ID: 1141504428

View in Genome Browser
Species Human (GRCh38)
Location 16:84465298-84465320
Sequence GGTCAGAGTGGACCCCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141504424_1141504428 16 Left 1141504424 16:84465259-84465281 CCAGGGGTGGTAACAGCTGGGTC No data
Right 1141504428 16:84465298-84465320 GGTCAGAGTGGACCCCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141504428 Original CRISPR GGTCAGAGTGGACCCCTGCC AGG Intergenic
No off target data available for this crispr