ID: 1141506561

View in Genome Browser
Species Human (GRCh38)
Location 16:84482103-84482125
Sequence CACAGGAAGCAGGGGGAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 698
Summary {0: 1, 1: 2, 2: 7, 3: 55, 4: 633}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141506561_1141506570 2 Left 1141506561 16:84482103-84482125 CCCGCTTCCCCCTGCTTCCTGTG 0: 1
1: 2
2: 7
3: 55
4: 633
Right 1141506570 16:84482128-84482150 ATGTCACCAAGCTGAAGCGAGGG 0: 1
1: 0
2: 0
3: 10
4: 95
1141506561_1141506574 19 Left 1141506561 16:84482103-84482125 CCCGCTTCCCCCTGCTTCCTGTG 0: 1
1: 2
2: 7
3: 55
4: 633
Right 1141506574 16:84482145-84482167 CGAGGGCTGGACAGGAGCCACGG 0: 1
1: 0
2: 2
3: 34
4: 442
1141506561_1141506573 11 Left 1141506561 16:84482103-84482125 CCCGCTTCCCCCTGCTTCCTGTG 0: 1
1: 2
2: 7
3: 55
4: 633
Right 1141506573 16:84482137-84482159 AGCTGAAGCGAGGGCTGGACAGG 0: 1
1: 0
2: 1
3: 13
4: 205
1141506561_1141506571 6 Left 1141506561 16:84482103-84482125 CCCGCTTCCCCCTGCTTCCTGTG 0: 1
1: 2
2: 7
3: 55
4: 633
Right 1141506571 16:84482132-84482154 CACCAAGCTGAAGCGAGGGCTGG No data
1141506561_1141506569 1 Left 1141506561 16:84482103-84482125 CCCGCTTCCCCCTGCTTCCTGTG 0: 1
1: 2
2: 7
3: 55
4: 633
Right 1141506569 16:84482127-84482149 CATGTCACCAAGCTGAAGCGAGG 0: 1
1: 0
2: 0
3: 6
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141506561 Original CRISPR CACAGGAAGCAGGGGGAAGC GGG (reversed) Intronic
900310818 1:2032428-2032450 CCCAGGAAGCAGAGGGTAGGAGG - Intergenic
900320534 1:2081400-2081422 TGCAGGGAGCAGGGGGAAGCAGG + Intronic
900666247 1:3817424-3817446 GAGAGGAACCAGGGAGAAGCAGG - Intronic
900861040 1:5231581-5231603 CATAGGAAGCAGAAGGAAGAGGG + Intergenic
901216676 1:7559101-7559123 CTCAGGAAGGAGGCGGCAGCTGG + Intronic
901735194 1:11307985-11308007 GACAGGAGGCAGAGGGAAGAGGG - Intergenic
901853396 1:12029815-12029837 CACAGGCGGCAGGGGGTACCGGG - Exonic
902670032 1:17966804-17966826 GACAGAAAGCAGAGGAAAGCGGG - Intergenic
902847577 1:19123973-19123995 CACTGGCAGCAGGAGGAAGAAGG + Intronic
902919044 1:19655778-19655800 GGCAGGAAGCAGGAGGAGGCTGG - Intronic
902969647 1:20038017-20038039 CCAGGGAAGTAGGGGGAAGCTGG + Intronic
903053134 1:20616401-20616423 GGCAGGAAGCAGGAGGAAGATGG - Intronic
903299442 1:22368151-22368173 CACAGGTGGCAGGGGGCAGGTGG - Intergenic
903681689 1:25101833-25101855 CACAGGAAGGAGAGGGGAGGAGG - Intergenic
903742785 1:25567886-25567908 CCCAGGAAGTATGGGGAGGCGGG - Exonic
904576392 1:31507711-31507733 CCCAGGAGGCAGCCGGAAGCTGG + Intergenic
904628931 1:31827078-31827100 CCCAGGAAGCAGGAGTAAGGTGG + Intergenic
905382793 1:37575339-37575361 CACAGGATCCAAAGGGAAGCAGG - Intronic
905542094 1:38767939-38767961 CAAGGGAGGCAGAGGGAAGCTGG - Intergenic
906477586 1:46180423-46180445 TCCAGGCAGCAGGGGGCAGCAGG + Intronic
906819698 1:48916389-48916411 CACAGGGAGGAGAGGGAGGCGGG + Intronic
907034354 1:51203017-51203039 GACAGGAAACAGGTGGAAACAGG - Intergenic
907118330 1:51989174-51989196 TCCAGGAAGCCGGGGGAAGAGGG + Intronic
907340471 1:53731767-53731789 CACAGAAAGAATGGGGAAGAGGG - Intronic
907740754 1:57163437-57163459 CAGAGCAAGCAAGGGGAAGGGGG + Intronic
907865897 1:58398754-58398776 GACAGGAAGCAGAGGAAGGCTGG + Intronic
907881092 1:58549856-58549878 CACAGGCAGCTGGGTGATGCTGG + Intergenic
908702178 1:66913684-66913706 CACAGTAAGAAGGTGGAGGCCGG + Intronic
908885685 1:68786029-68786051 CACAGGAAACATTGGGAATCTGG + Intergenic
910589745 1:88918096-88918118 CACAGGAAGCATAGAAAAGCAGG - Intergenic
911070171 1:93826060-93826082 GACAGGAAGCAAGGGAAAGAGGG + Intronic
911452596 1:98083894-98083916 AATAGGAAGAAGGGGGAAGACGG - Intergenic
912186046 1:107276980-107277002 AAGAGGAAGCTGGGGGAGGCTGG + Intronic
912471497 1:109910280-109910302 CAGAGGAAGAAGGGGGCTGCCGG + Intronic
912491443 1:110064857-110064879 CAAGGGCAGCTGGGGGAAGCTGG + Exonic
912527412 1:110293917-110293939 CACACGAGGCAGGGGGGAGGGGG + Intergenic
913243944 1:116855228-116855250 CACAGGAAGCCTGGAGAATCTGG + Intergenic
913346815 1:117817950-117817972 CACAGGAAACTGGGACAAGCGGG - Intergenic
914425137 1:147569064-147569086 AACAGGTAGCTGGTGGAAGCAGG + Intronic
914916095 1:151820126-151820148 CAGGGGAAGGAGGGGGGAGCAGG - Intronic
915092008 1:153433097-153433119 CAAAGGACGCAGGAGGAACCAGG - Intergenic
915169699 1:153969122-153969144 GAGAGGATGCAGGGGGAAACTGG + Exonic
915290427 1:154879445-154879467 CACAGGAAGTACTGGGCAGCTGG + Intergenic
915591857 1:156875369-156875391 GACAGCAGGCAGGGGGAAGGGGG - Intronic
