ID: 1141503849

View in Genome Browser
Species Human (GRCh38)
Location 16:84462206-84462228
Sequence CAGCCCAGGAGGGGTCAGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 419}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141503844_1141503849 -8 Left 1141503844 16:84462191-84462213 CCAGGTGGGGAGCTGCAGCCCAG 0: 1
1: 0
2: 2
3: 57
4: 480
Right 1141503849 16:84462206-84462228 CAGCCCAGGAGGGGTCAGTGCGG 0: 1
1: 0
2: 4
3: 54
4: 419
1141503836_1141503849 23 Left 1141503836 16:84462160-84462182 CCTCGACCAGGGCCATGGGGGGC 0: 1
1: 1
2: 0
3: 17
4: 190
Right 1141503849 16:84462206-84462228 CAGCCCAGGAGGGGTCAGTGCGG 0: 1
1: 0
2: 4
3: 54
4: 419
1141503839_1141503849 11 Left 1141503839 16:84462172-84462194 CCATGGGGGGCGGCAGCTGCCAG 0: 1
1: 0
2: 0
3: 29
4: 325
Right 1141503849 16:84462206-84462228 CAGCCCAGGAGGGGTCAGTGCGG 0: 1
1: 0
2: 4
3: 54
4: 419
1141503838_1141503849 17 Left 1141503838 16:84462166-84462188 CCAGGGCCATGGGGGGCGGCAGC 0: 1
1: 0
2: 2
3: 29
4: 359
Right 1141503849 16:84462206-84462228 CAGCCCAGGAGGGGTCAGTGCGG 0: 1
1: 0
2: 4
3: 54
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141503849 Original CRISPR CAGCCCAGGAGGGGTCAGTG CGG Intronic
900095432 1:938239-938261 CAGCCCAGCAGGTGGCAGAGGGG - Intronic
900095449 1:938296-938318 CAGCCCAGCAGGTGGCAGAGGGG - Intronic
900288740 1:1914839-1914861 CAGACAGGGAGGGCTCAGTGCGG + Exonic
900289350 1:1917307-1917329 CAACCCAGGCTGGGACAGTGAGG - Intergenic
900388160 1:2420000-2420022 CAGCACAGGAGGGGGTAGTGGGG - Intergenic
900394967 1:2449636-2449658 CTGCCCAGGTGGTGTCACTGGGG + Intronic
900556841 1:3284916-3284938 CAGCCCAGGAAGGGCCAGCGTGG - Intronic
900808102 1:4781158-4781180 CATCCCAGGAGTGGACAGCGAGG - Intronic
901195836 1:7439293-7439315 CAGCCAACGATGGCTCAGTGTGG - Intronic
902577775 1:17389228-17389250 GAGCCCAGGAAGGGGCGGTGTGG + Intronic
902702632 1:18183028-18183050 AGGCCCAGGAGGGGGCAGGGTGG - Intronic
902878217 1:19353554-19353576 CAGCCCTGGGAGGGTCAGAGGGG - Intronic
903049575 1:20590595-20590617 CACGGCAGGAGGGGTCAGTGTGG - Intronic
903300358 1:22374485-22374507 AACCCCAGGAGGGGGCAGGGTGG - Intergenic
903745811 1:25585888-25585910 CAGCCCAGTGAGGGGCAGTGTGG - Intergenic
903986623 1:27234043-27234065 AGGCCCAGGAGACGTCAGTGAGG + Intergenic
904033340 1:27546720-27546742 CAGGCCAAGAGTGGCCAGTGTGG - Intronic
904360161 1:29965947-29965969 CTGCCAAGGAGGGCTCAGAGAGG + Intergenic
904492679 1:30870511-30870533 CAGTCCAAGAGAGTTCAGTGAGG - Intronic
904565668 1:31426829-31426851 CAGGCCAGGGGGGGTCAGGCAGG - Intronic
905109503 1:35585019-35585041 CAGACCAGGAAGGTTCAGTGCGG + Intronic
905283557 1:36864662-36864684 CAGCCCGGGAGGGGGCAGGTTGG + Intronic
907311343 1:53540736-53540758 CTGCCCAGGATGGGGCAGTGGGG + Intronic
909810052 1:79922531-79922553 AATCCCAGGAGAGGGCAGTGAGG - Intergenic
910803034 1:91164363-91164385 CAGCTCAGAGGGGATCAGTGTGG + Intergenic
912520354 1:110240681-110240703 CACCCCAGGGAGGGTCACTGTGG - Intronic
912974349 1:114314495-114314517 CAGCCAAGGAGAGGTGACTGTGG - Intergenic
913127805 1:115809423-115809445 CAGACCAGGAGGTGACAGGGTGG - Intergenic
913532421 1:119742486-119742508 CAGAGCAGGAGGGGCCAGAGTGG + Intronic
914323205 1:146585043-146585065 CAGCCCAGGGGTGGTCAGAAAGG + Intergenic
914457135 1:147846536-147846558 CAGCCCAAGAGAGGACATTGCGG + Intergenic
915015416 1:152728452-152728474 CAGCCAAAGAGAGGACAGTGAGG + Intergenic
915509318 1:156377946-156377968 GAGCACAAGAGGGGTCAGAGAGG - Intronic
919762016 1:201103943-201103965 CAGCCCAGGAGGGGCCAAATGGG + Intronic
920079345 1:203361002-203361024 CAGCCGAGGAGGAGGCAGTGAGG + Intergenic
921092992 1:211860501-211860523 CAGGCCAGGAGGGAAAAGTGAGG + Intergenic
922154781 1:223032255-223032277 CAGCCCAGGAGGATTAAGTAGGG - Intergenic
922476040 1:225907531-225907553 CAGCAGGGAAGGGGTCAGTGCGG + Intronic
922503315 1:226112013-226112035 ACGCCCACGAGGGTTCAGTGAGG + Intergenic
924135930 1:240967062-240967084 CAGACCATGATGTGTCAGTGTGG + Intronic
1064097506 10:12434906-12434928 CAGCCCAGGAGGAATCAGGAGGG + Intronic
1064278691 10:13931319-13931341 CAGTCCAGAAGGGGTAGGTGGGG - Intronic
1064506294 10:16033913-16033935 CAGCCAAGGTGGCATCAGTGAGG + Intergenic
1066657759 10:37711535-37711557 CAGCCCAGGACAAGCCAGTGGGG + Intergenic
1067042238 10:42961145-42961167 CAGCCCAGGACCAGCCAGTGGGG + Intergenic
1067693674 10:48520382-48520404 CAGCCCAGGAGGGGCCTAAGGGG + Intronic
