ID: 1141504121

View in Genome Browser
Species Human (GRCh38)
Location 16:84463420-84463442
Sequence GTTCCAGAAGGGCCTGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 722
Summary {0: 1, 1: 0, 2: 3, 3: 114, 4: 604}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141504121_1141504125 -3 Left 1141504121 16:84463420-84463442 CCACAGGCAGGCCCTTCTGGAAC 0: 1
1: 0
2: 3
3: 114
4: 604
Right 1141504125 16:84463440-84463462 AACTGCAGCATTTTGGATTCTGG 0: 1
1: 0
2: 3
3: 47
4: 296
1141504121_1141504129 24 Left 1141504121 16:84463420-84463442 CCACAGGCAGGCCCTTCTGGAAC 0: 1
1: 0
2: 3
3: 114
4: 604
Right 1141504129 16:84463467-84463489 GGAAGATCTCCCTGCCTTCAGGG 0: 1
1: 0
2: 1
3: 33
4: 250
1141504121_1141504130 25 Left 1141504121 16:84463420-84463442 CCACAGGCAGGCCCTTCTGGAAC 0: 1
1: 0
2: 3
3: 114
4: 604
Right 1141504130 16:84463468-84463490 GAAGATCTCCCTGCCTTCAGGGG 0: 1
1: 0
2: 0
3: 26
4: 168
1141504121_1141504127 3 Left 1141504121 16:84463420-84463442 CCACAGGCAGGCCCTTCTGGAAC 0: 1
1: 0
2: 3
3: 114
4: 604
Right 1141504127 16:84463446-84463468 AGCATTTTGGATTCTGGGTTAGG 0: 1
1: 0
2: 9
3: 49
4: 352
1141504121_1141504126 -2 Left 1141504121 16:84463420-84463442 CCACAGGCAGGCCCTTCTGGAAC 0: 1
1: 0
2: 3
3: 114
4: 604
Right 1141504126 16:84463441-84463463 ACTGCAGCATTTTGGATTCTGGG 0: 1
1: 0
2: 7
3: 35
4: 236
1141504121_1141504128 23 Left 1141504121 16:84463420-84463442 CCACAGGCAGGCCCTTCTGGAAC 0: 1
1: 0
2: 3
3: 114
4: 604
Right 1141504128 16:84463466-84463488 AGGAAGATCTCCCTGCCTTCAGG 0: 1
1: 0
2: 0
3: 21
4: 248
1141504121_1141504124 -10 Left 1141504121 16:84463420-84463442 CCACAGGCAGGCCCTTCTGGAAC 0: 1
1: 0
2: 3
3: 114
4: 604
Right 1141504124 16:84463433-84463455 CTTCTGGAACTGCAGCATTTTGG 0: 1
1: 0
2: 0
3: 34
4: 467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141504121 Original CRISPR GTTCCAGAAGGGCCTGCCTG TGG (reversed) Intronic
900610978 1:3544534-3544556 GTTCCAGCAGCCCCTGCATGAGG - Intronic
901114913 1:6835558-6835580 GTTCCAGTAGGTCCTGGGTGGGG + Intronic
903684168 1:25119065-25119087 GTCCAAAAAGGGCCTTCCTGAGG + Intergenic
904146203 1:28394044-28394066 CTTCCTGAAGGACCTGCCAGAGG - Intronic
904263027 1:29301534-29301556 CTTCCTGAAGGACCTGCCAGAGG - Intronic
904436351 1:30500245-30500267 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
904749676 1:32733790-32733812 CTTCCAGAAGGCCCTGAGTGTGG + Intergenic
905360633 1:37417404-37417426 GCTCCTGAAGGACCTGCCTAAGG - Intergenic
905804601 1:40866792-40866814 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
905829244 1:41051435-41051457 CCTCCTGAAGGACCTGCCTGAGG - Intronic
906029446 1:42706183-42706205 CCTCCTGAAGGACCTGCCTGGGG + Intergenic
906796956 1:48704755-48704777 CCTCCTGAAGGACCTGCCTGAGG + Intronic
906920303 1:50056986-50057008 ACTCCTGAAGGACCTGCCTGAGG - Intronic
907056271 1:51371274-51371296 TCTCCTGAAGGACCTGCCTGAGG - Intronic
907087678 1:51691941-51691963 CCTCCTGAAGGACCTGCCTGAGG + Intronic
907117500 1:51982024-51982046 CCTCCTGAAGGACCTGCCTGAGG - Intronic
908067137 1:60418475-60418497 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
908500299 1:64736715-64736737 CCTCCCGAAGGACCTGCCTGGGG - Intergenic
908925856 1:69254125-69254147 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
909314833 1:74202977-74202999 CCTCCTGAAGGACCTGCCTGAGG + Intronic
909371229 1:74885374-74885396 GTTCCAGTAGGGACTGTATGTGG - Intergenic
909610296 1:77544735-77544757 ATTCCTGAAGGACCTGCCTGAGG + Intronic
909765181 1:79346956-79346978 CTTCCTGAAGGACCTGCCTGAGG + Intergenic
909886924 1:80953214-80953236 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
910003492 1:82365804-82365826 TTTCCAGAAGGACCTGACTGAGG + Intergenic
911661071 1:100501683-100501705 CCTCCTGAAGGACCTGCCTGAGG - Intronic
912879044 1:113390726-113390748 GTTCCAGAAGGGGCTTCGGGCGG - Intergenic
913075981 1:115340657-115340679 GTTCCAGATCAGCCTGCCTTTGG + Intergenic
913194833 1:116447246-116447268 CCTCCTGAAGGACCTGCCTGGGG - Intergenic
913325742 1:117627069-117627091 GTTCCTGATGGGGATGCCTGTGG + Exonic
913617282 1:120574009-120574031 GCTCCTGAGGGACCTGCCTGAGG - Intergenic
913975293 1:143450705-143450727 GTGCCCGATGGGGCTGCCTGGGG - Intergenic
914069686 1:144276321-144276343 GTGCCCGATGGGGCTGCCTGGGG - Intergenic
914109469 1:144690033-144690055 GTGCCCGATGGGGCTGCCTGGGG + Intergenic
914572993 1:148936910-148936932 GCTCCTGAGGGACCTGCCTGAGG + Intronic
914778029 1:150756294-150756316 CCTCCTGAAGGACCTGCCTGAGG + Intronic
915519230 1:156431526-156431548 GTTTCAGAAGGCGCTGCCTGCGG - Intergenic
915896672 1:159816642-159816664 CTTCCTGAAGGACCTGCTTGAGG - Intergenic
916406645 1:164504349-164504371 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
917131620 1:171749028-171749050 CTTCCCAAAGGACCTGCCTGAGG - Intergenic
917260535 1:173162526-173162548 CCTCCTGAAGGCCCTGCCTGAGG + Intergenic
917547865 1:175991905-175991927 TCTCCTGAAGGGCCTGCCTGAGG + Intronic
917552697 1:176051610-176051632 CCTCCTGAAGGACCTGCCTGCGG - Intronic
917674263 1:177304340-177304362 GGTCCCCAAGGGCCTCCCTGTGG - Intergenic
918031466 1:180816890-180816912 CCTCCCGAAGGACCTGCCTGAGG - Intronic
918102264 1:181386773-181386795 GTTGCAGAAGGGCCTACATGGGG - Intergenic
918174104 1:182028263-182028285 CCTCCTGAAAGGCCTGCCTGAGG + Intergenic
919378418 1:196822701-196822723 GTTCCTGAAGGACCTGCCTCAGG + Intronic
919388111 1:196946738-196946760 GTTCCTGAAGGATCTGCCTCAGG + Intronic
919390622 1:196980208-196980230 GTTCCTGAAGGACCCGCCTGAGG + Intronic
919769030 1:201145366-201145388 GTTGCAGGAGGGGCTGCCTCAGG + Intronic
920034883 1:203059369-203059391 GTTCAGGAAGGGCCTTGCTGGGG - Intronic
920440538 1:205977824-205977846 GGTCCAGGAGGGCTTCCCTGAGG - Exonic
921141548 1:212311625-212311647 CCTCCTGAAGGGCCTGCCTGAGG - Intronic
921563841 1:216692146-216692168 CCTCCTGAAGGACCTGCCTGAGG - Intronic
922122725 1:222688884-222688906 CCTCCTGAAGGACCTGCCTGAGG - Intronic
922630184 1:227099272-227099294 CTTCCTGAAGGACCTGCCTGAGG - Intronic
922887487 1:229031292-229031314 GGTCAAGAAGGGCCTTCATGGGG + Intergenic
923002063 1:230014933-230014955 TTTCCTGGAGGACCTGCCTGAGG - Intergenic
923128177 1:231050649-231050671 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
923192339 1:231631414-231631436 CCTCCTGAAGGACCTGCCTGAGG - Intronic
923601300 1:235405282-235405304 CCTCCTGAAGGACCTGCCTGAGG + Intronic
923662657 1:235971915-235971937 GTTCCAGAAGGGGCCACGTGAGG - Intergenic
1062908791 10:1199107-1199129 CTCTCTGAAGGGCCTGCCTGTGG - Intronic
1063313339 10:4977765-4977787 CTGCCAGAAGGCCCTGCGTGTGG + Exonic
1063314614 10:4989951-4989973 CTGCCAGAAGGCCCTGCGTGTGG - Exonic
1064145515 10:12823478-12823500 GATCGAGAAGGGCATGCATGAGG + Intronic
1064977728 10:21135934-21135956 GTTCCAGAAAGTTCTGCCTCAGG - Intronic
1065167388 10:22994143-22994165 GATCCAGAAGTGCCTCCTTGAGG + Intronic
1065631106 10:27681954-27681976 CCTCCTGAAGGGCCTGCCTGAGG - Intronic