916172784 1:162013268-162013290 CACAGGAAGGAGAGGTCAGCTGG + Intronic
916502063 1:165395969-165395991 AAAAGGAAGGAGGGGGAAGAAGG - Intergenic
917513590 1:175688565-175688587 CCCAGGAAGCAGAGGGCAGTGGG + Intronic
917735060 1:177912718-177912740 CACAGGAATATGGGGGAAGAGGG + Intergenic
918511324 1:185316998-185317020 GATGGGAAGCAGGAGGAAGCGGG + Exonic
919071185 1:192756947-192756969 CAAAGGAAGCAGGAAGAAGATGG - Intergenic
919726414 1:200887642-200887664 CACAGAAAGCAGGGGGCTCCAGG + Intergenic
919740855 1:200980898-200980920 CAAAGGAAGCAGGGGTGAGTAGG + Intronic
919798018 1:201332858-201332880 AACATGAAGCAAGGGGAAGGTGG - Exonic
920365629 1:205446930-205446952 CACAGGAGGTCGGGGGGAGCGGG - Intronic
920561473 1:206941923-206941945 CGCTGTAAGCAGGAGGAAGCTGG + Intronic
920687046 1:208117327-208117349 CGCAGGAGGCAGAGCGAAGCAGG + Intronic
920724335 1:208419694-208419716 GAAAGGAAGCAGGATGAAGCAGG - Intergenic
921022658 1:211250365-211250387 CTCAGGAAGGAGGCTGAAGCAGG + Intergenic
922027028 1:221759891-221759913 CACAGGAAGCAGCCCCAAGCAGG - Intergenic
922408115 1:225339895-225339917 CAGAGGAGGAAGAGGGAAGCTGG - Intronic
922572914 1:226644355-226644377 CACAGGACGCTGGGGGAGGAGGG + Intronic
922582005 1:226705573-226705595 CCCAGGAAGCTTGGGGAAGGAGG - Intronic
922593899 1:226799048-226799070 CGCAGGATGCCGAGGGAAGCGGG - Intergenic
923272951 1:232373841-232373863 CACAGCACGCAGGGCCAAGCGGG + Intergenic
1063081990 10:2776054-2776076 CGAAGGAAGCAGGGGGGAGAAGG + Intergenic
1063623799 10:7671125-7671147 CAGAGGAAGGAGGGGGAACAAGG + Intergenic
1063978212 10:11433723-11433745 GACAGGAAGGGGCGGGAAGCTGG + Intergenic
1063978220 10:11433755-11433777 GACAGGAAGGGGCGGGAAGCTGG + Intergenic
1064221029 10:13440296-13440318 CCCAGGAAGCTGGGGGCATCAGG + Intronic
1064935347 10:20672921-20672943 CACAGGATTAAGGAGGAAGCAGG + Intergenic
1065976247 10:30845377-30845399 CCCAGGAAGCAAGGGGACTCAGG - Exonic
1066357890 10:34702449-34702471 CTCTGGAAGCATTGGGAAGCTGG - Intronic
1066582054 10:36891679-36891701 CACAGGATGGAGGGGCAGGCAGG - Intergenic
1067007413 10:42678111-42678133 CACAGGAACGTGGGGGAAGTAGG + Intergenic
1067105494 10:43363264-43363286 CACAGGCAGCAAGGGGCAGGGGG + Intergenic
1067455981 10:46419559-46419581 CACAGGCAGCAGGGGGGATGGGG - Intergenic
1067631219 10:47965080-47965102 CACAGGCAGCAGGGGGGATGGGG + Intergenic
1067683301 10:48453511-48453533 CACAGGCAGCAGGGCTCAGCAGG - Intronic
1067944896 10:50683277-50683299 CCCAGGAAGCAGGGATGAGCGGG + Intergenic
1068083522 10:52347436-52347458 CACAAGGAGCAGGGAGAACCAGG - Intergenic
1068137597 10:52965779-52965801 CACTGGGAGCAGGGAGAGGCCGG + Intergenic
1068329686 10:55546885-55546907 GAAAGGAAGCAGGAGGCAGCAGG + Intronic
1068661511 10:59627719-59627741 GACTGGAAGCAGGGGGAATAAGG - Intergenic
1069617833 10:69817582-69817604 CACAGGCAGCAGGGTAAAGCGGG - Intronic
1069824875 10:71248948-71248970 CACAGGAAGGAGTGGGGTGCAGG - Intronic
1069996137 10:72343263-72343285 CCCAGGAAGCAGGGAGCAGGAGG - Intronic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070570437 10:77636894-77636916 CGGAGGAAGCTGGGGGCAGCTGG - Intronic
1070826352 10:79392468-79392490 CACAGGAGGGAGGGAGAAGAGGG - Intronic
1070866397 10:79710148-79710170 CCCAGGAAGCAGGGATGAGCGGG + Intronic
1070880190 10:79848279-79848301 CCCAGGAAGCAGGGATGAGCGGG + Intronic
1071008499 10:80910986-80911008 CACAGGCAGCCAGTGGAAGCTGG + Intergenic
1071508264 10:86245866-86245888 CACAGGAAGCCAGGGAAGGCAGG + Intronic
1071524540 10:86350543-86350565 CACAGAAAGCAAAGTGAAGCAGG - Intronic
1071531297 10:86391991-86392013 GAGAGGGAGCAGAGGGAAGCAGG + Intergenic
1071633306 10:87232369-87232391 CCCAGGAAGCAGGGATGAGCGGG + Intronic
1071646755 10:87364587-87364609 CCCAGGAAGCAGGGATGAGCGGG + Intronic
1071718440 10:88119996-88120018 GCGAGGAAGGAGGGGGAAGCAGG + Intergenic
1071718462 10:88120049-88120071 AGCGGGAAGGAGGGGGAAGCAGG + Intergenic
1071718480 10:88120102-88120124 AGCAGGAACGAGGGGGAAGCAGG + Intergenic
1071718495 10:88120155-88120177 AGCAGGAACGAGGGGGAAGCAGG + Intergenic
1072686381 10:97539805-97539827 CACAGGGAGCAGGGAGAGACAGG - Intronic
1072691053 10:97572625-97572647 CCCAGGGAGCAGGGGGAGCCAGG - Exonic
1072717807 10:97763085-97763107 CACAGGCAGCCAGGGGAATCCGG - Intergenic
1072936792 10:99720838-99720860 AACAGGAAACAGGGTGAAGATGG + Intronic
1073117216 10:101098026-101098048 CTCAGGGAGCAATGGGAAGCAGG + Intronic
1073255844 10:102150766-102150788 AACAGGAAGCGTGGGGAAGAGGG + Intergenic
1074579714 10:114707570-114707592 CTCAGGAAGCCAGGGGCAGCAGG - Intergenic