1067716899 10:48697019-48697041 GAGCTCAGGAGGGGTCAGGCTGG + Intronic
1068331223 10:55572559-55572581 CAGTCCATGAGGAGTAAGTGAGG + Intronic
1069747079 10:70722324-70722346 AAGGACAGGAGGGGTCACTGTGG + Intronic
1069772218 10:70907230-70907252 CAGCCCTGGTGGGGTAACTGAGG - Intergenic
1070702255 10:78612764-78612786 CAGACCAGGAAGGGTAAGAGAGG + Intergenic
1070931707 10:80265801-80265823 CAGCCCAGGAAGTGGGAGTGGGG + Intergenic
1071198304 10:83187508-83187530 AAGGTCAGGAGGGGTCAGTGTGG - Intergenic
1071294184 10:84207283-84207305 AAACCCAGGAGGGATCAGAGAGG + Intronic
1072221976 10:93334376-93334398 AAGCCCAGGAGCAGTCAGGGAGG - Intronic
1072961386 10:99932574-99932596 CAGCCCAAAAGGAGTCCGTGAGG + Intronic
1072964942 10:99963787-99963809 CAGCCCAAAAGGAGTCCGTGAGG - Intronic
1073051343 10:100669414-100669436 AAGCAGTGGAGGGGTCAGTGAGG - Intergenic
1073403210 10:103275849-103275871 AAGGCTGGGAGGGGTCAGTGTGG - Intergenic
1073494586 10:103879720-103879742 CAGCCCAAGAGGGGCCAGGGCGG + Intergenic
1075093525 10:119456539-119456561 CAGCCGGGCAGGGGACAGTGAGG - Intronic
1075397916 10:122141212-122141234 GGGCCCAGGAGGTGTCTGTGGGG + Intronic
1076157695 10:128216162-128216184 CAGCCCAGAAGGGAGAAGTGAGG + Intergenic
1076302899 10:129441521-129441543 CAGCCCAGCAGGGCTCAGGCAGG + Intergenic
1076343846 10:129767270-129767292 CAGCCCAGGATGGGGCAGTCTGG + Exonic
1076594816 10:131618972-131618994 CAGCCTGGGAGGGGCCCGTGGGG + Intergenic
1076916506 10:133425064-133425086 CAGCCCAGGAGGAGCCATGGGGG - Intergenic
1077178612 11:1202566-1202588 CATCCCAGGAGTGGGCAGAGGGG + Intergenic
1077235459 11:1480049-1480071 CAGCTCTGGATGGGACAGTGAGG - Intronic
1077475449 11:2788181-2788203 GAGCCCAGGAGGGGTCTGCAGGG - Intronic
1077549863 11:3195396-3195418 CTTCCCGGCAGGGGTCAGTGTGG - Intergenic
1077718161 11:4601613-4601635 CAGCCCTGTAGGGGATAGTGAGG - Intronic
1078160985 11:8839620-8839642 GAGGACAGGAGGGGTCACTGGGG - Intronic
1080343548 11:31296114-31296136 CAGCCCATCAGGGGTCTGTCAGG + Intronic
1082080334 11:48007822-48007844 CAGAGCAGGAAGGGTCATTGAGG + Intronic
1082774913 11:57237393-57237415 CAGCACAGTAGGGGTCAATTTGG - Intergenic
1083639184 11:64136170-64136192 CAGCCCAGGATGGGTGTGTCTGG - Intronic
1083833473 11:65248617-65248639 CAGCCGAGGTGGGGTATGTGTGG + Intergenic
1083882432 11:65555179-65555201 AAGCCAAGGAGGGGTCTGGGTGG - Intronic
1084009116 11:66338009-66338031 CCACTCAGGAGGGGTCAGGGAGG - Intronic
1084310754 11:68314770-68314792 GAGCCCAGAAGGGCTGAGTGGGG + Intronic
1084448860 11:69220796-69220818 CAGCCCACGAGGGCTCTGGGTGG - Intergenic
1084968808 11:72758333-72758355 CAGATCAGGAGAGGGCAGTGTGG - Intronic
1085298151 11:75442563-75442585 CTGTCCAGAAGGGGTCAGTCTGG + Exonic
1085314742 11:75537808-75537830 GAGACCAGGAGGTGTCAGCGAGG + Intergenic
1085338580 11:75716765-75716787 GAGCAGAGGAGGAGTCAGTGGGG + Intergenic
1088581897 11:111324751-111324773 CATCCCAGGAGGGCTGGGTGAGG + Intergenic
1089195773 11:116693302-116693324 CAGCCCTGGAGGAGCCACTGTGG + Intergenic
1089340539 11:117754460-117754482 CAGCTCGGGAGGGTGCAGTGGGG + Intronic
1089614538 11:119687801-119687823 CATCCCAGGAGGGGCCTGTGGGG + Intronic
1090463701 11:126913844-126913866 TAGCAGAGGAGGGGTCTGTGTGG + Intronic
1092132027 12:6119402-6119424 GAGCCCTGGGGAGGTCAGTGTGG - Intronic
1095999858 12:48119971-48119993 CACCCCTGGAAGCGTCAGTGAGG - Intronic
1096553353 12:52388772-52388794 TGGCCCAGGAGGGGACGGTGGGG + Intergenic
1096606488 12:52769975-52769997 CACCCCAGGAGGGCCCATTGTGG - Intronic
1096775834 12:53963593-53963615 CAGCCGAGCAGCGGTCGGTGGGG - Intergenic
1096979043 12:55717987-55718009 GAGCCCAGGAGGTGCCAATGTGG - Intronic
1098848888 12:75570937-75570959 CTCCCCAGGTGGGGTCAGTGGGG - Intergenic
1101033193 12:100679759-100679781 AAGCCCTGGAGGGGTGAGTAGGG - Intergenic
1101787047 12:107893340-107893362 CAGGCCAGGCGGGGACTGTGAGG + Intergenic
1102016480 12:109651185-109651207 CAGCCCAACAGTGTTCAGTGGGG + Intergenic
1102238372 12:111308768-111308790 CAGCTCAAGAAGGCTCAGTGGGG - Intronic
1102812675 12:115837963-115837985 CTGCCCAGGAGGGCTCAGCAAGG - Intergenic
1104770948 12:131364033-131364055 CAGAGCAGGAGGGGGCAGAGCGG + Intergenic
1104935024 12:132359899-132359921 CACCCCAGGATGGGTCAGGATGG + Intergenic
1104963377 12:132498523-132498545 CAGCCCAGGACAGGTGTGTGGGG - Intronic
1105883758 13:24625037-24625059 CAGCCCAGGAGGGGTGACGGGGG + Intergenic