1066063478 10:31744946-31744968 AGTCCACAAAGGCCTGCCTGTGG - Intergenic
1066218433 10:33311348-33311370 GTCCCAGGTGGGCCTGCCTTGGG + Intronic
1066511095 10:36097207-36097229 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
1066757798 10:38728405-38728427 CTTCCTGAAGGACCTGCCTGAGG - Intergenic
1067148895 10:43713412-43713434 GGAACAGAAGGTCCTGCCTGGGG - Intergenic
1067250819 10:44585654-44585676 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
1067826213 10:49575244-49575266 CCTCCAGAAGGCCCTGCCTGAGG + Intergenic
1068756091 10:60655243-60655265 CTTCCAGAAGGACCTGCCTGAGG - Intronic
1068912471 10:62393193-62393215 CTTCCTGAAGGACCTGCCTGAGG + Intronic
1069571925 10:69499439-69499461 TTTCCAGAGAGGCCTGCGTGGGG + Intronic
1070471180 10:76781267-76781289 GTTCAAAATGGGCCTGACTGGGG + Intergenic
1070681583 10:78452819-78452841 GTGCCTGAAGGACATGCCTGTGG - Intergenic
1071303070 10:84272320-84272342 GATCCAGAAAGGCTTCCCTGAGG + Intergenic
1071356650 10:84803257-84803279 ACTCCTGAAGGACCTGCCTGAGG - Intergenic
1071522805 10:86341423-86341445 TTTCCAGAAGGGCCCGCTTAGGG + Intronic
1072289861 10:93954022-93954044 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1072325154 10:94290631-94290653 CTTCCTGAAGGACCTGCCTGAGG + Intronic
1072998112 10:100264643-100264665 CTTCCTGAAGGACCTGCCTGAGG - Intronic
1074342763 10:112650422-112650444 CCTCCTGAAGGACCTGCCTGAGG + Intronic
1074392655 10:113071113-113071135 GTTCCAGAAGGCCAAGCCTAGGG - Intronic
1074747732 10:116552266-116552288 CTTCCTGAAGGATCTGCCTGAGG - Intronic
1075296590 10:121281979-121282001 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1075498099 10:122945441-122945463 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1076158066 10:128218798-128218820 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1076248012 10:128962416-128962438 GACCCAGATGGGCCTGGCTGTGG - Intergenic
1076787174 10:132756751-132756773 CTGCCTGAAGGACCTGCCTGAGG - Intronic
1076869488 10:133186368-133186390 TGTCCAGAAAGGCCTTCCTGGGG - Exonic
1077410721 11:2402780-2402802 GTCCCCGATGGGGCTGCCTGGGG + Exonic
1078125014 11:8552779-8552801 CCTCCTGAAGGACCTGCCTGAGG + Intronic
1078343471 11:10520536-10520558 CCTGCTGAAGGGCCTGCCTGAGG + Intronic
1078644514 11:13127753-13127775 CCTCCCAAAGGGCCTGCCTGAGG - Intergenic
1078652669 11:13210173-13210195 GTTCCAGCAGGGCCTACCCAAGG + Intergenic
1079061748 11:17254964-17254986 TCTCCTGAAGGGCGTGCCTGAGG + Intronic
1079777401 11:24549396-24549418 CCTACTGAAGGGCCTGCCTGAGG + Intronic
1080090050 11:28336873-28336895 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1080282451 11:30573473-30573495 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1080480565 11:32645232-32645254 CTTCCTGAAGGACCTGCCTGAGG + Intronic
1081004239 11:37714235-37714257 CCTCCTGAAGGACCTGCCTGTGG + Intergenic
1081163275 11:39777644-39777666 GATCAAGAAGGGCTTTCCTGAGG - Intergenic
1081273825 11:41121875-41121897 ATTCCAGGAGAGTCTGCCTGAGG + Intronic
1081508783 11:43746562-43746584 TCTCCTGAAGGACCTGCCTGAGG + Intronic
1081938788 11:46923030-46923052 GTTCGAGGAAGGCCTGCCAGAGG + Intergenic
1082724222 11:56715973-56715995 CCTCCTGAAGGACCTGCCTGTGG - Intergenic
1082892104 11:58150841-58150863 CCTCCTGAAGGACCTGCCTGGGG - Intronic
1083397806 11:62403174-62403196 GTCCCAGAAGTGCCCGCCTTAGG + Intergenic
1083466820 11:62852913-62852935 GTTCCAGAAGGAACTGTCTGAGG - Intergenic
1083861308 11:65421759-65421781 CTTCCAGAAGAGCCAGGCTGGGG + Intergenic
1084004970 11:66317812-66317834 GTTCCAGCTGGGCCAGCGTGTGG + Intergenic
1084274989 11:68046774-68046796 GTGCCAGCTGGGGCTGCCTGTGG + Intronic
1084465601 11:69321250-69321272 GTTGGAGAGGGGCCTGCCTTGGG - Intronic
1085177732 11:74505575-74505597 ATTACACAAGGTCCTGCCTGAGG + Intronic
1085555476 11:77416518-77416540 CCTCCAAAAGGACCTGCCTGAGG + Intronic
1087088912 11:94247967-94247989 TTCCCTGAAGGACCTGCCTGAGG + Intergenic
1087345642 11:96967541-96967563 CATCCTGAAGGACCTGCCTGAGG + Intergenic
1087819703 11:102698020-102698042 CCTCCTGAAGGGCCTGCCTGAGG + Intronic
1087884078 11:103457325-103457347 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1088086874 11:105991709-105991731 CCTCCTGAAGGGCCTGCCTAAGG + Intergenic
1088336507 11:108710606-108710628 CTTCCTGAGGGACCTGCCTGAGG + Intronic
1088851941 11:113711829-113711851 GGTCCACAAGGGCCTGCCCTGGG - Intergenic
1089995381 11:122902079-122902101 CCTCCTGAAGGACCTGCCTGAGG + Intronic
1090114082 11:123947691-123947713 GATCTAGAAGGGCCTGCATATGG + Intergenic
1090361238 11:126174218-126174240 CCTCCTGAAGGCCCTGCCTGAGG + Intergenic
1091097019 11:132833458-132833480 CCTCCTGAAGGCCCTGCCTGAGG + Intronic
1091108827 11:132946269-132946291 CCTCCTGAAGGACCTGCCTGTGG + Intronic
1091361243 11:134979972-134979994 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
1091744485 12:2982478-2982500 GACCCAGGAGGGCCTGCCAGGGG - Intronic
1091745035 12:2986273-2986295 CCTCCCGAAGGGCCTGCCTGAGG + Intronic
1091953973 12:4620930-4620952 TGTCCTGAAGGACCTGCCTGAGG - Intronic
1094030063 12:26001747-26001769 CCTCCTGAAGGACCTGCCTGAGG + Intronic
1094254839 12:28411857-28411879 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1094446615 12:30537897-30537919 GCTCCTGAAGGACCTGCCTGAGG + Intergenic
1095222490 12:39633439-39633461 CCTTCTGAAGGGCCTGCCTGAGG + Intronic
1095863420 12:46945300-46945322 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1096263108 12:50105021-50105043 GGTCCAGTAGTGCCTGCCTCCGG + Intronic
1096499453 12:52056122-52056144 CTTCCAGAAGTGCCTGGCGGTGG + Exonic
1096911941 12:54992894-54992916 GGTCCTGAAGGACCTGCCTAAGG + Intergenic
1096967178 12:55637678-55637700 GTAACAGAGGAGCCTGCCTGCGG - Exonic
1097649426 12:62278274-62278296 CTTCCTGAAGGACCTGCCTGAGG + Intronic
1097912105 12:64981744-64981766 GTTCCAGAGGGGCCTGTATGAGG + Intergenic
1098515369 12:71369608-71369630 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1099541921 12:83921587-83921609 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1100177987 12:92052358-92052380 GTTCAAGGATGGCCTGCCTGAGG - Intronic
1100807886 12:98306651-98306673 CCTCCTGAAGGGCTTGCCTGAGG + Intergenic
1100967184 12:100025842-100025864 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
1101989413 12:109472469-109472491 CCTCCAGAAGCACCTGCCTGAGG + Intronic
1102201991 12:111063608-111063630 ACTCCAGCAGGGCCTGCCTTGGG + Intronic
1103323132 12:120103064-120103086 TTTCCTGGAGGGCCTGCCTCTGG - Intronic
1104892326 12:132146178-132146200 GATCCAGGAGTGGCTGCCTGGGG - Intronic
1105760307 13:23508008-23508030 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1105778738 13:23687730-23687752 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1105832927 13:24181723-24181745 TGTCCTGAAGGACCTGCCTGAGG + Intronic
1106059407 13:26272503-26272525 CCTCCTGAAGGACCTGCCTGAGG + Intronic
1106065564 13:26344823-26344845 CCTCCTGAAGGACCTGCCTGAGG + Intronic