1074853606 10:117457582-117457604 CTCAGGGACCAGGGGGAGGCAGG - Intergenic
1074925739 10:118068558-118068580 CACAGCAAATAGGGGGAAGGGGG - Intergenic
1075222974 10:120600648-120600670 CAGAGGAAGCAGAAGCAAGCCGG - Intergenic
1075469612 10:122678217-122678239 CACAGGGAGGAGAGGGAAGTAGG + Intergenic
1075557716 10:123445409-123445431 CACAGCAAGCATTGAGAAGCTGG - Intergenic
1075660020 10:124186999-124187021 AAGAGGATGCAGGTGGAAGCTGG - Intergenic
1075687061 10:124371555-124371577 CCCAGGAAGCACAGGGAAGATGG + Intergenic
1076382770 10:130036593-130036615 TACAGGAACCAGGTGGCAGCTGG - Intergenic
1076425990 10:130367997-130368019 CACCGGAACCTGGGAGAAGCCGG + Intergenic
1076568276 10:131413467-131413489 CACAGAAGTCAGGGGCAAGCAGG + Intergenic
1077230030 11:1454616-1454638 CACAGGGCGCTGGGGGAGGCGGG + Intronic
1077385172 11:2266145-2266167 CACAGGAAGGAGGTGGCAACGGG + Intergenic
1077459410 11:2701067-2701089 CACAGGAGGAAGGGGGAGGCTGG + Intronic
1077487606 11:2846210-2846232 CACAGGCAGCAGGCGGGAGCTGG - Intronic
1078002945 11:7512735-7512757 CACAGCCAGCAGGGGAAGGCTGG - Intergenic
1078069302 11:8097840-8097862 CCCAGGAAGCAGGCGGGAGTGGG + Intronic
1078145458 11:8719126-8719148 CTCAGGAAGCAGGCAGAAGAAGG + Intronic
1078246155 11:9574315-9574337 CCCAGGAAGTAGGGGGCCGCCGG - Exonic
1078461015 11:11515443-11515465 CAGAGAGAGCAGGGGGAATCGGG - Intronic
1078523993 11:12086714-12086736 CACAGGGAACACGGGGATGCTGG - Intergenic
1078559840 11:12361850-12361872 CAGAGGTGGCAGGGGGCAGCCGG + Intergenic
1078942200 11:16020112-16020134 CACAGGAAAGGAGGGGAAGCTGG - Intronic
1079336077 11:19572029-19572051 CCCAGGTAGCAGGGGGCAGATGG - Intronic
1079399002 11:20090738-20090760 CACAGGAAGCACCAGGCAGCTGG + Intronic
1079795573 11:24798709-24798731 AATGGCAAGCAGGGGGAAGCAGG - Intronic
1080409518 11:32010362-32010384 GACAGCAAGCAGGGGGAAAAGGG - Intronic
1080652504 11:34234055-34234077 CACCTGAAGCAGGGCCAAGCTGG + Intronic
1080786853 11:35483263-35483285 TGCAGGAAGCTGGGGGAAGGAGG - Intronic
1081625406 11:44652398-44652420 CACAGGATACAGGGGGTACCAGG + Intergenic
1081673370 11:44954255-44954277 CACAGGAACCTGGGAGCAGCAGG + Intergenic
1081705534 11:45180561-45180583 CGCAGGGAGCGGGAGGAAGCGGG - Intronic
1083126757 11:60576848-60576870 GGCAGGAAGCAAGGGGAAACTGG - Intergenic
1083137647 11:60693953-60693975 CACAGGAAGCATGAAAAAGCAGG + Intergenic
1083262153 11:61528988-61529010 CACAGGAAGCAGCTGGGAGGAGG + Intronic
1083324743 11:61867494-61867516 CAGAGGCAGCAGGGAGAGGCGGG - Intergenic
1083336113 11:61922824-61922846 AACAGGAAGCGGGTGGGAGCAGG - Intergenic
1083651329 11:64206558-64206580 CACAGGAAGCTAGGGAGAGCGGG - Intergenic
1083778080 11:64903813-64903835 GACAGCAGGCAGTGGGAAGCGGG + Intronic
1083990367 11:66242823-66242845 CACAGGAAGAAGGGGACAGTCGG + Intronic
1083997434 11:66279169-66279191 GACAGGAAGAGGAGGGAAGCTGG - Intronic
1084606702 11:70176690-70176712 GACAGGAAGCAGGGGGCGGGAGG - Intronic
1084661466 11:70548937-70548959 CACCGGGAGCAGGAAGAAGCTGG + Intronic
1084946829 11:72642889-72642911 CCTAGGAGGCAGGGGGAAGTCGG + Intronic
1085177669 11:74505040-74505062 GACAGGAAGCAGGGAGAGGAGGG + Intronic
1086196268 11:84143794-84143816 AGGAGGAAGCAGGGAGAAGCAGG + Intronic
1086370544 11:86151714-86151736 CACAGGAAGCTGCCTGAAGCTGG - Intergenic
1086926011 11:92641494-92641516 CACTGGAAGCTGGAGGAAGCAGG - Intronic
1087142067 11:94774370-94774392 CACAGGAGGCAGGAGGAGGTGGG + Intronic
1087170561 11:95045615-95045637 GAAAGGGAGGAGGGGGAAGCAGG - Intergenic
1088020296 11:105111251-105111273 CACAGAAAGCAAGGAAAAGCAGG + Intergenic
1088810489 11:113388391-113388413 CACAGGACACCGGGGGAAGAAGG - Intronic
1088880789 11:113971863-113971885 CACAACAGACAGGGGGAAGCTGG - Intergenic
1089111659 11:116062302-116062324 CACAAGAAGCGGAGGGAAGGAGG + Intergenic
1089139241 11:116273085-116273107 CACAGGGAGCAAAGGGAAGGAGG + Intergenic
1089219381 11:116858238-116858260 CACATGAACCAAGGGGATGCGGG - Exonic
1089356618 11:117858133-117858155 GATGGGAAGCAGGGGGACGCTGG - Intronic
1089642970 11:119859737-119859759 GACAGGAAGCATGGGGGAACAGG - Intergenic
1089836932 11:121379047-121379069 CCAAGGAAGTAGGGGAAAGCTGG - Intergenic
1090236900 11:125154903-125154925 CACAGGGAGGGTGGGGAAGCTGG - Intergenic
1090664991 11:128909016-128909038 CACATGAAGGAGCAGGAAGCAGG + Intronic
1091192191 11:133705438-133705460 GACAGGCGGGAGGGGGAAGCAGG - Intergenic
1091386811 12:101198-101220 CACAGGCAGCAGGGGAGTGCTGG - Intronic