1106028171 13:25974760-25974782 CAGGACATGAGGGGACAGTGTGG - Intronic
1107014115 13:35695249-35695271 CAGCCCGGGAGGGGCCAGAGAGG - Intergenic
1107821517 13:44289973-44289995 CAGCCAAGGAGGGACCAGAGCGG - Intergenic
1108001476 13:45909304-45909326 CTGCCCTGGAGGTGACAGTGAGG - Intergenic
1108466965 13:50726312-50726334 CAGCTGAGGAGGGGTGGGTGGGG - Intronic
1108866682 13:54932341-54932363 TAGCCCAGGAGGTGTCCTTGAGG + Intergenic
1109991321 13:70061069-70061091 CAGGCTGGGAGGGGTCACTGGGG + Intronic
1113432319 13:110261714-110261736 CTGCCCAGGTGGAGACAGTGAGG + Intronic
1113521771 13:110946643-110946665 AAGCCCCGGAGGTGACAGTGGGG - Intergenic
1113646058 13:111996810-111996832 CAGCCCCGGAGGTGTCGGTGAGG + Intergenic
1113706125 13:112434060-112434082 AAGCCCTGGAGGTGACAGTGGGG + Intronic
1115456930 14:33614479-33614501 CAGCCCTGGAGAGGTGAGGGTGG + Intronic
1116030962 14:39570958-39570980 GAGGCCAGGAAGGGTCAGTGAGG - Intergenic
1118387907 14:65271919-65271941 CGTCCCAGGAGAGGTAAGTGAGG + Intergenic
1118726378 14:68631948-68631970 CATCCCAGGAGCCCTCAGTGAGG + Intronic
1119168766 14:72516650-72516672 GAGCTGAGGAGGGGTCAGTGTGG - Intronic
1119295576 14:73530392-73530414 CAGCCCAAAGGGTGTCAGTGGGG + Intronic
1119299224 14:73558120-73558142 CAGCCCAAAGGGTGTCAGTGGGG + Intronic
1119423998 14:74524279-74524301 GGTCCCAGGAGAGGTCAGTGGGG + Intronic
1120941276 14:89952578-89952600 CAGCTCAGGTGGGTTCAGAGTGG - Intronic
1121407729 14:93729078-93729100 CAGCCTAGAAGGTGGCAGTGAGG + Intronic
1121719704 14:96100722-96100744 AGGACCAGCAGGGGTCAGTGTGG + Intergenic
1121798451 14:96754529-96754551 CAGCCCAGCATGGGTGGGTGAGG - Intergenic
1122181707 14:99959858-99959880 CAGCTCAGGAGGTATCAGAGAGG - Intergenic
1122275575 14:100589182-100589204 CAGCCCAGGAGGAGGCAATGTGG - Intergenic
1122774338 14:104110600-104110622 AGGTCCAGGAGGGGCCAGTGAGG + Intronic
1122798013 14:104216084-104216106 CAGGCCAGGAGGGGTGAGAGGGG + Intergenic
1122862352 14:104588336-104588358 CACCCACGGAGGGGGCAGTGGGG - Intronic
1122985572 14:105210108-105210130 CTGCTCAGGAGGGGACGGTGCGG + Exonic
1123933856 15:25184712-25184734 CAGGCCACGTGGGGTCACTGAGG + Intergenic
1123988474 15:25665636-25665658 GAGCTCAGGAGGTGTCTGTGTGG + Intergenic
1124222306 15:27861396-27861418 CAGCCCAGGAGAGGTTGCTGTGG + Intronic
1124385915 15:29207995-29208017 CAGGCTAGGAGGGGCCAGCGTGG - Intronic
1124441342 15:29688286-29688308 GAGGCCAGGAGCGGTCAATGGGG - Intergenic
1125501388 15:40242021-40242043 CTGCCCAGTTGGGGTCAGAGGGG + Intronic
1125893430 15:43282507-43282529 CAGACCAGCAGTGGTGAGTGAGG - Exonic
1128570999 15:68732753-68732775 CAGACCAGGAGGGATCAGGTAGG - Intergenic
1128716820 15:69914576-69914598 CAGGCCAGGCCGGCTCAGTGAGG + Intergenic
1129069478 15:72938789-72938811 CAGCCCAGGATGGCTGAGTGGGG + Intergenic
1129191559 15:73940815-73940837 GAGGCCAGGTGGGGCCAGTGAGG - Intronic
1129219186 15:74121582-74121604 CAGCACAGGAGGGGAAACTGAGG + Intronic
1129350805 15:74955091-74955113 CAGCCCGGGAGGGCGGAGTGGGG + Exonic
1132903388 16:2270217-2270239 CTGCCCACCAGGTGTCAGTGGGG - Intergenic
1133168349 16:3964721-3964743 CACCCCAAGAGGGGTCTGAGTGG - Exonic
1133549408 16:6839344-6839366 CTGCCCAGATGGAGTCAGTGGGG - Intronic
1134518178 16:14903790-14903812 AAGTCCAGGAGAGGACAGTGTGG + Intronic
1134705848 16:16302444-16302466 AAGTCCAGGAGAGGACAGTGTGG + Intergenic
1134961693 16:18409670-18409692 AAGTCCAGGAGAGGACAGTGTGG - Intergenic
1134965991 16:18492269-18492291 AAGTCCAGGAGAGGACAGTGTGG - Intronic
1135712144 16:24726963-24726985 CAGCCCAGGAGGGCTCAGATGGG + Intergenic
1135870146 16:26142291-26142313 AAGCCCAGGAAAGGTCAGTTTGG + Intergenic
1135942159 16:26831299-26831321 AAGCCCAGGAAGGGTCAGGGAGG + Intergenic
1136267564 16:29130445-29130467 CAGCCCGCGGGGGGTCAGGGGGG + Intergenic
1136284280 16:29232146-29232168 CAGCCCTGGAGTGGACTGTGGGG + Intergenic
1136564790 16:31063496-31063518 GAGACCAGGAGGTGTGAGTGGGG - Intronic
1137032177 16:35533359-35533381 CAGCCCAGCAGGGGGCAGGGTGG - Intergenic
1137587007 16:49669738-49669760 CAGCCCAGCTGGGCTCTGTGTGG - Intronic
1138011669 16:53386576-53386598 CAGCTAAGGAGGGGGCAGGGAGG - Intergenic
1139469403 16:67170329-67170351 GAGGCCAGGAGGGGGCAGTTCGG - Intronic
1139671085 16:68492884-68492906 CAACCCAGGTGGAGCCAGTGGGG + Intergenic
1140009609 16:71118069-71118091 CAGCCCAGAGGGGGTCACAGAGG - Intronic