1106406108 13:29475447-29475469 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1107294763 13:38897198-38897220 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
1108384847 13:49889788-49889810 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1108423655 13:50276351-50276373 TCTCCTGAAGGACCTGCCTGAGG + Intronic
1108803197 13:54125159-54125181 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1108904867 13:55456037-55456059 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1108979687 13:56494822-56494844 TCTCCTGAAGGGCCTGCCTGAGG + Intergenic
1109431545 13:62242362-62242384 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
1110144162 13:72169040-72169062 CTTCCAGAGGGGCCTGGATGAGG + Intergenic
1111269074 13:85856187-85856209 TATCCTGAAGGACCTGCCTGTGG + Intergenic
1111421401 13:88016371-88016393 CTTCCTGAAGGACCTGCCTGCGG - Intergenic
1113030541 13:105989443-105989465 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
1113444975 13:110358397-110358419 CTTCCTGAAGCACCTGCCTGAGG + Intronic
1113462404 13:110491369-110491391 GTCTCCGGAGGGCCTGCCTGAGG - Intronic
1113866071 13:113525512-113525534 GCTCCTGAAGAACCTGCCTGAGG - Intronic
1114188093 14:20418869-20418891 GGCCCAGAAGGGCTTGTCTGAGG - Intergenic
1114566350 14:23635872-23635894 GTGCCAGCTGGGCCTGACTGGGG + Intronic
1114856857 14:26457738-26457760 CTTCCTGAAGGACCTGCCTGAGG - Intronic
1115210405 14:30961965-30961987 CTTCCTGAAGGACCTGCCTGAGG - Intronic
1116242428 14:42362246-42362268 GCTCCTGAAGGGACTGCCTGAGG + Intergenic
1116824495 14:49658920-49658942 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1117235201 14:53767057-53767079 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
1117304077 14:54456602-54456624 CATCCTGAAGGACCTGCCTGAGG - Intergenic
1117558888 14:56915404-56915426 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
1117794033 14:59373176-59373198 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
1117863324 14:60116726-60116748 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1117873805 14:60228952-60228974 CTTCCTGAAGGACCTGCCTGAGG + Intergenic
1119159052 14:72438083-72438105 GTTCCAGGAGGGCCTGGTGGAGG + Intronic
1120634234 14:86931513-86931535 TCTCCTGAAGGACCTGCCTGAGG - Intergenic
1121045791 14:90786432-90786454 GTTCCAGAAGGACCTTGCTGGGG - Intronic
1122147542 14:99700811-99700833 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1122235965 14:100330760-100330782 CTTCCAGAGGGGGCTGCCCGTGG + Intergenic
1122303486 14:100746065-100746087 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1122520802 14:102342144-102342166 GATGCAGAGGGGCGTGCCTGCGG + Exonic
1122559911 14:102605743-102605765 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1122904036 14:104793843-104793865 CTTCCAGATGGGCCTTCCTGAGG + Exonic
1123030100 14:105447546-105447568 TTTCCAGAAGGGCCTCGTTGGGG + Intronic
1123066086 14:105620161-105620183 GTTCTGGAAGGCCCTCCCTGTGG + Intergenic
1123070230 14:105639214-105639236 GTTCTGGAAGGCCCTCCCTGTGG + Intergenic
1123074820 14:105662873-105662895 GTTCTGGAAGGCCCTCCCTGTGG + Intergenic
1123089467 14:105735998-105736020 GTTCTGGAAGGCCCTCCCTGTGG + Intergenic
1123095255 14:105764158-105764180 GTTCTGGAAGGCCCTCCCTGTGG + Intergenic
1123506384 15:20943784-20943806 GCTCCTGAAGGACCTGCCTCAGG - Intergenic
1123563610 15:21517491-21517513 GCTCCTGAAGGACCTGCCTCAGG - Intergenic
1123599861 15:21954779-21954801 GCTCCTGAAGGACCTGCCTCAGG - Intergenic
1124665908 15:31592542-31592564 CTTCCTGAAGGACCTGCCTGAGG + Intronic
1124811529 15:32944089-32944111 GTGCCAGAAGGGAGTGCCTGGGG + Intronic
1124920167 15:34018133-34018155 GCTCCTGAAGGACCTGCTTGAGG - Intronic
1125147081 15:36483738-36483760 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1125501305 15:40241603-40241625 CTCCCAGAAGGGCTTGCCTCTGG - Intronic
1125729078 15:41882722-41882744 GCTCCAGCAGGGCCCGCCTGAGG + Exonic
1126624418 15:50672391-50672413 CTTCCTGAAGGACCTGCCTGAGG - Intronic
1127191441 15:56535154-56535176 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1127690947 15:61396964-61396986 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1128297362 15:66535232-66535254 CCTCCTGAAGGTCCTGCCTGAGG + Intronic
1128493182 15:68171301-68171323 CCTCCTGAAGGACCTGCCTGAGG + Intronic
1128850965 15:70955264-70955286 CTTCTTGAAGGACCTGCCTGAGG - Intronic
1129228255 15:74182250-74182272 CAGCCAGAAGGGCCTGCCAGTGG + Exonic
1129447366 15:75627947-75627969 GTTTCAGAAGGGGCTACCTCTGG + Intergenic
1129490616 15:75921953-75921975 CGTCCTGAAGGACCTGCCTGAGG + Intronic
1130156239 15:81352626-81352648 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1131472275 15:92707839-92707861 GATCCACAATGGCCAGCCTGTGG + Intronic
1132059443 15:98679742-98679764 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1132126496 15:99231309-99231331 GCTCTTGAAGGACCTGCCTGAGG - Intronic
1202971968 15_KI270727v1_random:244624-244646 GCTCCTGAAGGACCTGCCTCAGG - Intergenic
1132460888 16:53998-54020 GTTCCAGGAGGGTCTGGCTATGG + Exonic
1132609726 16:809390-809412 TTTCCAGAGGAGCCTGCCTGGGG - Intronic
1133232590 16:4373551-4373573 GTGCCAGAGGGGCCTTCCTCGGG - Intronic
1135749960 16:25049969-25049991 TTTCCTGAAGGACCTGCCTGAGG - Intergenic
1136018156 16:27419393-27419415 CATCCTGAAGGACCTGCCTGAGG + Intronic
1136720019 16:32312425-32312447 CTTCCTGAAGGACCTACCTGAGG + Intergenic
1136725072 16:32350819-32350841 CTTCCTGAAGGACCTGCCTGAGG + Intergenic
1136838396 16:33518704-33518726 CTTCCTGAAGGACCTACCTGAGG + Intergenic
1136843399 16:33556872-33556894 CTTCCTGAAGGACCTACCTGAGG + Intergenic
1138356869 16:56388883-56388905 CCTCCTGAAGGACCTGCCTGAGG + Intronic
1139707489 16:68751468-68751490 GTTCAAGAAAGTCCTCCCTGAGG - Intronic
1140200346 16:72889788-72889810 GCTGCAGAAGGGCCTTCCAGAGG - Exonic
1140224827 16:73068775-73068797 GTTCCCAAGGGGCCTGCCTTTGG - Intergenic
1140489545 16:75323397-75323419 CTTCCTGAAGGACCTGCCTGAGG + Intronic
1140885556 16:79239569-79239591 GGTCCAGAAATGCCTCCCTGTGG - Intergenic
1141504121 16:84463420-84463442 GTTCCAGAAGGGCCTGCCTGTGG - Intronic
1141724061 16:85774666-85774688 GCTGCAGAAGTGACTGCCTGAGG - Intronic
1142032659 16:87846273-87846295 CTTCCAGGCTGGCCTGCCTGTGG - Intronic
1142045943 16:87925331-87925353 ACTCCAGAAGCTCCTGCCTGGGG - Intronic
1203001358 16_KI270728v1_random:166935-166957 CTTCCTGAAGGACCTGCCTGAGG - Intergenic
1203006412 16_KI270728v1_random:205344-205366 CTTCCTGAAGGACCTACCTGAGG - Intergenic
1203132961 16_KI270728v1_random:1703339-1703361 CTTCCTGAAGGACCTGCCTGAGG - Intergenic
1203148560 16_KI270728v1_random:1818989-1819011 CTTCCTGAAGGACCTGCCTGAGG + Intergenic
1203153564 16_KI270728v1_random:1857170-1857192 CTTCCTGAAGGACCTACCTGAGG + Intergenic
1142742826 17:1940912-1940934 TTTGCAGAATGGCCTGGCTGTGG - Intronic
1142802034 17:2352322-2352344 GGTCCAGAATGGACTACCTGAGG + Intronic