1091636031 12:2197326-2197348 CACAAGATGCAGGGGGATGGGGG - Intronic
1092154742 12:6274786-6274808 CCCAGGAAGCAGGGCGAGGGCGG + Intergenic
1092793646 12:12090231-12090253 CAAAGGAAGAAGGGGAAAGAAGG + Intronic
1094871599 12:34602028-34602050 AACATGAAGCAGGGAGATGCAGG - Intergenic
1095679606 12:44958750-44958772 CACAGGTATCTGGGGGAAGATGG + Intergenic
1096168255 12:49444321-49444343 CACAGGAGGCAGGCTGAAGCAGG - Intronic
1096190508 12:49614800-49614822 CAGAGGAAAAAGTGGGAAGCGGG + Intronic
1096773252 12:53949750-53949772 CACAGGGAGCACAGGGAAGGGGG + Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098771776 12:74561733-74561755 CACAGGTAGAAGGGGGAAAATGG - Intergenic
1099540627 12:83903594-83903616 CTCAGGAAGGTGGGGTAAGCAGG + Intergenic
1100221134 12:92505574-92505596 CACTGGCAGCTGGGGGAAGTGGG + Intergenic
1100772926 12:97943177-97943199 CAAAGGAAGTGGAGGGAAGCTGG + Intergenic
1100979488 12:100153584-100153606 CCCAGGACCCTGGGGGAAGCAGG - Intergenic
1101707620 12:107235220-107235242 CACAGGATGCAGAGAGAAGGGGG - Intergenic
1101871098 12:108566204-108566226 CACAGGAAGCAGGTGGCACGTGG - Intronic
1102799154 12:115716469-115716491 TAAAGGAAGCAGGAGGAGGCTGG + Intergenic
1102830360 12:115992700-115992722 CACAGAAAGCTGCTGGAAGCTGG - Intronic
1102965428 12:117121613-117121635 AACAGGAAGCCGGGGGCTGCAGG + Intergenic
1102986719 12:117284394-117284416 CACAGGGAGCAGGCCGAGGCAGG - Intronic
1103071938 12:117951623-117951645 CACACAGAGCAGGGGGATGCTGG + Intronic
1103555475 12:121763793-121763815 CCCAGGAGGAAGGAGGAAGCAGG - Intronic
1104278635 12:127353564-127353586 CACAGGGAGCAGGGGATAGCTGG - Intergenic
1104612464 12:130240970-130240992 GACAGGAAGTAGGAGGCAGCCGG - Intergenic
1104681456 12:130754861-130754883 AGCAGGAACCAGAGGGAAGCAGG + Intergenic
1105706628 13:22971377-22971399 CCCCAGAAGCTGGGGGAAGCAGG - Intergenic
1106172048 13:27296695-27296717 CTCAGGGAGCAGGAGGATGCAGG - Intergenic
1106175984 13:27332090-27332112 CACAGGAATGAGGAGGAAGAGGG + Intergenic
1106576416 13:30979372-30979394 TCCAGGAAGCAGGCAGAAGCTGG - Intergenic
1107058099 13:36128531-36128553 CAGAGGAAGCAGTGGTCAGCAGG + Intronic
1107362765 13:39637849-39637871 CACAGGGAACAAGGGAAAGCAGG - Intergenic
1107434572 13:40371004-40371026 CACAGGAGGCCCGGGGAAGGTGG + Intergenic
1109064179 13:57663819-57663841 TACAGGAACGAGGAGGAAGCAGG - Intronic
1109515835 13:63441491-63441513 CACAGGTAACAGGGAGAAGAGGG + Intergenic
1110008108 13:70297356-70297378 GGCAGGAAGCAGGGACAAGCAGG + Intergenic
1110103115 13:71634394-71634416 CACAGAGAGCAAGGGGGAGCCGG - Intronic
1110533397 13:76623118-76623140 CCCTGGAAGCAGGGGGCAGTTGG - Intergenic
1111165087 13:84447841-84447863 CACAGGGAGCGGTGGGTAGCCGG + Intergenic
1111486338 13:88905586-88905608 CATAGAAAGCAGGGAGATGCAGG + Intergenic
1112760885 13:102692147-102692169 CAAAGGTAGAAGGGGGCAGCCGG + Intronic
1113038211 13:106074547-106074569 CACAAGAAGCCTGGGGAACCCGG + Intergenic
1113552187 13:111201138-111201160 CACAGGAACAAGGGGGACGATGG - Intronic
1114699814 14:24665549-24665571 CTCAGGAAGCAGGGCCATGCAGG - Intergenic
1115993919 14:39175770-39175792 GACAGGAAGCTGGGGTAAGGCGG - Intronic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1117116409 14:52517698-52517720 CACAGGAAAAAGGGGGGAGTTGG - Intronic
1117244432 14:53870166-53870188 CAGAGGAAGCAGGAGGAAGTGGG + Intergenic
1117627139 14:57651564-57651586 CACAGGAAGCAAGAGGAACCAGG + Intronic
1118362575 14:65068913-65068935 CAAAGGAGGCAAGGGGAGGCTGG + Intronic
1119539901 14:75431186-75431208 CCCAGGCAGCAAGAGGAAGCTGG - Intronic
1119623769 14:76152532-76152554 CACAGGAAGGAACGGGTAGCTGG - Intronic
1119772973 14:77232825-77232847 CTGAGGAATCAGGGGAAAGCTGG - Intronic
1120450938 14:84666004-84666026 CCAGGGAAGCAGGGGAAAGCTGG + Intergenic
1120479246 14:85028204-85028226 TACAGGAAGCAGAGGACAGCGGG - Intergenic
1120941488 14:89954581-89954603 CACAGGAAGTGGGTGGAAGTAGG - Exonic
1121956109 14:98214910-98214932 GACAGGCAGCAGGGGGATGTGGG - Intergenic
1122544164 14:102513083-102513105 CACAGGCAGTAGGGGGAGGCTGG + Intergenic
1122823166 14:104357137-104357159 CACTGGAAGCTGGGAGAGGCAGG + Intergenic
1124017411 15:25889112-25889134 CACAGGAATGTGGGGGCAGCAGG - Intergenic
1124462728 15:29907774-29907796 CGCGGGAACCTGGGGGAAGCTGG - Intronic
1124638236 15:31378518-31378540 CATCGGAGGCAGTGGGAAGCTGG + Intronic
1124804477 15:32867626-32867648 CACAGGGAGCGGGGGGCAGGGGG - Intronic
1125685149 15:41559393-41559415 CACGGGAGGCGGCGGGAAGCGGG + Intronic
1126753028 15:51896716-51896738 CATAGGAAGGAGGGGGAAGCTGG - Intronic