1140010356 16:71125807-71125829 CAGCCCAGGGGTGGTCAGAAAGG - Intronic
1141172811 16:81701839-81701861 CAGGCCAGGGGGGGCCAGGGCGG + Intronic
1141503849 16:84462206-84462228 CAGCCCAGGAGGGGTCAGTGCGG + Intronic
1141609597 16:85173832-85173854 CTGCCCAGAAGGGGTCAGCATGG + Intronic
1141832502 16:86517552-86517574 ATGCCTAGGAGGGGTCAGTGAGG - Intergenic
1141838980 16:86562168-86562190 CAACCAAGGTGGGGTCAGAGGGG - Intergenic
1142089314 16:88201652-88201674 CAGCCCTGGAGTGGACTGTGGGG + Intergenic
1142136457 16:88453888-88453910 CAGCCCAGGAGGGGGCCGCCCGG + Intronic
1142155545 16:88531370-88531392 CAGCCCATTTGGGGTCAGTGTGG + Intronic
1142170477 16:88619503-88619525 AGGCCCAGCAGGGGTCAGTGAGG - Intronic
1203141779 16_KI270728v1_random:1771675-1771697 CAGCCCCAGAGGGGAGAGTGTGG + Intergenic
1142749865 17:1980847-1980869 GAACCCAGGAGGTGGCAGTGCGG + Intronic
1143125108 17:4636862-4636884 CAGCCCAGGAGGGATTGGGGAGG - Intronic
1143736827 17:8916807-8916829 CAGCCCACGATGGGGCAGGGAGG + Intronic
1143920953 17:10330684-10330706 CTGCCCAGGAGGAGCCACTGAGG - Intronic
1143954309 17:10656876-10656898 CAGCCCAGGTGGGGAAGGTGAGG + Intronic
1144624159 17:16836223-16836245 CATTCCAGGAGGTGTCAGGGTGG + Intergenic
1144635444 17:16904722-16904744 CAGCACAGGTGGCATCAGTGGGG - Intergenic
1144882267 17:18436496-18436518 CATTCCAGGAGGTGTCAGGGTGG - Intergenic
1144892502 17:18502034-18502056 CAGCCCAGGAGGGGCAACTGAGG - Intergenic
1145139712 17:20442254-20442276 CAGCCCAGGAGGGGCAACTGAGG + Intergenic
1145149967 17:20507890-20507912 CATTCCAGGAGGTGTCAGGGTGG + Intergenic
1145270621 17:21402834-21402856 CAGGCCTGGAGGGCTCACTGAGG + Intronic
1145308826 17:21690224-21690246 CAGGCCTGGAGGGCTCACTGAGG + Intergenic
1145810601 17:27761748-27761770 AAGCCCAGGAGGGCCCACTGAGG - Intronic
1146458271 17:33024010-33024032 CAGACCTGGAGGGGAGAGTGAGG + Exonic
1146601885 17:34224427-34224449 CAACCCAGTATGGGTCAGTGGGG - Intergenic
1146951859 17:36912533-36912555 CATGCCAGGAGGAGTCAGAGGGG - Intergenic
1147183937 17:38703899-38703921 CCGCCCAGGAGGGGGGAGTAGGG - Intergenic
1147312576 17:39604185-39604207 CACCCCAGGAGGGGACAGAATGG + Intronic
1147556251 17:41481028-41481050 GAGCCCAGGAGGGGCCAGTGGGG - Exonic
1147575206 17:41594941-41594963 CAGCCCAGCTGGGGGCAGAGGGG + Intergenic
1147578294 17:41614942-41614964 CATTCCAGGAGGTGTCAGGGCGG + Intronic
1147668245 17:42162289-42162311 CAGCCCAGAATTGGCCAGTGAGG - Exonic
1147843039 17:43386128-43386150 GAGCCCAGGAGGCCACAGTGAGG - Intergenic
1148203977 17:45768134-45768156 CTGCCCAGGAGGGGGCAGAGAGG - Intergenic
1148232914 17:45948293-45948315 GAGCCCAGGAGGGCTGGGTGCGG - Intronic
1149552580 17:57551318-57551340 CAGCCCAGGTGAGTCCAGTGAGG - Intronic
1150248050 17:63690726-63690748 CAGCCCAGGAAGGAGCTGTGGGG + Intronic
1150822318 17:68445537-68445559 GAGCCCAGGAAGGAACAGTGGGG - Intronic
1151189731 17:72389312-72389334 CAGGCCAGATGGGGTGAGTGGGG - Intergenic
1151354558 17:73550749-73550771 AAGCCCAGCGGGGGACAGTGAGG + Intronic
1151453391 17:74212691-74212713 CAGGCCAGGAGGGGGCTCTGGGG - Intergenic
1151631430 17:75313780-75313802 GAGCCCAGGTGGGGTTTGTGGGG - Intergenic
1151678200 17:75610617-75610639 CAGCCAGGGAGGGGCCAGAGAGG - Intergenic
1152231069 17:79114445-79114467 CAGCCCAGGAGGTGGCTGGGTGG + Intronic
1152528694 17:80904207-80904229 CAGCCCCTGAGGGGTCAGGAGGG + Intronic
1152557687 17:81062547-81062569 CAGCCCACGAGGGAGCAGGGAGG - Intronic
1152639884 17:81444983-81445005 GGGCCCAGGAGGGGTCAGCCTGG - Intronic
1152710326 17:81868005-81868027 GGGCCCAGGTGGGGTGAGTGAGG + Exonic
1152736944 17:82001679-82001701 CAGGCCAGAAGGGGCCAGTGGGG - Intronic
1154329214 18:13415792-13415814 CAGCCCAGCAGGCATCAGGGTGG + Intronic
1154980313 18:21498263-21498285 CAGAAGAGGAGGGGTCTGTGGGG + Intronic
1155980494 18:32174807-32174829 ATGCCCAGGAGAGGGCAGTGAGG + Intronic
1156624751 18:38895197-38895219 CAGCCCTGGTCGGGTCAGTGTGG + Intergenic
1157598166 18:48876319-48876341 CGCCACAGGAGGGGCCAGTGAGG - Intergenic
1157751247 18:50180240-50180262 CAGCCCAGTGCGGGGCAGTGTGG - Intronic
1158670162 18:59467511-59467533 CAGCTCATGAGGGGTCTGTCTGG - Intronic
1158761069 18:60387629-60387651 CAGCTCAGGAGGGATCACAGAGG + Intergenic
1159926897 18:74277678-74277700 AGGCCCAGGAGGGGTCACTCAGG + Intronic
1160049917 18:75423462-75423484 CACCCCAGGAAGGGTCACTGGGG - Intronic
1160489192 18:79322494-79322516 CACCCCAGGCAGGGGCAGTGGGG + Intronic