1143038085 17:4011941-4011963 GTGAGAGAGGGGCCTGCCTGAGG - Intronic
1143697074 17:8629506-8629528 GTTCCAAACAGGCCTGGCTGGGG + Intronic
1144370097 17:14582130-14582152 CCTACTGAAGGGCCTGCCTGAGG - Intergenic
1144723585 17:17489162-17489184 CTTGCAGAGGGGCCTCCCTGTGG + Intronic
1145786919 17:27600052-27600074 CCTCCTGAAGGACCTGCCTGAGG + Intronic
1145820901 17:27834466-27834488 CCTCCTGAAGGACCTGCCTGAGG + Intronic
1146078047 17:29751066-29751088 CTTCCTGAAGGACCTGCCTGAGG + Intronic
1146643527 17:34559903-34559925 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1147266290 17:39236828-39236850 GATTCTGAGGGGCCTGCCTGGGG - Intergenic
1147683130 17:42267313-42267335 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1147977940 17:44258684-44258706 GTTCCTGGAGGCCCTGGCTGTGG - Intronic
1148326438 17:46785918-46785940 GCTCCTGGAGCGCCTGCCTGCGG + Intronic
1148472892 17:47906516-47906538 GGTCCAGAAAGGCCTCTCTGAGG + Intronic
1148920520 17:51027859-51027881 CTTCCTGAAGGACCTACCTGAGG - Intronic
1149029160 17:52064452-52064474 GATCCAGGATGGCCAGCCTGGGG - Intronic
1149261588 17:54885925-54885947 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
1149629038 17:58105574-58105596 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1150336422 17:64333849-64333871 GAGTCAGAGGGGCCTGCCTGGGG + Intronic
1150482757 17:65523149-65523171 GTTTTAGAAGGGTCTGCCTCAGG - Intergenic
1150867757 17:68871986-68872008 CCTCCCGAAGGACCTGCCTGAGG - Intronic
1151316455 17:73325417-73325439 GTCCCAGAGGGGCCGTCCTGGGG + Intergenic
1151955590 17:77378668-77378690 GTGCCAGTAGCGCCCGCCTGGGG + Intronic
1152836112 17:82533113-82533135 CTTCCTGAAGGACCTACCTGGGG + Intronic
1153003898 18:480605-480627 GTGCATGAAGGGCCTGCCAGTGG + Intronic
1153230288 18:2928590-2928612 ATTCCAGAAGAGCTTGCCTAAGG - Exonic
1153281809 18:3421782-3421804 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1153692854 18:7610871-7610893 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1153728545 18:7982482-7982504 CCTCCTGAAGGTCCTGCCTGAGG + Intronic
1155199990 18:23508731-23508753 GTTTGAGAAGGGCCGGGCTGAGG - Intronic
1156249753 18:35341526-35341548 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1156493166 18:37508362-37508384 GGCCCAGAGGGGCCTGCCTCTGG - Intronic
1156974537 18:43202843-43202865 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
1157801861 18:50627389-50627411 GTTCCAGATGGGAGTGTCTGTGG - Intronic
1157844104 18:50986621-50986643 GTTCCACCAGGTCCTGCCTATGG + Exonic
1158111605 18:53946074-53946096 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
1158256010 18:55549692-55549714 CCTCCTGAAGGACCTGCCTGAGG + Intronic
1158911863 18:62071929-62071951 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1160368048 18:78346162-78346184 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
1160368152 18:78347182-78347204 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
1161541782 19:4856203-4856225 GTTACAGAAGGGCCACCCTCGGG - Intronic
1161634187 19:5376994-5377016 GGTCCGGGAGGGCCTGTCTGAGG + Intergenic
1162231734 19:9272205-9272227 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1162752048 19:12834926-12834948 GTGCCCCAAGGCCCTGCCTGGGG + Intronic
1162948253 19:14056435-14056457 GCGCCAGCTGGGCCTGCCTGAGG + Exonic
1164603133 19:29577196-29577218 CTTCCGGAAGGACCTGCCTGCGG - Intergenic
1164802185 19:31086609-31086631 CTTCCGGAAGGACCTGCCTGAGG + Intergenic
1165200912 19:34144154-34144176 CTTCCTGAAGGACCTGCCTCAGG + Intergenic
1165221440 19:34319966-34319988 GTTACAGAAGGTCCAGCCGGTGG + Exonic
1165699166 19:37924380-37924402 TCTCCTGAAGGACCTGCCTGAGG + Intronic
1166224515 19:41386704-41386726 GCTCCAGCAGTGCCTGGCTGCGG - Exonic
1167053398 19:47094115-47094137 GTGCCCGAGTGGCCTGCCTGTGG - Intronic
1168399176 19:56074154-56074176 CCTCCAGAAGGACCTGCCTGAGG + Intergenic
1168666785 19:58210362-58210384 GATACAGATGTGCCTGCCTGTGG - Intronic
925677873 2:6385290-6385312 TCTCCTGAAGGACCTGCCTGGGG + Intergenic
925959330 2:9001156-9001178 TTTCCTGAAGGCCCTGCCTCAGG + Intronic
926390608 2:12387509-12387531 CTTACTGAAGGACCTGCCTGAGG + Intergenic
926652396 2:15360852-15360874 CCTCCTGAAGGACCTGCCTGAGG + Intronic
926942881 2:18156502-18156524 GTTCCAGAAGGGGAAGACTGAGG - Intronic
926963232 2:18381605-18381627 GTTCCAGAAGAGCTTGCATGGGG + Intergenic
927113988 2:19884274-19884296 GTGCCTGAAGGTCCTGGCTGTGG + Intergenic
927250196 2:20989852-20989874 GTCCCAGCAGAGCTTGCCTGGGG + Intergenic
928355301 2:30607686-30607708 CCTCCTGAAGGACCTGCCTGGGG - Intronic
928437542 2:31265143-31265165 CCTCCTGAAGGGCCTGCCTGAGG + Intronic
929091742 2:38224308-38224330 GTTCGAGAAGTGCTTGCCTGAGG + Intergenic
929219257 2:39446662-39446684 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
930892808 2:56410824-56410846 CTTCCTGAAGGACCTACCTGAGG + Intergenic
931423244 2:62147352-62147374 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
932585725 2:73027095-73027117 CCCCCTGAAGGGCCTGCCTGAGG - Intronic
933410119 2:81914992-81915014 CTTCCTGAAGGGTCTGCCTGAGG + Intergenic
933592458 2:84247910-84247932 GTTGGAGAAGGGCTGGCCTGAGG - Intergenic
934179993 2:89611678-89611700 GTGCCCGATGGGGCTGCCTGGGG - Intergenic
934290288 2:91685939-91685961 GTGCCCGATGGGGCTGCCTGGGG - Intergenic
934321108 2:91972846-91972868 CTTCCTGAAGGACCTGCCTGAGG - Intergenic
934510287 2:94933577-94933599 GCTTCAGAAGGGCCTGCTTTGGG + Intergenic
935221411 2:101017234-101017256 GCGCCTGAAGGACCTGCCTGAGG + Intronic
935620344 2:105124730-105124752 GCTCCAGCAGCGCCTGCTTGGGG + Intergenic
935716249 2:105941664-105941686 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
935818680 2:106871805-106871827 CCTCCTGAAGGACCTGCCTGGGG + Intronic
935828090 2:106971678-106971700 CTTCCTGAAGGACCCGCCTGAGG + Intergenic
935862397 2:107347379-107347401 GTTCCAGAAACACCTGACTGGGG + Intergenic
936047416 2:109198168-109198190 GTTCCAGAAGGTCCCTGCTGTGG - Intronic
936234008 2:110727793-110727815 CTTCCTGAAGGACCTGCATGAGG + Intergenic
936579549 2:113685902-113685924 TCTCCTGAAGGACCTGCCTGAGG - Intergenic
936788586 2:116124201-116124223 GCCCCAGAAGGGACTGTCTGGGG - Intergenic
936834431 2:116690283-116690305 TCTCCTGAAGGACCTGCCTGAGG + Intergenic
937216893 2:120318651-120318673 GTTCCAGAGGGGCAAGGCTGTGG - Intergenic
937262396 2:120595014-120595036 CTTCCAGAAGGGCGGGACTGTGG - Intergenic
937310147 2:120897072-120897094 GTTCCCCATGGGGCTGCCTGCGG + Intronic
937482136 2:122272771-122272793 ATTCCAGAAGCCCCTCCCTGGGG - Intergenic
937627570 2:124060575-124060597 GGTGGAGAAGGGCCTGCCAGTGG + Intronic
937682701 2:124661535-124661557 TCCCCCGAAGGGCCTGCCTGAGG + Intronic
937725587 2:125161389-125161411 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
938123375 2:128650420-128650442 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
938291467 2:130152980-130153002 GTTCTAGATGCTCCTGCCTGGGG - Intronic