1127599246 15:60518722-60518744 CACAGGAAGGAAGGTGCAGCAGG - Intronic
1127688501 15:61371782-61371804 AAGAGGAAGCAAGGGGAAGGAGG + Intergenic
1128248961 15:66151751-66151773 CCCAGGAAGAAGGGGGAAGTGGG - Intronic
1128883057 15:71261070-71261092 CACAGGTACCAGGGGTAGGCTGG - Intronic
1128984839 15:72211982-72212004 CACAGGAGGCTGGAGGGAGCTGG + Intronic
1129878332 15:78991649-78991671 CTGAGGAAGCGGGGGGAGGCGGG + Intronic
1129886633 15:79042601-79042623 ACAAGGCAGCAGGGGGAAGCTGG + Intronic
1131141325 15:89978914-89978936 CACAGGAGGGAGGGGAGAGCAGG + Intergenic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1131539798 15:93266546-93266568 CACAGGCAACAGGGACAAGCCGG - Intergenic
1131539806 15:93266594-93266616 CACAGGCAACAGGGACAAGCCGG - Intergenic
1131983387 15:98017408-98017430 CAGAGGGAGCAGGGGGAGGATGG - Intergenic
1132514776 16:361215-361237 CAAAGGGAGCAGGGTGAGGCAGG - Intergenic
1132812942 16:1810434-1810456 CACAGCAAGCACGGGGAGGAGGG + Intronic
1135139883 16:19912235-19912257 CACTGGGATCACGGGGAAGCGGG - Intergenic
1135766068 16:25178767-25178789 GACAAGAAGCAGGGGCAACCAGG + Intergenic
1135913868 16:26586032-26586054 CATGGGAAGCAAGGGGAAGAGGG - Intergenic
1136287825 16:29254582-29254604 CACAGGAAGAGAGAGGAAGCGGG + Intergenic
1136518271 16:30780861-30780883 CACAAAAATTAGGGGGAAGCAGG - Exonic
1137446460 16:48535404-48535426 CTCAGGAACCAGGAGGGAGCCGG + Intergenic
1138128209 16:54456279-54456301 CACAGAGCGCAGTGGGAAGCAGG - Intergenic
1138315464 16:56065923-56065945 CACAGGGAGCAGAGGGATGAAGG - Intergenic
1138625203 16:58246255-58246277 GACTGGAGGGAGGGGGAAGCAGG + Intronic
1139484160 16:67246827-67246849 CACCTGAAGCAGGTGGAAGCTGG + Intronic
1140504184 16:75460073-75460095 CCCAGGAACCAGGGAGGAGCAGG - Intronic
1141506561 16:84482103-84482125 CACAGGAAGCAGGGGGAAGCGGG - Intronic
1142093476 16:88227285-88227307 CACAGGAAGAGAGAGGAAGCGGG + Intergenic
1142211144 16:88809122-88809144 CACAGGCAGCCTGGAGAAGCTGG + Exonic
1142274804 16:89112793-89112815 CAGATGAAGCAGGAGCAAGCGGG - Intronic
1142359513 16:89619613-89619635 CAGAGGGAGCAGGGGGCTGCAGG - Intronic
1142590877 17:1005413-1005435 CACAGGCAGCAAGGCAAAGCAGG + Exonic
1142638348 17:1271156-1271178 CACAGGCCTCCGGGGGAAGCTGG + Exonic
1143134523 17:4704108-4704130 CACTGGAACCCGGGGGAAGATGG - Exonic
1143155490 17:4833657-4833679 GACAGGAACCAGGGCGAGGCTGG - Intronic
1143478913 17:7217629-7217651 GAGAGGAAGCAGGGGGAGGGAGG + Intronic
1143563554 17:7708761-7708783 CAGAGGAAGCTGGGGAAGGCAGG - Intronic
1143801055 17:9381263-9381285 AACAGGAAGGAGGGAGAAGGAGG - Intronic
1144140265 17:12341216-12341238 GGCAGGAAGCAGGAGGAACCTGG + Intergenic
1144300823 17:13921981-13922003 CACAGGATGCAGGGAGTGGCAGG - Intergenic
1144420921 17:15097827-15097849 TGCAGGAAGGAGGGGGAAGAGGG - Intergenic
1145791891 17:27632528-27632550 CAGAGGGGGCTGGGGGAAGCTGG + Intronic
1145878498 17:28337342-28337364 CACAGACAGTAGGGGGAAGTTGG - Intronic
1146833285 17:36088950-36088972 GACAGGAAGAAGGAGGCAGCGGG - Intronic
1146847807 17:36195565-36195587 GACAGGAAGAAGGAGGCAGCAGG - Intronic
1147951657 17:44111087-44111109 CCCAGGAACCAGGGAGAGGCTGG - Intronic
1147967045 17:44199329-44199351 GCCGGGAAGCTGGGGGAAGCCGG + Intronic
1148021736 17:44557875-44557897 CACACGAACCAGGAGGACGCAGG + Exonic
1148227245 17:45907404-45907426 CACAGGAAGCGGGGGCAAGAAGG - Intronic
1148748013 17:49929179-49929201 GTCAGGAAGCAGAGGGAACCAGG + Intergenic
1149275290 17:55027084-55027106 CACAGGGAGTAGGGAGTAGCAGG - Intronic
1149360463 17:55889617-55889639 AAGAGGAAGAAGAGGGAAGCTGG - Intergenic
1150195231 17:63291066-63291088 TATAGGAAGCTGGGGGAAGGGGG - Intronic
1150622027 17:66814796-66814818 CCCAGGAGGAAGGAGGAAGCGGG + Intergenic
1151188065 17:72378601-72378623 CACAGGAACCTGCTGGAAGCCGG + Intergenic
1151331341 17:73411046-73411068 CAGAGGAAGGAAGGGGAGGCCGG - Intronic
1151433546 17:74080696-74080718 CTCAGGCAGCAGGGCCAAGCAGG - Intergenic
1151480481 17:74367681-74367703 CACAGGTCACAGGGGGAAGCTGG + Exonic
1151752259 17:76046278-76046300 CAGAGGAAGCAGGGGGCGGGTGG + Intronic
1151972586 17:77466445-77466467 CACAGGCAGCAGCCGGAACCTGG - Intronic
1152074192 17:78148718-78148740 CACAGGAAGCAAGGGGCAAAGGG + Intronic
1152105043 17:78323923-78323945 CACAGGAAGGAGAGAGAAGAGGG - Intergenic
1152117614 17:78398368-78398390 CACAGGAAGCAGGAGGGGCCAGG - Intronic
1152285565 17:79410763-79410785 CTCAGGAAGCAGGAGGCAGGAGG - Intronic
1152356864 17:79811709-79811731 CAGAGGAAGGTGGTGGAAGCGGG + Intergenic