1160498373 18:79388292-79388314 CAGGCCAGGGGAGGCCAGTGGGG + Intergenic
1160516087 18:79479992-79480014 CAGCCCAGGGAGGGGCACTGTGG + Intronic
1160541667 18:79627339-79627361 CAGGCGAGGAGGGGGCAGAGTGG + Intergenic
1160582983 18:79898329-79898351 CAGGCCAGGAGAGGCCAATGGGG - Intronic
1161375293 19:3936784-3936806 GACCCCAGGAGGGGTCAGGCAGG - Intronic
1161399243 19:4060144-4060166 CAGCCCAGGAGGGGCCTGCCAGG - Intronic
1161420328 19:4173117-4173139 CAGCCTGGGATGGGTGAGTGAGG + Intergenic
1161625132 19:5322141-5322163 CAGCTCAGGCGGGGACCGTGGGG - Intronic
1161633664 19:5373436-5373458 GACCCAAGGAGGGGTGAGTGAGG + Intergenic
1161739061 19:6009219-6009241 CAACCCAGGAGGGTTCTGTTTGG + Intronic
1162031247 19:7918104-7918126 CAGCCCAGGAGGTCCCAGTGAGG + Exonic
1162746474 19:12801525-12801547 CAGCCCAGAAGGAGACAGTGAGG + Intronic
1163433643 19:17282624-17282646 CAGCGCAAGAGGGGTCATTGCGG - Intronic
1163476209 19:17527401-17527423 CAGCCGGGGAGGGGACAGGGTGG + Intronic
1163521979 19:17796809-17796831 CAGCCCAGGAGGAGCAAGTAAGG + Intronic
1163811199 19:19432909-19432931 CATCCCAGTAGAGGACAGTGTGG + Intronic
1163832253 19:19552711-19552733 CTCCCCGGGAGAGGTCAGTGAGG - Intergenic
1164587610 19:29485693-29485715 CAGACCAGGTGGGCTGAGTGGGG - Intergenic
1164681596 19:30137529-30137551 CGGCATTGGAGGGGTCAGTGTGG + Intergenic
1165764688 19:38343386-38343408 CAGCCTAGGAGGGGGCAGAGGGG - Intronic
1165787928 19:38473531-38473553 CAGGCCAGGAGGTGCCAGCGGGG - Exonic
1165862018 19:38914251-38914273 GGGCCCAGGTGGGGTCAGGGAGG + Intergenic
1165931085 19:39359219-39359241 CTGCTCAGGATGGGACAGTGGGG - Intronic
1166300705 19:41910578-41910600 TATGCCAGGATGGGTCAGTGGGG - Intronic
1166599054 19:44077879-44077901 CCCCCGAGGAGGGGTCAGGGAGG - Intronic
1166777555 19:45322181-45322203 CACCCCAGGAGAGGGCACTGAGG + Intronic
1166813721 19:45528963-45528985 CGGTCCAGGATGGGACAGTGCGG + Exonic
1167016192 19:46842621-46842643 GGGCGCGGGAGGGGTCAGTGAGG - Intronic
1167302343 19:48685491-48685513 CAGCCCAGGATGGGACTGGGTGG - Intergenic
924990599 2:309553-309575 CAGACCAGAAGGGGTGAGGGAGG + Intergenic
926123126 2:10255587-10255609 CAGGCCCCGAGGGGTCAGTGTGG - Intergenic
926142678 2:10377641-10377663 CTGCTCAGGAGGTGCCAGTGTGG - Intronic
927173081 2:20386814-20386836 GAGCACAGCAGGGGGCAGTGAGG - Intergenic
927215186 2:20664509-20664531 GAGCCCAGGAGGAGGCAGAGAGG - Intergenic
927506803 2:23620207-23620229 CAGCCCAGGGGTGGTGAGAGGGG + Intronic
928994712 2:37275433-37275455 CTGTCCAGAAGAGGTCAGTGAGG - Intronic
929014328 2:37479457-37479479 CAGCCAAGGAGAGTTAAGTGTGG + Intergenic
929571223 2:43024330-43024352 CAGCCCTGGGGGGGTGAGGGGGG + Intergenic
931440262 2:62285290-62285312 AAGTCCAGGTGGGGTCAGTTGGG + Intergenic
931667271 2:64618311-64618333 GACTCCAGGAGGGGTCAGTGGGG + Intergenic
932580763 2:72991451-72991473 GAGCTCATGAGGAGTCAGTGAGG + Intronic
932813863 2:74845909-74845931 CTTCCCAGGAGGAGTCTGTGAGG + Intronic
934614810 2:95764357-95764379 GATCCCATGAGGGGCCAGTGTGG - Intergenic
934646093 2:96060137-96060159 GATCCCATGAGGGGCCAGTGTGG + Intergenic
934752156 2:96800221-96800243 CAGCACAGGAGAGGGCACTGGGG - Intronic
934839496 2:97616220-97616242 GATCCCATGAGGGGCCAGTGTGG + Intergenic
936246877 2:110836189-110836211 CAGCCCTGGAGGGGGCTGTTGGG + Intronic
937315867 2:120931828-120931850 CAGCCAAGGAGGGGCTAGTCTGG + Intronic
938669514 2:133573566-133573588 CAGCCCAGGGAGGCACAGTGAGG + Intergenic
941732576 2:168934561-168934583 CTGCCTAGGAGGAGTCAGTTGGG + Intronic
945977528 2:216282437-216282459 AAGCCCAGGAGGGGTAATGGGGG - Intronic
946301644 2:218827823-218827845 GAGACCTGGAGGGGTGAGTGGGG - Exonic
946494937 2:220186634-220186656 CAGAGCAGGAGGGGACTGTGAGG - Intergenic
947187953 2:227472057-227472079 CTGGCCAGGAGGAGTCACTGCGG - Intergenic
947595989 2:231412194-231412216 CAGCCCAGGCGGGTTCCGCGAGG - Intergenic
947711585 2:232319494-232319516 CACCCCAGGAGGGCCCTGTGTGG - Intronic
947873244 2:233451274-233451296 GAGCCCAGGAGGCGCCATTGAGG + Intronic
947875790 2:233467544-233467566 CAGCCCAGGAGGGAGCAGGCAGG - Intronic
948661426 2:239508923-239508945 CAGCCCAGGAGAGGCCAGGGAGG - Intergenic
1169406741 20:5327522-5327544 AAGCACAGGAGGGGGAAGTGAGG - Intergenic
1169730093 20:8777258-8777280 CAGCCCCGGAGTGGTCCCTGTGG - Intronic
1171331452 20:24342547-24342569 CAGCCCAGGTGAGGTGACTGCGG + Intergenic
