGGTCTTCTCTAGCTTCAGG - Intergenic
1184234045 22:43173717-43173739 TGGGGGTGCTCTCTCGGTGCCGG + Exonic
1184307345 22:43614624-43614646 CAGAGCAGCCCTCTAGGTTCAGG - Intronic
1184319773 22:43732076-43732098 CTTAGGTGCTGTCTAGGTTGGGG - Intronic
1184740423 22:46425319-46425341 GGGAAGTGCTCTCTATTTTCTGG + Intronic
949940255 3:9149249-9149271 CAGATGGGCTCTCTAGCTTCAGG - Intronic
951310219 3:21116631-21116653 CAGAGATGCTGTCTAGGTGCTGG + Intergenic
953676595 3:45007542-45007564 CGAAGATGCTCTCTGGGTCCAGG - Exonic
953859979 3:46536010-46536032 CGGAGGTGGACTCTAGGATCAGG - Intronic
954628770 3:52037087-52037109 GGGAGGTGCTCAGGAGGTTCAGG + Intergenic
954935399 3:54322163-54322185 AGGAGGTGAGGTCTAGGTTCTGG - Intronic
975638101 4:76470747-76470769 AGGATGTGTTCTCTAGGCTCAGG + Intronic
981956103 4:150476440-150476462 CCCAGGCACTCTCTAGGTTCTGG + Intronic
991566713 5:68012391-68012413 TTGAAGTTCTCTCTAGGTTCAGG - Intergenic
1019896456 7:3987245-3987267 CCGTGGTGCTCTCTTGGGTCCGG + Exonic
1026394766 7:69940375-69940397 AGTAGGTGCTCTCTAGGTGAGGG + Intronic
1032090877 7:128910852-128910874 TGGAGCTGCTCTCTGGGGTCAGG - Intergenic
1036666982 8:10752702-10752724 CTGGGCTGATCTCTAGGTTCAGG - Intronic
1037163230 8:15797070-15797092 CGGAGGTGCCCATTAGGGTCTGG - Intergenic
1037728305 8:21502405-21502427 AGGAGGAGCTCTCTAAGTTATGG + Intergenic
1042736632 8:71996640-71996662 CAGAGGTGCTGTCTAAGTTAGGG + Intronic
1046902527 8:119538616-119538638 CTGAGGTGCTCTAGAGGTTGAGG + Intergenic
1048030190 8:130624066-130624088 AGGAGGTTATCTCTAGGTTATGG + Intergenic
1049426023 8:142538234-142538256 GGGAGGTGCTCCCTGGGTCCCGG + Intronic
1050124462 9:2342377-2342399 TGGAGGTGCTCTTTATGGTCTGG + Intergenic
1057303335 9:93898947-93898969 CAGAGGTGCTCTCTTGCTTGGGG + Intergenic
1058816233 9:108684999-108685021 GGGAGGAGCTCTCTGGGGTCAGG - Intergenic
1061200079 9:129132957-129132979 GGGAGGTGTTCTCTAGGTCAGGG + Intronic
1187648111 X:21371880-21371902 CAGAGTTGCTGTTTAGGTTCTGG + Intergenic
1194016315 X:88625516-88625538 CAGAGGTGCTGTCTTGGTCCAGG - Intergenic