1152471319 17:80491394-80491416 CTCGGGAAGCAGGGTGAAGGGGG + Intergenic
1153238366 18:3010006-3010028 AGCAGGAAGCTGGTGGAAGCTGG - Intronic
1153543936 18:6186559-6186581 CACAGTAAGCATGGGAAAGCAGG + Intronic
1153810059 18:8744536-8744558 CACAAGAAGCAGCAGGAAGCAGG - Intronic
1153824975 18:8866798-8866820 CACAGGCAGCTGGTGGCAGCTGG - Intergenic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1154385847 18:13891144-13891166 CACAGGAAGCGGAGGCATGCTGG - Intronic
1155572737 18:27213180-27213202 TACAGAAACCAGGGGGAAGATGG + Intergenic
1156723509 18:40099469-40099491 CACAGGGATCAGAGGGAAGGTGG + Intergenic
1157995910 18:52555636-52555658 CACAGGAAGCAGAAGGACTCAGG + Intronic
1158400499 18:57117094-57117116 GACAGGGAGCAAGGGGATGCAGG - Intergenic
1158647951 18:59264430-59264452 CGCAGGAAGCTGGGGGCAGGGGG - Intergenic
1159659015 18:71070470-71070492 CACGGGAAGCTGGTGGAAGCTGG + Intergenic
1160116862 18:76086799-76086821 CACAGGAAGCAGGTGCAGGTAGG + Intergenic
1160135207 18:76265920-76265942 CCCAGGAAGCAAGCTGAAGCTGG + Intergenic
1160242368 18:77132829-77132851 CGCAGGAAGCCCGGGGAGGCGGG - Intronic
1160329433 18:77978161-77978183 TCCAGGGTGCAGGGGGAAGCTGG - Intergenic
1160975516 19:1790503-1790525 CAGAGGAGGGAGGGGGAAGAGGG - Intronic
1161077683 19:2294314-2294336 CCCAGGAAGCCGGGAGAGGCAGG + Intronic
1161316597 19:3620280-3620302 CACAGGAGGCTGAGGGCAGCGGG + Intronic
1161428007 19:4215087-4215109 GCCAGGAAGCTGGGGGATGCTGG + Intronic
1161448325 19:4330026-4330048 CCCAGGAAGCAGGGTCAAGTCGG + Exonic
1161627804 19:5337328-5337350 CACAGAAAGCAGGTGAACGCGGG + Intronic
1162794552 19:13079697-13079719 CACAGGCAGCAGGAGGGCGCAGG + Intronic
1162971617 19:14184150-14184172 GACAGGAAGCAGGGGGCTGGGGG - Intronic
1163146945 19:15386529-15386551 CACACTAAGCTGGGGGAGGCAGG - Intronic
1163397631 19:17073374-17073396 CCCAAGAAGCACAGGGAAGCCGG + Intronic
1164609289 19:29621282-29621304 CACAGGGTGCAGCGGGAAGGTGG - Intergenic
1164718144 19:30408598-30408620 CACAGGAAGTAAGTGGAAGAAGG + Intronic
1164803594 19:31098698-31098720 CATGGGAACCAGGAGGAAGCAGG - Intergenic
1165350431 19:35272292-35272314 CACAGGCAGGAGAGGAAAGCTGG + Intronic
1165761407 19:38323450-38323472 CACTTGAGGCAGGAGGAAGCGGG + Intronic
1166247306 19:41538305-41538327 CCCATGAAGCAGGGAGAACCTGG - Intergenic
1166326857 19:42056394-42056416 CACAGGAAGCAGGGGGAAGAGGG + Intronic
1166499730 19:43331614-43331636 CACAGAAGGGAAGGGGAAGCAGG - Intergenic
1166562826 19:43744707-43744729 CACTGGGAGCAGGGGCAAGGTGG - Intronic
1166960514 19:46493683-46493705 CGCAGGAAGCAGGAAGAAGAAGG - Exonic
1167120232 19:47512355-47512377 CAGAGGAAGCAGCGTGAACCAGG - Intronic
1168166531 19:54552133-54552155 CACAGGGCCCAGGGGGAAGTTGG - Intergenic
1168166989 19:54555375-54555397 CCCAGGAACAAGGGAGAAGCTGG - Intergenic
1168343978 19:55641554-55641576 CACAGAAAGGAGGGGAAAGTGGG + Intronic
925178664 2:1802363-1802385 GACAGGAAGCTGTGGGAAGTGGG + Intronic
925411767 2:3643640-3643662 CACAGGCAGCAGGGGCCGGCAGG - Intronic
925638038 2:5960662-5960684 CACAGGAAGTGGGGAGAAGTAGG + Intergenic
925906878 2:8544985-8545007 CACAGGGAGCAGGGCACAGCTGG + Intergenic
926127691 2:10282060-10282082 GGCAGGCAGCAGAGGGAAGCTGG + Intergenic
926263639 2:11292978-11293000 GACAGAAAGCAAAGGGAAGCAGG - Intronic
926286802 2:11495051-11495073 CACCGGGGGCAGGGGCAAGCGGG - Intergenic
926561955 2:14427270-14427292 CACAGGAAAAAGAAGGAAGCGGG + Intergenic
926838421 2:17050665-17050687 CACAGACAGCAGGGAGAAGAGGG - Intergenic
927459939 2:23289815-23289837 GAGAGGAAGCAGTGGGAAGCTGG - Intergenic
927469536 2:23362679-23362701 AGCAAGAAGCAGGGAGAAGCTGG - Intergenic
927588268 2:24330344-24330366 CACAGGATGCAGTGGCATGCAGG - Intronic
927915457 2:26933230-26933252 CACAAGAAACAGTGGGAAGTAGG - Intronic
928620046 2:33079641-33079663 CACAGAAAGCAGGGTGCAACTGG - Intronic
929245500 2:39697761-39697783 AACAGGAAGGAGGTGGCAGCTGG - Intronic
929576964 2:43058006-43058028 CTCAGGAAGCAGGAGGGGGCTGG - Intergenic
930122080 2:47768523-47768545 CACAGGAAGGAGTGGGAAAGAGG + Intronic
930806671 2:55497264-55497286 CACAGATAGCAGGAGGAAGAGGG + Intergenic
931129770 2:59322113-59322135 CACAAGAAGCAATGGGAATCTGG + Intergenic
931340744 2:61398506-61398528 CAGGGGAAGGAGGCGGAAGCGGG + Intronic
932331800 2:70901927-70901949 AAGAGGCAGCAGGAGGAAGCCGG - Intronic
932408966 2:71534063-71534085 TACAGGGAGGAGGGGGAAGGTGG + Intronic
932703842 2:74008634-74008656 AACAGAAAGTAGGGGGAAGATGG - Intronic