1171396468 20:24837085-24837107 CAGCCCAGGAAGGGTCTGCCTGG + Intergenic
1172083275 20:32358843-32358865 CAGCCGAGGGGGGCTCCGTGGGG + Intronic
1173094439 20:40011544-40011566 GATCCCAGGAGGGGACAATGAGG - Intergenic
1173852693 20:46228752-46228774 CAGCCCAGGAGGGGCCTGCCTGG - Intronic
1173927249 20:46789895-46789917 CAGACCAGGAGGTGGGAGTGCGG + Intergenic
1174205013 20:48831833-48831855 CAGCCTTGGCGGGATCAGTGGGG + Intergenic
1174453334 20:50632921-50632943 CAGCACAGGAGGGGACTGTAGGG - Intronic
1174555805 20:51394561-51394583 CAGCGCAGCAGGGGATAGTGAGG - Intronic
1175085082 20:56451629-56451651 CAGACCAGGTGGGGTCAGCGTGG + Intronic
1175167308 20:57054122-57054144 CAGACAAGGAGGGCTGAGTGGGG - Intergenic
1175279465 20:57793497-57793519 GAGCCCTGGAGGGGTCTGCGGGG + Intergenic
1175403904 20:58715103-58715125 CAGCACAGGAGGGGTTCCTGGGG - Intronic
1175864687 20:62168991-62169013 CAAGCCAGGAGGGGACAGCGGGG + Intronic
1175967204 20:62665677-62665699 CAGGCCAGGATGGGCCTGTGGGG - Intronic
1176024506 20:62978844-62978866 CAGCTCCGGAGGGGTCCCTGAGG - Intergenic
1176025706 20:62984458-62984480 CAGCCCAGGACAGGGCAGGGAGG - Intergenic
1176093539 20:63329395-63329417 GAGCCCAGGAGGCGCCTGTGTGG + Intronic
1176231525 20:64035683-64035705 CAGCCCAGGAGGAGTGAGGCCGG + Intronic
1178840284 21:36133034-36133056 CAGCCCAGGAGGGGACAAGCAGG - Intergenic
1178914021 21:36697214-36697236 AAGCCCAGGAGGTGCCAGAGCGG + Intergenic
1179157360 21:38862286-38862308 CAGCCCGGGATGGGTCAGTGGGG - Intergenic
1179232460 21:39517608-39517630 GAGCCCAGGAGAGGAGAGTGGGG - Intergenic
1179667404 21:42922321-42922343 AAGCCCTGGAGGGGTCTGGGTGG + Intergenic
1180161708 21:46001164-46001186 CAGCCAAGGAGGGGCCAGGGCGG + Intronic
1180186930 21:46144759-46144781 CAGCCCAGGAGAGGACAGGAGGG - Intronic
1181409055 22:22705257-22705279 AAGCCAAGGAGGGGACACTGTGG + Intergenic
1181673385 22:24436612-24436634 GAGCCAGGGAGGGGACAGTGAGG - Intronic
1181808074 22:25387006-25387028 CAGCCCTGGTGGGCTCCGTGGGG - Intronic
1182089432 22:27583985-27584007 GGGCCCAGGAGGAGGCAGTGGGG + Intergenic
1182144460 22:27988755-27988777 CAGCCACGGAGGGGTCGGGGCGG - Intronic
1182261243 22:29073794-29073816 CGGCCCGGGAGGGGTCGCTGGGG - Intronic
1182301765 22:29340962-29340984 CAGCCCTGTCGGGGACAGTGAGG - Intronic
1183618637 22:38960012-38960034 AAGCCCAGGAGAGGGCACTGGGG - Intronic
1183672789 22:39283026-39283048 CAGCCAAGGGGTGGCCAGTGTGG - Intergenic
1184690353 22:46114600-46114622 CAGGCCAGGAGGGCACAGGGGGG - Intergenic
1185015863 22:48342215-48342237 CACCCCCGGGGGGTTCAGTGAGG + Intergenic
1185125271 22:49007054-49007076 CAGCCCAGGAGGCCACACTGGGG + Intergenic
1185285453 22:49997887-49997909 CAGACCAGGAGGGGGCTCTGAGG + Intronic
1185331906 22:50255740-50255762 CTGCCCAGGTGGGGGCAGTGGGG - Intronic
949904698 3:8849331-8849353 CAGCCCAGGAGTGGTCGTGGCGG + Intronic
950435396 3:12976315-12976337 AAGCCCAGGTGGGGTCACAGTGG + Intronic
950495601 3:13332467-13332489 GAGCCGAGGAGGGGCCAGAGAGG + Intronic
950977894 3:17269235-17269257 AAGTCTAGGAGGGGTCAGTGGGG + Intronic
952597228 3:35032619-35032641 CAACCCTTGTGGGGTCAGTGTGG - Intergenic
953761910 3:45695058-45695080 CAACCAGGGAGGGCTCAGTGAGG + Intronic
954425294 3:50439914-50439936 CAGCCTAGAAGGGGTGGGTGAGG - Intronic
954435796 3:50495285-50495307 CAGGCCAGGAGGGGTTCCTGTGG - Intronic
954443821 3:50536003-50536025 CAGCAGAGGAGGGGACAGTGGGG - Intergenic
954589885 3:51774475-51774497 CAACCCAGGAGGAGAAAGTGGGG - Intergenic
956644959 3:71446333-71446355 CAGCCCAGGAGGAAACAGGGAGG + Intronic
958985908 3:100779275-100779297 TGGCCCAGGAGGTGTAAGTGGGG + Intronic
959262269 3:104097894-104097916 CAGCTCAGCTGGGGTCTGTGGGG - Intergenic
959981714 3:112524945-112524967 CAGCCCAGGAGAGGTTGGAGAGG + Intergenic
960937617 3:122913140-122913162 CAGCCCCGGAGCGGTGAGGGCGG - Intronic
961442435 3:126960942-126960964 AAGCCCAGGGCGGGTTAGTGGGG + Intergenic
962321882 3:134397120-134397142 GAGCACACAAGGGGTCAGTGGGG - Intergenic
962824823 3:139091152-139091174 TAGCCCAAGTGGGGTCAGTAAGG - Intronic
962946605 3:140176666-140176688 GGCCCCAGGAGGGGTGAGTGAGG + Intronic
963982188 3:151551012-151551034 CAACCCAGCATGGTTCAGTGTGG + Intergenic
964110013 3:153078155-153078177 CAGACAAGGAGGGGTTAGAGTGG + Intergenic
964472825 3:157072366-157072388 CAGCCCAGGAGTGGGCACAGTGG + Intergenic
964726390 3:159818471-159818493 CTCCCCAGGAAGGGGCAGTGTGG + Intronic