939037664 2:137151573-137151595 CCTCCTGAAGGACCTGCCTGAGG + Intronic
939330226 2:140749694-140749716 CCTCCTGAAGGACCTGCCTGAGG + Intronic
939694593 2:145308883-145308905 ATGCCTGAAGGACCTGCCTGAGG - Intergenic
940038597 2:149335166-149335188 CCTCCTGAAGGACCTGCCTGAGG - Intronic
940066076 2:149631396-149631418 GTTCCTGAAGGACCTGCCTGAGG + Intergenic
940234259 2:151492654-151492676 GGACCAGAAGGGCCCGCCAGTGG + Intronic
940283638 2:152012130-152012152 CCTCCAGAAGGACCTGCCTGAGG - Intronic
940354691 2:152727052-152727074 CCTCCTGAAGGACCTGCCTGAGG - Intronic
942049155 2:172122533-172122555 CTTCCTGAAGGACCTGCCTGAGG - Intergenic
942208809 2:173650157-173650179 GTAGCAGAAGAGCCTCCCTGTGG + Intergenic
942249493 2:174035199-174035221 GTTTCAGAAGGTGCTGCCTATGG - Intergenic
942264832 2:174212885-174212907 GCTCCGGAAGGACCTGCCTGAGG + Intronic
942359225 2:175154436-175154458 CCTCCTGAAGGACCTGCCTGAGG + Intronic
942493507 2:176513782-176513804 GCTCCTGAAGGACCTGCCTGAGG + Intergenic
942631468 2:177954661-177954683 ATTCCAGAATGGCCTTACTGGGG - Intronic
942913344 2:181272673-181272695 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
943769316 2:191697963-191697985 CTTCCTGAAGGACCTGCCTGAGG + Intergenic
946385130 2:219379281-219379303 GCTCCTAAAGGACCTGCCTGAGG - Intronic
946455782 2:219824910-219824932 GTTCTAGGAGGGCTTTCCTGAGG + Intergenic
946941627 2:224775355-224775377 CTTCCAGATGTGCCTGGCTGTGG + Intronic
947038122 2:225883312-225883334 CCTCCAGAAGGACCTGCCTGAGG - Intergenic
947159270 2:227195723-227195745 TCTCCTGAAGGACCTGCCTGAGG - Intronic
947835757 2:233174098-233174120 CCTCCTGAAGGACCTGCCTGAGG + Intronic
948925028 2:241090383-241090405 CCTCCTGAAGGACCTGCCTGAGG + Intronic
1169057874 20:2638520-2638542 GCTCCTGAAGGACCTGCCTGAGG - Intronic
1169353243 20:4887161-4887183 GTTGTTGAAGGGCATGCCTGTGG - Intronic
1170253288 20:14310656-14310678 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1170515463 20:17125196-17125218 CTTCCTGAAGGACCTGCCTGAGG + Intergenic
1171986729 20:31665990-31666012 GTTCCTGACGGGCATGACTGTGG - Exonic
1172738314 20:37145773-37145795 CCTCCTGAAGGGCCTGCCTGGGG + Intronic
1172744410 20:37195434-37195456 GCTCCAGAAGAGCCTGGCTCTGG - Intronic
1172867081 20:38108510-38108532 GTTGCATAAGAGCCTGCCTCTGG - Intronic
1173194538 20:40903452-40903474 GTTCCAGGAGGGCCTCTCTGTGG + Intergenic
1174535521 20:51248309-51248331 TGTCCTGAAGGGCCAGCCTGGGG + Intergenic
1174670021 20:52298313-52298335 GTTCCAGATTGGTATGCCTGTGG - Intergenic
1175843078 20:62042810-62042832 CTTCCTGAAGGACCTGCCTGAGG - Intronic
1175851926 20:62098218-62098240 GTTGGGGAGGGGCCTGCCTGGGG + Intergenic
1175883325 20:62273051-62273073 CTGCCAGAAGGGCCTGGCTCCGG + Intronic
1178458248 21:32776174-32776196 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
1178946807 21:36955095-36955117 GCTCCTGAAGGACCTGCCTCAGG - Intronic
1179033714 21:37742034-37742056 TTTCCATCAGGGCATGCCTGAGG - Intronic
1179115211 21:38485038-38485060 CTTCTTGAAGGACCTGCCTGAGG - Intronic
1179252204 21:39680642-39680664 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1179580700 21:42342047-42342069 CCTCCTGAAGGGCCCGCCTGAGG + Intergenic
1180157383 21:45984106-45984128 CTTCCAGGAGGGCCGGCCTCAGG + Intronic
1180238639 21:46482586-46482608 GCTCACGAAGGGTCTGCCTGAGG - Intronic
1180309350 22:11156818-11156840 CTTCCTGAAGGACCTGCCTGAGG - Intergenic
1180547827 22:16518629-16518651 CTTCCTGAAGGACCTGCCTGAGG - Intergenic
1181468638 22:23124729-23124751 GTCCCAGCAGGGCCTCCCTCAGG - Exonic
1181968276 22:26671599-26671621 GCTCCAGAAGGCTCTGCCTATGG + Intergenic
1182211630 22:28681740-28681762 CTTCCTGAAGGACCTGCCTGAGG + Intergenic
1182243474 22:28935953-28935975 GCACCAGAAGAGCCTGCCAGAGG - Intronic
1182458579 22:30468672-30468694 GATCCAGAAGTACATGCCTGGGG - Exonic
1182520287 22:30881133-30881155 GATGCAGAGGGGCCGGCCTGGGG - Intronic
1182869233 22:33631642-33631664 CCTCCTGAAGGACCTGCCTGAGG + Intronic
1183061114 22:35336852-35336874 GTCCCTGAAGGCCATGCCTGTGG - Intronic
1183291339 22:37003662-37003684 GTACCAGAAGGGCAGGGCTGTGG - Intronic
1184159982 22:42692333-42692355 GGCCCAGAAGTGCCAGCCTGGGG - Exonic
1184474747 22:44714412-44714434 GCTCCAGCAGGGCCGGGCTGGGG + Intronic
1185180900 22:49362537-49362559 CCTCCAGGAGGCCCTGCCTGCGG - Intergenic
949510412 3:4761989-4762011 ATTCCAGAAGGCCCTCCCTGAGG + Intronic
951527392 3:23666766-23666788 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
951561698 3:23974050-23974072 TCTCCTGAAGGACCTGCCTGAGG + Intronic
952976098 3:38697843-38697865 GATCCAGATGGACCTGCCTTTGG - Exonic
953517556 3:43610314-43610336 CCTCCTGAAGGACCTGCCTGAGG + Intronic
953819786 3:46196699-46196721 CCTCCCGAAGGACCTGCCTGAGG - Intronic
954895655 3:53972840-53972862 GTTCCAGAAAGGCCTCTCTGAGG - Intergenic
954975835 3:54693585-54693607 CCTCCTGAAGGACCTGCCTGAGG - Intronic
955138437 3:56244423-56244445 CTTCCTGAGGGACCTGCCTGAGG - Intronic
956107812 3:65839434-65839456 CTTCCTGAAGGACCTGCTTGAGG - Intronic
956139636 3:66132429-66132451 CTTCCTGAAGGACCTGCCTGAGG - Intergenic
956189038 3:66590835-66590857 GTCCCAGAAAGGCCTCTCTGAGG - Intergenic
956247069 3:67195834-67195856 ACTCCTGAAGGGCCTGCCTGAGG - Intergenic
956712872 3:72053624-72053646 CCTCCTGAATGGCCTGCCTGAGG - Intergenic
957268402 3:77997575-77997597 TTTCCTGAAGGACCTGCCTGAGG - Intergenic
957403242 3:79743921-79743943 CCTCCTGAAGGGCCTGCCTCAGG + Intronic
957552515 3:81725479-81725501 CCTCCTGAAGAGCCTGCCTGAGG + Intronic
957838644 3:85636130-85636152 CTTCCTGAAGGACTTGCCTGAGG - Intronic
958596125 3:96226107-96226129 GCTCCTGAAGGACCTGCCTGAGG - Intergenic
959060183 3:101609490-101609512 CTTCCTGAAGGACCTACCTGAGG - Intergenic
959396911 3:105852145-105852167 CCTCCTGAAGGGCCTGCCTGAGG - Intronic
959652587 3:108765726-108765748 CTTCCTGAAGGACCTGCCTGAGG + Intergenic
960091163 3:113639943-113639965 ACTCCTGAAGGACCTGCCTGAGG + Intergenic
960138278 3:114127485-114127507 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
960357052 3:116666385-116666407 CCTCCCGAAGGACCTGCCTGAGG + Intronic
960458803 3:117907330-117907352 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
960560965 3:119083892-119083914 GCTCCTGAAAGGCCTGTCTGAGG - Intronic
961114013 3:124313332-124313354 GTTCCCTAAAGGCCTGCCTTAGG - Intronic
961204556 3:125071274-125071296 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
961345058 3:126258898-126258920 CCTGCAGAAGGGCTTGCCTGAGG - Intergenic
961398275 3:126613910-126613932 CCTCCTGAAGGACCTGCCTGAGG - Intronic
961616992 3:128190204-128190226 CATCCTGAAGGACCTGCCTGAGG - Intronic
962089172 3:132224902-132224924 CCTCCTGAAGGACCTGCCTGAGG - Intronic
962208406 3:133455081-133455103 CCTCCTGAAGGACCTGCCTGAGG + Intronic
962256652 3:133874998-133875020 CCTCCTGAAGGACCTGCCTGAGG + Intronic
962539861 3:136370172-136370194 CCTCCTGAAGGACCTGCCTGAGG - Intronic