932875311 2:75444972-75444994 ACAAGGAAGCAGGGTGAAGCAGG + Intergenic
933250701 2:80025317-80025339 GACAGGAGGCAGGGGAATGCTGG - Intronic
933808430 2:86017026-86017048 CAAAGGATGCAGAGAGAAGCTGG + Intergenic
934090989 2:88550147-88550169 TACAGGAATCAGCGGGGAGCCGG - Intergenic
934479186 2:94619108-94619130 CACAGGGAGCAAGGAAAAGCAGG - Intergenic
934509028 2:94922071-94922093 CACAGGAACATGGGGGAAGTAGG + Intergenic
934768484 2:96893856-96893878 CACAGGTAGCAGGGAAAGGCAGG - Intronic
934770927 2:96907237-96907259 CACAGCAAGGAGGGGGCAGGGGG + Intronic
934913541 2:98279756-98279778 CTCAGAAGGCAGGAGGAAGCCGG - Intronic
935187321 2:100745879-100745901 CACTGGAAGAAGAAGGAAGCTGG + Intergenic
935641478 2:105294643-105294665 TACAGGGAGAAGCGGGAAGCAGG + Intronic
935744862 2:106181420-106181442 CAAAGAAAGCTGGGGCAAGCGGG + Intronic
936948587 2:117954130-117954152 CACAAGAAGGTGGGTGAAGCAGG - Intronic
937071420 2:119066634-119066656 CCCAGGGAGCAGGAGGGAGCTGG - Intergenic
937905169 2:127049581-127049603 CTCTGGAAGCAGGAAGAAGCCGG + Intronic
938053892 2:128199011-128199033 CACAGGGAGCAGGGGAATGTGGG - Intergenic
938375902 2:130806464-130806486 CAGAGGAAGCAGAGGGGTGCCGG + Intergenic
939837766 2:147150949-147150971 CACAGGACGCAAGCCGAAGCAGG + Intergenic
939940610 2:148346097-148346119 CACAGGAAGCAAGGGGTATATGG + Intronic
942682458 2:178491850-178491872 CGGAGGAAGCAAGGGAAAGCGGG + Intronic
943025813 2:182626062-182626084 CAAAGGCAGCAGGGAGCAGCAGG - Intergenic
943384554 2:187185073-187185095 CACAGGAAGCAGGGAAATTCTGG - Intergenic
944036238 2:195297872-195297894 CACAGTAAGCAAGAGGAAGAGGG + Intergenic
944086220 2:195850782-195850804 GAAAGGATGCAGGGGGAAGCAGG + Intronic
944146679 2:196514169-196514191 CACTAGAAGCAGGGAGAGGCCGG - Intronic
945146999 2:206748668-206748690 GGCAGGAAGCAGGTGGAACCAGG - Intronic
945285174 2:208074924-208074946 CACAGGAAGCACAGAGAGGCGGG - Intergenic
945530062 2:210942166-210942188 TGCAGAAAGCAAGGGGAAGCAGG + Intergenic
946177128 2:217928757-217928779 AAGAGGAAGCAGTGGGCAGCTGG - Intronic
946752440 2:222905990-222906012 CACAGAAAGAAGGGAAAAGCAGG - Intronic
948120226 2:235524025-235524047 CACTGGAAGGATGGGGAAGCCGG - Intronic
948144606 2:235699097-235699119 CACAGGAGGGACGGGGAGGCAGG + Intronic
948573815 2:238937016-238937038 GACAGGAAGCAGGGGGACTCTGG - Intergenic
1169000333 20:2163631-2163653 CAGAGGAAGCAAGGGGAAGAAGG + Intronic
1169075017 20:2755038-2755060 CCCAGGGTGCAGGGGGAAGTGGG + Intronic
1169111575 20:3037434-3037456 CACAGGAAACATTGGGAGGCAGG + Intronic
1170528280 20:17262942-17262964 GACAGGAAGGAGAAGGAAGCTGG - Intronic
1170845259 20:19956822-19956844 CTCGGGAAGCAGGTTGAAGCAGG + Intronic
1172595661 20:36149497-36149519 AAGAGGAAGTAGGGGGCAGCTGG + Intronic
1172751752 20:37256385-37256407 AGCAGGCAGCAGGGGTAAGCAGG - Exonic
1172833068 20:37853065-37853087 CAAAGGAGGCAAGGGGAAGCTGG + Intronic
1175688773 20:61050618-61050640 CCCAGGAGGCAGGGGGAGGCTGG + Intergenic
1175736155 20:61388688-61388710 CACAGACAGCAGGGGGATGCTGG + Intronic
1175772786 20:61634238-61634260 CACAGGAAGGAGGGGTATACAGG - Intronic
1175848039 20:62069255-62069277 CACCGGAAGCTGGAGGAAGCAGG - Intergenic
1175902190 20:62364358-62364380 CACGAGCAGCAGAGGGAAGCTGG + Intronic
1176028376 20:62997940-62997962 CAGGAGAAGCACGGGGAAGCCGG + Intergenic
1176113311 20:63420471-63420493 CTCAGGAAGCAGTGGCAAGGAGG - Intronic
1176113595 20:63421702-63421724 CACAGGCATGAGGGGGCAGCCGG + Intronic
1176124207 20:63468235-63468257 CACAGGAGGCTGTGGGAAGAAGG + Intronic
1176246364 20:64099126-64099148 CACATGAAGCACGGGGAGGGAGG - Exonic
1176257297 20:64158946-64158968 CAGGAGAAGCAGGAGGAAGCAGG - Intronic
1176943201 21:14948785-14948807 CACCAGAAGCTGGGAGAAGCTGG - Intergenic
1178257178 21:31064790-31064812 CACATGGAGCAGAGGCAAGCTGG + Intergenic
1178824614 21:36004931-36004953 GAGGGGAGGCAGGGGGAAGCAGG + Intergenic
1179085023 21:38208224-38208246 CCCAGGAAGCAGGAAGGAGCAGG - Intronic
1181005939 22:20013543-20013565 CGCAGGAAGCTGGGTGGAGCCGG + Intronic
1181020895 22:20101765-20101787 CACAGGCAGCTGGGAGGAGCAGG - Intronic
1181287621 22:21765654-21765676 CACATGAATCCAGGGGAAGCTGG - Intronic
1181831734 22:25565206-25565228 TCCAGGAAGCAGGGGGTAGCTGG - Intronic
1181846114 22:25710098-25710120 CACAGGATGCTGGGGGAGGTGGG - Intronic
1181987457 22:26810449-26810471 CACAGCTAGTAGGGGAAAGCTGG - Intergenic
1182155904 22:28072769-28072791 CAGAGGTAGCAGGGGGAAGCCGG + Intronic
1182309624 22:29395395-29395417 CTCAGCAAGCAGGTGGAGGCTGG - Intronic