965606284 3:170500556-170500578 CAGCCTAGAAGAGGTCAGGGAGG - Intronic
967126582 3:186429698-186429720 CAGCCCTGTCGGGGACAGTGGGG - Intergenic
968850128 4:3073421-3073443 CAGCTCAGCAGAGGTCTGTGGGG - Intergenic
968916115 4:3497718-3497740 CAGGCCTGGAGGGGACAGTCAGG + Intronic
969435941 4:7189444-7189466 GTGCCCAGGAGAGGACAGTGCGG - Intergenic
969455647 4:7298285-7298307 CACCCCAGCAGGGGTGAGTGAGG + Intronic
969621751 4:8282159-8282181 CAGCCTAGCAGGGTCCAGTGAGG + Intronic
969641449 4:8401512-8401534 CAGCCCAGGAGAGCTGAGTAGGG - Intronic
970146497 4:13041805-13041827 CAGCCCAGGACAGGTCATTTGGG + Intergenic
971253294 4:24991330-24991352 CAGACAAGGAGGAGTCAGGGAGG + Intergenic
972636336 4:40887133-40887155 CAACCCTGGGGGGCTCAGTGGGG + Intronic
973892865 4:55385379-55385401 CCCCACAGGAGGGGGCAGTGAGG - Intergenic
976265924 4:83186060-83186082 CAGTCCCGGAGGGGGGAGTGGGG - Intergenic
983684406 4:170390859-170390881 CAGCCCAGGAAGGCTCAGTTAGG - Intergenic
985536002 5:466073-466095 CATCCCGGGTGGGGACAGTGGGG + Intronic
985541283 5:488817-488839 CAGCCCAGGAGAAGCAAGTGGGG + Intronic
985625569 5:983430-983452 CAGCCCAAGTGGGGACAGAGGGG + Intergenic
985638995 5:1054433-1054455 CTGCCTAGGAGGGGACCGTGGGG - Intronic
990279246 5:54232003-54232025 CAGCACATGAGCAGTCAGTGTGG - Intronic
995751515 5:115457569-115457591 CAGACCATCAGGGGTCAGTTTGG + Intergenic
996224641 5:120976833-120976855 CAGGACAGGTGGGGTCAGTAGGG + Intergenic
996472822 5:123879692-123879714 CAGCCCATGTGTGGCCAGTGAGG + Intergenic
997122716 5:131192266-131192288 GAGGCCAGGAAGGGTCAGAGGGG + Intronic
997590111 5:135067157-135067179 CCGGCAAGGAGGGGTCAGGGAGG - Intronic
999125404 5:149242460-149242482 CAGACCAGGAAGGGACAGTGGGG - Intronic
999244700 5:150147635-150147657 CCGCCCAGGAGGGCTCTGAGGGG - Intronic
999299975 5:150485394-150485416 CTGCCCAGGAGGGGTCATTCTGG + Intergenic
1000385952 5:160675019-160675041 CAGCCCAAGGGGGTTCAGTCAGG + Intronic
1001768185 5:174271517-174271539 CAGCCCAGCTGGGGTGGGTGGGG + Intergenic
1001979547 5:176029693-176029715 TAGCCCAGCAGGAGTGAGTGGGG + Intronic
1002086749 5:176780638-176780660 CAACCCAGGTGGGGACAGAGTGG - Intergenic
1002087687 5:176785978-176786000 CAGGCCTGCAGGGGGCAGTGGGG + Intergenic
1002167278 5:177356085-177356107 CAGCCCTAGAAGGGGCAGTGGGG + Intergenic
1002174070 5:177391486-177391508 CAGCCCAGGTTAGGTCAGTGGGG + Intronic
1002237870 5:177814070-177814092 TAGCCCAGCAGGAGTGAGTGGGG - Intergenic
1002377840 5:178801056-178801078 CATCCCTGGAGGGGTCAGTGAGG - Intergenic
1002428779 5:179191296-179191318 GAGCCCTGGGGGGCTCAGTGAGG + Intronic
1002484208 5:179523653-179523675 TTGCCCAGGAGGGGACCGTGTGG + Intergenic
1002538840 5:179893086-179893108 GAGCCCATGAGGGGTGAATGTGG + Intronic
1003421697 6:5964043-5964065 CAGTGCAGCAGGGGTCAGGGAGG + Intergenic
1003957032 6:11173667-11173689 CAGCCTGGGAGGGGGCATTGAGG - Intergenic
1006180651 6:32151716-32151738 CAGCTGAGGAGGGGTAAGGGAGG + Intronic
1006509857 6:34515884-34515906 CTGCTCAGGAGGGGGCAGGGTGG + Intronic
1007298838 6:40850306-40850328 CAGCTCAGATGGGGTCAGAGGGG - Intergenic
1007512153 6:42381808-42381830 AAGCACAGGAGGGCTCAGGGAGG + Intronic
1007819760 6:44552584-44552606 CAGCACAGGAGGGGTTAAAGGGG - Intergenic
1010495842 6:76533030-76533052 CAGCCCCAGAGGGGTTAGGGTGG + Intergenic
1010768108 6:79799011-79799033 CAGCCAATGAGGGGTAAGTAAGG - Intergenic
1015051262 6:128843067-128843089 CAGTCCAGGAGAGATCACTGGGG + Intergenic
1015599934 6:134902239-134902261 CAGCCCAGGAAGGCTCAGCTGGG - Intergenic
1016356788 6:143227306-143227328 CAGCCCAGCAGGGTCCTGTGTGG + Intronic
1016386858 6:143537362-143537384 CGGCCGAGGAGGCGGCAGTGTGG - Intronic
1016804858 6:148202446-148202468 CAGCCCACCAGGGCTCAGGGAGG - Intergenic
1016889038 6:148987361-148987383 CAACCCAGGAAGGGTCAGGATGG + Intronic
1017615689 6:156244185-156244207 CATCCAAGCAGGGGGCAGTGAGG - Intergenic
1017720098 6:157237749-157237771 GAGCCTAGGAGGGGGCAGTTTGG + Intergenic
1018978493 6:168583383-168583405 CAGACCAGGAGGGGTGAGGCAGG - Intronic
1019497117 7:1345880-1345902 CAGCCCAGAGGGTGTCACTGGGG + Intergenic
1020116298 7:5478287-5478309 CAGCCCAGGGGGGCTGGGTGAGG - Intronic
1020248547 7:6449298-6449320 CAGACCAGGGTGGGGCAGTGGGG - Intronic
1020683019 7:11259923-11259945 CAGCCAAGGAGGGGCCAGACTGG - Intergenic
1021981280 7:26058153-26058175 CAGCCCAGGTGGAGTGTGTGGGG + Intergenic