962614563 3:137111982-137112004 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
963216026 3:142749411-142749433 TTTCCTGAAGGAACTGCCTGAGG - Intronic
963886523 3:150588900-150588922 CCTCCTGAAGGGCATGCCTGAGG - Intronic
964201950 3:154127560-154127582 CCTCCTGAAGGACCTGCCTGAGG + Intronic
964229450 3:154446853-154446875 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
964600423 3:158494894-158494916 CCTCCAAAAGGCCCTGCCTGAGG + Intronic
964749859 3:160044260-160044282 CCTCCTGAAGGGCCTGCCTGAGG - Intergenic
965011986 3:163106221-163106243 CCTCCTGAAAGGCCTGCCTGAGG + Intergenic
966499064 3:180617418-180617440 TCTCCTGAAGGACCTGCCTGAGG - Intronic
968193795 3:196690477-196690499 TCTCCCGAAGGGTCTGCCTGCGG + Intronic
968255722 3:197269043-197269065 CCTCCTGAAGGGCCTGCCTGAGG + Intronic
969433328 4:7168772-7168794 GTTCCAAAAGGGACTGACTCAGG - Intergenic
969829286 4:9781952-9781974 GTGCCCGATGGGGCTGCCTGGGG + Exonic
970797625 4:19932722-19932744 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
970845909 4:20537055-20537077 CCTCCGGAAGGACCTGCCTGAGG + Intronic
970889060 4:21021759-21021781 CCTCCTGAAGGGCCTCCCTGAGG + Intronic
971116623 4:23654146-23654168 CTTCCTAAAGGGCCTGCCTGAGG + Intergenic
971383682 4:26123889-26123911 CTTCCAGAAGTACCTTCCTGAGG + Intergenic
971390730 4:26182978-26183000 CCTCCTGAAGGACCTGCCTGAGG + Intronic
971791289 4:31173071-31173093 CTTTCTGAAGGACCTGCCTGAGG - Intergenic
972272675 4:37526890-37526912 CCTCCTGAAGGACCTGCCTGAGG - Intronic
972484304 4:39527505-39527527 AATCCAGGAGGGCCTGGCTGCGG - Exonic
973561971 4:52146015-52146037 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
973952449 4:56030223-56030245 CTTCCTGAAGGACCTGCCTGAGG + Intronic
975564718 4:75742070-75742092 CTTCTTGAAGGACCTGCCTGAGG + Intronic
975601893 4:76109434-76109456 GCTCCTGAAGGACCTGCCTCAGG + Intronic
976002895 4:80392926-80392948 TTTCCTGAAGGACCTGCCTGAGG - Intronic
976459890 4:85298002-85298024 TGTCCTGAAGGGCCTGCCTGAGG + Intergenic
976896154 4:90114751-90114773 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
977412266 4:96683113-96683135 CTTCCAGACATGCCTGCCTGTGG - Intergenic
977658379 4:99551699-99551721 TCTCCTGAAGGACCTGCCTGAGG - Intronic
977676358 4:99752273-99752295 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
977841013 4:101704701-101704723 CCTCCTGAAGGACCTGCCTGAGG + Intronic
978640078 4:110860161-110860183 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
978854384 4:113376990-113377012 CCTCCTGAAGGACCTGCCTGAGG + Intronic
979194728 4:117906920-117906942 TCTCCTGAAGGACCTGCCTGAGG - Intergenic
979504048 4:121474342-121474364 CTTCCCAAAGGACCTGCCTGAGG + Intergenic
980158082 4:129130943-129130965 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
980433189 4:132730792-132730814 TCTCCTGAAGGACCTGCCTGAGG + Intergenic
980515571 4:133854175-133854197 CCTCCAGAAGGACCCGCCTGAGG - Intergenic
981041146 4:140223332-140223354 CTTCCTGAAGGACATGCCTGAGG + Intergenic
981811323 4:148778961-148778983 TCTCCTGAAGGACCTGCCTGAGG + Intergenic
982252137 4:153417777-153417799 CCTCCCGAAGGACCTGCCTGGGG + Intergenic
983014013 4:162586940-162586962 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
983591732 4:169420279-169420301 CCTCCTGAAGGACCTGCCTGAGG + Intronic
983688431 4:170438224-170438246 GTTCTAGAAGGGTCTGTGTGAGG - Intergenic
984046644 4:174808593-174808615 CCTCCTGAAGGACCTGCCTGAGG - Intronic
984868641 4:184307918-184307940 CCTCCTGATGGGCCTGCCTGAGG + Intergenic
985138079 4:186809316-186809338 CCTCCTGAAGGGCCTGCCTGAGG + Intergenic
985235952 4:187874488-187874510 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
986894856 5:12353337-12353359 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
987593210 5:19960511-19960533 TCTCCTGAAGGACCTGCCTGAGG + Intronic
987857189 5:23435736-23435758 CTTCCTGAAGGACCTGCCTGAGG - Intergenic
987987545 5:25167664-25167686 TCTCCTGAAGGACCTGCCTGAGG + Intergenic
989037498 5:37191003-37191025 ACTCCTGAAGGACCTGCCTGAGG - Intronic
989175286 5:38518760-38518782 CCTCCTGAAGGACCTGCCTGAGG - Intronic
990057229 5:51598402-51598424 CCTCCTGAAGGGCCTGCCTAAGG - Intergenic
991984853 5:72274530-72274552 CCTCCTGAAGGACCTGCCTGAGG + Intronic
992065401 5:73103145-73103167 CTTCCAGAAGGAACTGCCTAAGG + Intergenic
992407972 5:76477684-76477706 CCTCCAAAAGGGCCTGCCTGGGG - Intronic
992501025 5:77344071-77344093 CCTCCTGAAGGACCTGCCTGAGG + Intronic
993639654 5:90386979-90387001 GTTCCAGCAGTGTCAGCCTGGGG + Intergenic
994090029 5:95801746-95801768 GTTCCAGGCCAGCCTGCCTGAGG - Intronic
995757144 5:115518590-115518612 CATCCTGAAGGACCTGCCTGAGG - Intergenic
995900241 5:117057187-117057209 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
997390436 5:133510729-133510751 CTTCCAGAAAGGACTCCCTGGGG - Intronic
998212757 5:140213074-140213096 TCTCCTGAAGGACCTGCCTGAGG - Intronic
998397728 5:141829854-141829876 TTTCCAGATGGGCCAGTCTGAGG - Intergenic
998791502 5:145770532-145770554 CCTCCTGAAGGACCTGCCTGAGG - Intronic
999077582 5:148811515-148811537 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
999215219 5:149928028-149928050 TCTCCTGAAGGACCTGCCTGAGG + Intronic
1000425841 5:161090632-161090654 CCTCCAGAAAGACCTGCCTGAGG + Intergenic
1000709291 5:164550735-164550757 CTGCCTGAAGGACCTGCCTGAGG + Intergenic
1001225290 5:169939402-169939424 TGTCCTGAAGGACCTGCCTGAGG + Intronic
1001314230 5:170631391-170631413 GTTCCTGAAGCCCCTTCCTGGGG - Intronic
1001361547 5:171091001-171091023 GTTCCAGAAGGGACTCTGTGAGG - Intronic
1001398846 5:171434943-171434965 GGTCCAGGAAGGCCTGCTTGAGG + Intronic
1001752429 5:174141876-174141898 GTTCCAGAAAGGGCTGTCTTGGG + Intronic
1002043366 5:176529632-176529654 GGTTCAGGAGGGCCTGCATGCGG + Exonic
1002282974 5:178143954-178143976 GTTCCAGCAGGCGCTGCCTGTGG - Exonic
1002868258 6:1143199-1143221 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1003235318 6:4290233-4290255 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1003996493 6:11546053-11546075 GCTCCTGAAGGATCTGCCTGAGG - Intronic
1004524714 6:16396059-16396081 CCTCCAGAGGGACCTGCCTGAGG - Intronic
1004578643 6:16925328-16925350 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
1004587698 6:17018124-17018146 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1004891297 6:20103125-20103147 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1005047800 6:21658677-21658699 GTTCTAGAAGGGCTTCCCTTAGG + Intergenic
1005105067 6:22215161-22215183 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1005343117 6:24862194-24862216 GCAGCAGAAGGGCCTCCCTGGGG - Intronic
1005897283 6:30189063-30189085 GTTGCAAAAGGGGCTACCTGGGG + Intronic
1006441964 6:34058640-34058662 TTTCCTGAAGAGTCTGCCTGGGG - Intronic
1006729415 6:36225195-36225217 GTGCCCAAAAGGCCTGCCTGTGG - Intronic
1006754676 6:36404988-36405010 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1006794300 6:36722054-36722076 GGTGCAGGAGGGCCTTCCTGAGG + Exonic