1023518962 7:41031779-41031801 CAGCCCATTAGGGGTTAGGGAGG - Intergenic
1023644327 7:42293512-42293534 CAGCACAGGAGGCTTCACTGTGG - Intergenic
1023882748 7:44329742-44329764 CAGCTAAGGTGGGGTCAGTCAGG - Intronic
1023931404 7:44708646-44708668 GGGCCCAGGAGGGGTGGGTGGGG - Exonic
1024238772 7:47417448-47417470 AAGCCCAGTAGTGGTCAGAGGGG + Intronic
1026564651 7:71480062-71480084 CAGCCCAACTGGGGTTAGTGTGG - Intronic
1026833637 7:73624274-73624296 GCGACCAGGAGGGGTCCGTGGGG - Exonic
1029283028 7:99448964-99448986 GAGCCCGGGTGGAGTCAGTGGGG + Intronic
1029423717 7:100484304-100484326 CAGCCCAGAAGGTAGCAGTGGGG + Intronic
1029426049 7:100494471-100494493 CAGCCAAGGAGGGGTCTGCATGG + Exonic
1029649161 7:101879189-101879211 GAGCCCAGGAGGAGTCCCTGGGG + Intronic
1029675974 7:102069183-102069205 GAGCACAGGAGGGGGCAGGGAGG - Intronic
1029707070 7:102281780-102281802 CAGCCCTGCAGGGGTGGGTGAGG + Intronic
1030108958 7:106010047-106010069 CAGCCCTGGAGGGCCAAGTGAGG + Intronic
1032436401 7:131904488-131904510 CAGCCCAGGAGGTGTCATGAGGG - Intergenic
1032458612 7:132092923-132092945 GAATCCAGGAGGGGACAGTGGGG + Intergenic
1033955756 7:146845781-146845803 CAGTGCAGGCTGGGTCAGTGAGG + Intronic
1035119003 7:156549368-156549390 GAGCCCAGGAGGGGACTGGGCGG - Intergenic
1035264777 7:157684840-157684862 CGGCCCAGGAGGGCACAGGGCGG - Intronic
1035775226 8:2182530-2182552 CAGCCCAGGAAGGGGAACTGGGG + Intergenic
1036478989 8:9120945-9120967 GAGCCCTGGAGGGGGCAGAGAGG - Intergenic
1036929654 8:12942710-12942732 CAGCCCAGGAGGGGACATTGAGG + Intergenic
1042225019 8:66508449-66508471 TAGCCTTGGAGAGGTCAGTGTGG - Intronic
1042857884 8:73285838-73285860 CACCCCAGGAGTGGTGAATGTGG - Intergenic
1044263768 8:90158917-90158939 CAGCCCAGGAGTGGGCAGGTAGG + Intergenic
1045426201 8:102068239-102068261 CAGCCAAGGAGGGTTAAGTGGGG - Intronic
1047887310 8:129266022-129266044 CCGCTCAGGTGGGGTCACTGAGG - Intergenic
1048209053 8:132439619-132439641 CAGCAGAGGAGGGGGCAGAGAGG + Intronic
1048788477 8:138077713-138077735 CACTCTAGGAGGGGTGAGTGGGG - Intergenic
1048901184 8:139039422-139039444 CTGCCCAGGAAGAGTAAGTGAGG + Intergenic
1049571338 8:143371594-143371616 CTGCCCAGGAGGAAACAGTGTGG - Intronic
1049709828 8:144058456-144058478 AGGCCCAGGAGTGGGCAGTGGGG + Intronic
1049755886 8:144311145-144311167 CAGACCAGGCTGGGTCAGTGGGG - Intronic
1050813580 9:9780248-9780270 GATTCCAAGAGGGGTCAGTGAGG + Intronic
1052140904 9:24981872-24981894 TACCCCAGGAAGTGTCAGTGTGG - Intergenic
1055701978 9:78954580-78954602 CACCCCAAGAGGTATCAGTGAGG - Intergenic
1056659681 9:88534908-88534930 CAGCGCAGTGGGGGACAGTGTGG + Intergenic
1057874088 9:98740211-98740233 CAGCACAAGAGGTGTCTGTGTGG - Intronic
1060087964 9:120718469-120718491 CAGAACAGCAGGGGTCAGAGTGG + Intergenic
1060581128 9:124747713-124747735 GAGCCCAGGAGGAGTCTTTGGGG - Intronic
1061293887 9:129666795-129666817 CAGCCCCGGACGGTTCAGTGGGG + Intronic
1061987357 9:134137162-134137184 CAGTCCAGGAGGGCACACTGAGG + Intronic
1062282920 9:135759961-135759983 ACTCCCAGGAGGGGACAGTGAGG + Intronic
1062309550 9:135928659-135928681 GAGCCCAGGAGGGGTCAGCCAGG + Intergenic
1062378158 9:136274277-136274299 CAGCCCAGGGAGGGTGAATGCGG - Intergenic
1062627033 9:137448045-137448067 CAGCACAGGAGGGGACGGAGAGG - Exonic
1187009649 X:15266615-15266637 CAACCCTGGTGGGGTCAGGGTGG - Intronic
1187118152 X:16374829-16374851 CAGCCCAGGAAAAGACAGTGTGG + Intergenic
1187416143 X:19094933-19094955 CAGCCCTGGGCGGGTCAGAGAGG - Intronic
1190640872 X:52482035-52482057 GAGCCCAAAAGGGGTCTGTGGGG - Intergenic
1190646800 X:52530830-52530852 GAGCCCAAAAGGGGTCTGTGGGG + Intergenic
1192176488 X:68889292-68889314 GAGCCCAGGATGGGTCTCTGAGG + Intergenic
1192181311 X:68917434-68917456 CAGGAGAGGAGAGGTCAGTGTGG - Intergenic
1195527705 X:105910815-105910837 CAGACCAGTTGGCGTCAGTGGGG + Intronic
1196457713 X:115901843-115901865 GAGTCCAGAAGGGGTCAGAGAGG - Intergenic
1196463433 X:115951139-115951161 GAGTCCAGAAGGGGTCAGGGAGG - Intergenic
1197766650 X:130063658-130063680 TAGGCCAGGAGGAGTCAGTGAGG + Intergenic
1200073735 X:153541255-153541277 CACCCCAGGAGCAGTCAGTCAGG + Intronic
1200138757 X:153886995-153887017 GAGCCTAGGAGGGGGCACTGGGG - Intronic
1200235108 X:154464329-154464351 CTGCCCAGGATGGGGCAGAGTGG + Intronic
1201481467 Y:14443940-14443962 CAGCCCAGGTCTGGTCTGTGTGG - Intergenic
1201630223 Y:16063543-16063565 GAGGGCAAGAGGGGTCAGTGAGG + Intergenic