1007020049 6:38510891-38510913 CCTCCTGAAGGACCTGCCTGAGG + Intronic
1008001880 6:46369260-46369282 CCTCCTGAAGGACCTGCCTGAGG + Intronic
1009410698 6:63362127-63362149 TTCCCTGAAGGACCTGCCTGAGG + Intergenic
1009979551 6:70711052-70711074 CCTCCTGAAGGGCCTACCTGAGG + Intronic
1010822763 6:80434716-80434738 GTTCCCGAAGGTACTGCCTTAGG - Intergenic
1011345389 6:86364301-86364323 GCTCCAAAAGGACTTGCCTGAGG + Intergenic
1011456764 6:87558874-87558896 TCTCCTGAAGGACCTGCCTGAGG - Intronic
1011763199 6:90590683-90590705 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1012146467 6:95690030-95690052 CTTCTAGAAGGACCTGCCTCAGG - Intergenic
1012152477 6:95771783-95771805 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1013411017 6:109883362-109883384 CTTCCTGAAGGTCCTGCCTGAGG + Intergenic
1013968016 6:115979134-115979156 GCTCCTGAAGAACCTGCCTGAGG - Intronic
1014052920 6:116976746-116976768 TCTCCTGAAGGACCTGCCTGAGG - Intergenic
1014142313 6:117957940-117957962 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1014321163 6:119929780-119929802 CCTCCTGAAGAGCCTGCCTGAGG + Intergenic
1014579409 6:123117965-123117987 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1014928125 6:127299233-127299255 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1015028913 6:128570489-128570511 GTTCCAGAGGGGCATGCCCTTGG + Intergenic
1015043715 6:128753603-128753625 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1015696124 6:135981726-135981748 CCTCCTGAAGGACCTGCCTGAGG + Intronic
1015914077 6:138197333-138197355 CCTCCTGAAGGACCTGCCTGAGG + Intronic
1015974746 6:138778526-138778548 GTTCCAAAAAGGCCTTCCTGAGG + Intronic
1016262545 6:142189498-142189520 ATTCCAACAGGGCCTGCTTGAGG - Exonic
1016522148 6:144958226-144958248 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
1016635848 6:146289140-146289162 ACTCCTGAAGGACCTGCCTGAGG - Intronic
1016716763 6:147241987-147242009 TTTCCTGAAGGACCTGCCTGAGG - Intronic
1016891864 6:149015057-149015079 GTTCCAGAGAGTCCTTCCTGAGG - Intronic
1017599536 6:156065466-156065488 CCTCCCGAAGGACCTGCCTGAGG - Intergenic
1017600904 6:156080065-156080087 CCTCCTGAAGGGTCTGCCTGAGG - Intergenic
1017669266 6:156754680-156754702 CCTCCTGAAGGGCCTGCCTGAGG - Intergenic
1018041601 6:159928875-159928897 CCTCCTGAAGGGCCTGCCTGAGG - Intergenic
1018702250 6:166436501-166436523 GGACCAGAAGGGGCTGCATGGGG + Intronic
1018897203 6:168028016-168028038 GTTCCAGAAGAACCCCCCTGTGG + Intronic
1019099077 6:169612674-169612696 CTTCCTGCAGGACCTGCCTGAGG + Intronic
1019583279 7:1780216-1780238 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1020156404 7:5728200-5728222 TCTCCAGAAGGGCCACCCTGAGG - Intronic
1020259269 7:6521539-6521561 GGCCCAGGAGGGCCTGACTGGGG + Intronic
1020832224 7:13106992-13107014 TTTCCTGAAGGACCTGCCTGAGG - Intergenic
1021696539 7:23281779-23281801 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1022151790 7:27615815-27615837 CCTCCTGAAGGACCTGCCTGGGG - Intronic
1022666078 7:32412073-32412095 CTTCCTGAAGGACCTGCTTGAGG + Intergenic
1023223630 7:37946599-37946621 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1023248094 7:38228344-38228366 GATCCAGAAGGGCCAGACTGTGG + Intronic
1023262938 7:38376486-38376508 CCTACTGAAGGGCCTGCCTGAGG - Intergenic
1023308683 7:38858905-38858927 CCTCCAGAAGGACCTGCCTGAGG - Intronic
1024269371 7:47630644-47630666 CTTCCTGAAGGGCCTGCCTGGGG - Intergenic
1024784841 7:52895511-52895533 GGAGCTGAAGGGCCTGCCTGAGG - Intergenic
1026903852 7:74051606-74051628 TCTCCAGATGGGCCTGTCTGGGG - Intronic
1027008124 7:74714850-74714872 GTTTCAGAAGGGCCTGCTTTGGG - Intronic
1027329909 7:77081299-77081321 CTTCCTGAAGGACTTGCCTGAGG - Intergenic
1027344513 7:77243706-77243728 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1028636597 7:92996379-92996401 CTTCCTGAAGGACTTGCCTGAGG + Intergenic
1028977238 7:96927561-96927583 CCTCCTGAAGGGCCTGCCTGAGG - Intergenic
1030276898 7:107731123-107731145 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
1030471190 7:109964426-109964448 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
1030707645 7:112711180-112711202 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1031191923 7:118563727-118563749 CTTCCCAAAGGACCTGCCTGAGG - Intergenic
1031634732 7:124088519-124088541 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
1032094066 7:128928968-128928990 CTTCCACAGGGGCCTGACTGAGG + Intergenic
1032099334 7:128960363-128960385 CCTCCCGAAGGACCTGCCTGAGG - Intronic
1032578757 7:133083504-133083526 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
1032627157 7:133604204-133604226 CCTCCTGAAGGACCTGCCTGAGG + Intronic
1032890472 7:136189791-136189813 GTTGGAGCAGGGCCTGCCTCTGG - Intergenic
1033020879 7:137723153-137723175 GTTCCATGAAGGCCTCCCTGAGG - Intronic
1033429635 7:141277501-141277523 CCTCCTGAAGGACCTGCCTGAGG + Intronic
1033480618 7:141736747-141736769 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1034092092 7:148373106-148373128 GCTCCTGAAGGACCTGCCTGAGG + Intronic
1034165484 7:149022006-149022028 GTTACTGAAGGCCCTGCCTGTGG - Intronic
1034373212 7:150619102-150619124 GCTCCTGAAGAACCTGCCTGAGG + Intergenic
1034609315 7:152351126-152351148 GCTCCTGAAGGTTCTGCCTGAGG + Intronic
1035917058 8:3636274-3636296 CCTCCTGAAGGCCCTGCCTGAGG + Intronic
1036021236 8:4848969-4848991 CTTCCTGAAGGACCTGCCTGAGG - Intronic
1036444974 8:8813376-8813398 CCTCCCGAAGGGCCTGCCTGAGG - Intronic
1036591923 8:10176226-10176248 GTTTCAGGAGAGCCTGCCTGTGG + Intronic
1037035110 8:14156893-14156915 CCTCCTGAAGGACCTGCCTGAGG + Intronic
1037248259 8:16862317-16862339 GTTCCTGAGGGACCTGCCTGGGG - Intergenic
1037458989 8:19090242-19090264 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1037867173 8:22454402-22454424 CTTCCTGAAGGACCTGTCTGGGG + Intronic
1037868886 8:22472549-22472571 CCTCCTGAAGGACCTGCCTGAGG + Intronic
1037870744 8:22493740-22493762 CCTCCTGAAGGACCTGCCTGGGG + Intronic
1038019734 8:23542717-23542739 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1038220732 8:25604653-25604675 GTTACAGAAGGGCCAGACTCAGG + Intergenic
1038371914 8:27002689-27002711 TTTCCTGAAGGACCTGCCTGAGG - Intergenic
1038710148 8:29936261-29936283 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1038834414 8:31103193-31103215 CCTCCTGAAGGACCTGCCTGAGG + Intronic
1038922898 8:32104869-32104891 CCTCCTGAAGGACCTGCCTGAGG + Intronic
1039116632 8:34098568-34098590 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1039305918 8:36262715-36262737 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1040004384 8:42607183-42607205 TCTCCTGAAGGACCTGCCTGAGG + Intergenic
1040322782 8:46327013-46327035 GTCTCACAAAGGCCTGCCTGTGG + Intergenic
1040449633 8:47531383-47531405 TATCCTGAAGGACCTGCCTGAGG + Intronic
1040764120 8:50886098-50886120 CTTCCTGAAGGACCTTCCTGAGG + Intergenic
1040896263 8:52372012-52372034 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1040902858 8:52434889-52434911 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1041141799 8:54828112-54828134 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
1041193601 8:55377829-55377851 TTTCCAGAAGTGCCTTTCTGGGG - Intronic
1041785690 8:61630837-61630859 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1041861802 8:62522492-62522514 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1041994216 8:64033794-64033816 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1042543360 8:69929015-69929037 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1042660247 8:71146824-71146846 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1043061474 8:75509976-75509998 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1043142069 8:76603001-76603023 GTTCCAGAAGTACCAGGCTGTGG - Intergenic
1043278651 8:78435117-78435139 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
1044189678 8:89300256-89300278 CTTCCTGAAGGACTTGCCTGAGG - Intergenic
1044517994 8:93162090-93162112 ACTCCTGAAGGACCTGCCTGAGG - Intronic
1044538047 8:93380255-93380277 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1044733899 8:95257880-95257902 CCTCCCGAAGGACCTGCCTGAGG - Intronic
1044845830 8:96380047-96380069 CCTCCTGAAGGACCTGCCTGGGG + Intergenic
1044892844 8:96855547-96855569 GTATCAGAAAGGCCTCCCTGGGG - Intronic
1045196548 8:99937239-99937261 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1046104501 8:109649447-109649469 GTTCAAGCATGGCCTGCCTCAGG - Intronic
1046116334 8:109788694-109788716 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1047384956 8:124400490-124400512 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
1048346505 8:133579642-133579664 CATCCTGAAGGTCCTGCCTGAGG + Intergenic
1048751686 8:137684238-137684260 TCTCCTGAAGGACCTGCCTGAGG + Intergenic
1048999155 8:139813722-139813744 GCTGCAGAATGGGCTGCCTGGGG + Intronic
1049394294 8:142391988-142392010 CCTCCTGAAGGCCCTGCCTGAGG + Intronic
1049640473 8:143712892-143712914 GGTCCAGGTGGGCCTGCATGGGG + Intronic
1049755293 8:144308817-144308839 GTTTCAGAAGGGGCGGCCTGGGG + Intronic
1049987234 9:962602-962624 GGTCCAGGAGGGCCTGGGTGGGG + Intronic
1051046222 9:12877478-12877500 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1051263900 9:15292559-15292581 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1053655105 9:40210765-40210787 GTTTCAGAAGGGCCTGCTTTGGG - Intergenic
1053905487 9:42839977-42839999 GTTTCAGAAGGGCCTTCTTTGGG - Intergenic
1054367220 9:64356981-64357003 GTTTCAGAAGGGCCTGCTTTGGG - Intergenic
1054529494 9:66165549-66165571 GTTTCAGAAGGGCCTGCTTTGGG + Intergenic
1054674851 9:67846718-67846740 GTTTCAGAAGGGCCTGCTTTGGG - Intergenic
1054978499 9:71176179-71176201 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1055630410 9:78217844-78217866 CTTTCTGAAGGTCCTGCCTGAGG + Intergenic
1055641692 9:78323918-78323940 CTTTCAGAGGGGCCTGACTGTGG + Intronic
1055991222 9:82108095-82108117 CTTCCTGAAGGATCTGCCTGAGG - Intergenic
1056031754 9:82560719-82560741 CTCCTCGAAGGGCCTGCCTGGGG - Intergenic
1056242524 9:84662539-84662561 CTTCCTGAAGGATCTGCCTGAGG + Intergenic
1056432030 9:86537385-86537407 CCTCCTGAAGGGCCTGCCTGAGG - Intergenic
1056645126 9:88405070-88405092 CCTCCTGAAGGACCTGCCTGAGG + Intronic
1056816990 9:89809032-89809054 ACTGCACAAGGGCCTGCCTGAGG - Intergenic
1056902350 9:90611701-90611723 GTCCCACGTGGGCCTGCCTGGGG - Exonic
1058172482 9:101699337-101699359 CCTCCTGAAGGACCTGCCTGAGG + Intronic
1058662372 9:107278344-107278366 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1059951509 9:119467526-119467548 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1060011564 9:120047797-120047819 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
1060194278 9:121613127-121613149 GCTGCAGAAGGACCTGCCTGAGG - Intronic
1060868367 9:127018269-127018291 CTTCCGGAAGGACCTGCCTGAGG + Intronic
1061230929 9:129315470-129315492 AGTCCAGAAGGGCCTGACTCAGG - Intergenic
1061400442 9:130365443-130365465 TTTCCAGAAGCACGTGCCTGTGG - Intronic
1061644118 9:131985756-131985778 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1061790928 9:133058453-133058475 ATTCCAGAGGGGCCTGGCTGTGG - Exonic
1062049040 9:134437815-134437837 GTCCCACCAGGGCCTGCGTGTGG - Intronic
1062091584 9:134681226-134681248 GTTCTTGAAGGGCCGGGCTGAGG - Intronic
1185762586 X:2700146-2700168 GGTCCACAAGGCCGTGCCTGGGG - Intronic
1187773118 X:22724387-22724409 ACTCCTGAAGGACCTGCCTGAGG - Intergenic
1188966700 X:36562269-36562291 CTTCCTGAAGGCCCTGCTTGAGG + Intergenic
1189022265 X:37353056-37353078 CTTCCTGAAGGACCTGTCTGAGG - Intronic
1189132300 X:38512637-38512659 CCTCCTGAAGGACCTGCCTGAGG + Intronic
1189158250 X:38782331-38782353 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
1189428538 X:40926215-40926237 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1189965836 X:46371904-46371926 CTTCCTGAAGGATCTGCCTGAGG + Intergenic
1191598429 X:62974181-62974203 GCCCCAGAAGGGACTGTCTGTGG + Intergenic
1192344895 X:70294316-70294338 CCTCCTGAAGGACCTGCCTGAGG + Intronic
1192385110 X:70660670-70660692 CTTCCTGAAGGACCTGTCTGAGG + Intronic
1192423308 X:71053149-71053171 GTTCCACAAACGCCAGCCTGGGG - Intergenic
1192569760 X:72193346-72193368 CCTCCTGAAGGACCTGCCTGAGG - Intronic
1192710337 X:73576155-73576177 CTTCTAAAAGGGCCTGCCTGAGG + Intronic
1192784892 X:74325949-74325971 GATACAGAAAGGCCTGCCTCAGG - Intergenic
1193089641 X:77480653-77480675 TTTCCTAAAGGACCTGCCTGTGG + Intergenic
1193436413 X:81479228-81479250 GTTCCAGAACTTCCTGCTTGTGG + Intergenic
1194180817 X:90709973-90709995 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1194419316 X:93652830-93652852 CTTCCTGAAGGACATGCCTGAGG - Intergenic
1194586993 X:95747510-95747532 ACTCCTGAAGGACCTGCCTGAGG - Intergenic
1195058411 X:101169658-101169680 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1195501827 X:105610899-105610921 CCTCCAGAAAGACCTGCCTGAGG - Intronic
1195756280 X:108202150-108202172 GGTCAAGAAGGGCCTTTCTGAGG - Intronic
1195805102 X:108756784-108756806 CTTCCTGAAGGACTTGCCTGAGG + Intergenic
1197699858 X:129591184-129591206 GCTCTAGATGGGCCTGCCTGAGG - Exonic
1197863464 X:130994709-130994731 GTCCCAGGAGGGCTTGCCAGTGG - Intergenic
1197877961 X:131131520-131131542 CCTCCTGAAGGACCTGCCTGAGG + Intergenic
1198193453 X:134334818-134334840 TCTCCAGAAGGGCTTGCCTGAGG + Intergenic
1198231236 X:134691637-134691659 TTTCCAGAAGGGCCGTCCTAAGG - Intronic
1199270376 X:145875418-145875440 ATTCCTGAAGGACCGGCCTGTGG - Intergenic
1200063937 X:153495953-153495975 GTCCCAGAGGGGCCTGCCAAGGG + Intronic
1200527479 Y:4292129-4292151 CCTCCTGAAGGACCTGCCTGAGG - Intergenic
1201188595 Y:11427968-11427990 CTTCCTGAAGGACCTGCCTGAGG - Intergenic