1183049306 22:35247773-35247795 CCCAGGCAGCAGGGGAAATCTGG + Intergenic
1184362518 22:44026822-44026844 CTAAGGGAGGAGGGGGAAGCTGG + Intronic
1184442055 22:44523010-44523032 CCCAGGAAGCAGGGCAAGGCAGG - Intergenic
1184448622 22:44569697-44569719 CACGTGCAGCAGGGGGGAGCTGG - Intergenic
1184663044 22:45974378-45974400 CAGCGGTAGAAGGGGGAAGCTGG - Intronic
1184695236 22:46135295-46135317 CTCAGGAGGCAGGGGGCAGCTGG + Intergenic
1184965674 22:47970308-47970330 CCCAGGGAGCAGGGGATAGCGGG - Intergenic
1185399060 22:50606687-50606709 CACAGGAGGCAGGAGGGCGCAGG - Exonic
949213519 3:1536038-1536060 GACAGGAAGAAGGAGGAAGCAGG - Intergenic
949809622 3:7992190-7992212 CCCAATAAGCAGGGAGAAGCAGG + Intergenic
950124132 3:10501247-10501269 GGCGGGAGGCAGGGGGAAGCGGG - Intronic
950525914 3:13523184-13523206 CACGGGAAGCAGGGGGAAGCTGG - Intergenic
950627971 3:14262227-14262249 GACAGGAGGCAGGAGGAAGAAGG - Intergenic
951563694 3:23991870-23991892 AAGAGGAAACAGGGGAAAGCAGG - Intergenic
952723218 3:36555070-36555092 CACAGGCAGCTGGGGGATGGGGG + Intergenic
952747031 3:36791145-36791167 TAGAGGGAGCAGGGGAAAGCAGG + Intergenic
953450141 3:42998727-42998749 CACAGGGAGCGGGAGTAAGCAGG - Intronic
954526341 3:51275082-51275104 CACAGGAAGCAGGATGCGGCGGG - Exonic
954852254 3:53613338-53613360 TACAGGAAGAAGAGGGAAGAGGG - Intronic
954872768 3:53780280-53780302 AACAGGAGGCAGGGGCCAGCCGG - Intronic
955340765 3:58123399-58123421 CACGGGAAGGTGGGTGAAGCTGG + Exonic
955406902 3:58631321-58631343 CTGAGGAAGGAGTGGGAAGCTGG + Intergenic
955539743 3:59961712-59961734 CACAGGGGGCGAGGGGAAGCAGG - Intronic
955678534 3:61475397-61475419 GAAAGGAAGGAGGAGGAAGCAGG - Intergenic
955708448 3:61753667-61753689 CTCAGGAAGCAGGGGGTTGGGGG - Intronic
955943514 3:64169186-64169208 GACAGGAAGCAGGAAGAAGGGGG - Intronic
956774064 3:72550365-72550387 CACCGGAAGCTGGGGGAGGCAGG - Intergenic
956792369 3:72690072-72690094 CACAGGAGGCTGGGGGATGGAGG + Intergenic
959009206 3:101055437-101055459 GGCAGAAAGCAGGGGGAAGAGGG - Intergenic
959320807 3:104872639-104872661 AACTGGTAGCAGTGGGAAGCTGG - Intergenic
959406208 3:105964612-105964634 CAAAGAAAGCAGTGTGAAGCTGG - Intergenic
960732641 3:120743414-120743436 GAAGTGAAGCAGGGGGAAGCTGG + Intronic
961441481 3:126955845-126955867 CAAAGGGAGCAGGGAGGAGCAGG - Intronic
961647288 3:128399441-128399463 AAAAGGAATTAGGGGGAAGCAGG - Intronic
961647413 3:128400069-128400091 GACAGAAAGAAGGGGGAACCTGG - Intronic
961865658 3:129951847-129951869 CACTGTAAGCATGGGGAAGTAGG - Intergenic
963110073 3:141681225-141681247 CACAGGAAACTGTGGGAACCTGG + Intergenic
963938491 3:151078047-151078069 AACAGGAAGCAGGGGCCAGCTGG - Intergenic
965179476 3:165383574-165383596 AAGTGAAAGCAGGGGGAAGCAGG + Intergenic
965906660 3:173716474-173716496 TACAGGAAGCAAGAGGCAGCAGG + Intronic
967460992 3:189745198-189745220 CACAGGAAGCATGAAAAAGCAGG + Intronic
967721196 3:192818232-192818254 CACAGAACACAGGGGGATGCAGG - Intronic
967728073 3:192880456-192880478 TAAAGGAAGGAGGAGGAAGCAGG + Intronic
968669731 4:1842654-1842676 CACAGGCAGCAGTGGGAGGCTGG + Intronic
968913430 4:3486923-3486945 CCCGGGGAGCAGAGGGAAGCAGG + Intronic
968925216 4:3543469-3543491 GGCAGGGGGCAGGGGGAAGCAGG - Intergenic
969119927 4:4900666-4900688 CCCAGGAAGCAGGAGGAAGTGGG - Intergenic
969175129 4:5392937-5392959 CACAGGAAGCAGGAGACAGAAGG + Intronic
969206618 4:5652034-5652056 ACCAGGGAACAGGGGGAAGCTGG + Intronic
969689902 4:8698674-8698696 CACCGGAAGAAGGGGGAATGTGG - Intergenic
970198463 4:13576450-13576472 CCCAGAAAGCAGGAGGAACCAGG - Intronic
970402874 4:15734851-15734873 CACAGGGAGCAGGCAGGAGCGGG + Intronic
971375246 4:26050907-26050929 CAGTGGAAGCATGAGGAAGCTGG - Intergenic
971487718 4:27177076-27177098 CTCAGGAAGCTGGGGGCGGCTGG + Intergenic
971580700 4:28335682-28335704 CAAAGGAAGAAGGTGAAAGCAGG - Intergenic
971615651 4:28787925-28787947 TACAGGAAGCAGGGAGAGGGTGG + Intergenic
972097339 4:35364534-35364556 CTAGGGAAGCAGGGGAAAGCCGG + Intergenic
973243774 4:47987938-47987960 TAGAGGAAGCAAGGGGAAGAGGG + Intronic
976225135 4:82789872-82789894 CAAAGGAAGGAAGGGGAAGGAGG + Intronic
976351440 4:84064495-84064517 CTCAGGAAGCAAGGGGAAGCAGG + Intergenic
977101723 4:92824396-92824418 CACAGGTAGCAGGGAATAGCTGG - Intronic
977647895 4:99435018-99435040 CAGTGGAAGCAGGGGTAAGTTGG - Exonic
977915641 4:102589543-102589565 AAGATGAAGCAGGGGAAAGCAGG - Intronic
978485338 4:109247236-109247258 CTCAGGAAGCTGAGTGAAGCAGG + Intronic
978492981 4:109328675-109328697 TACAATAAGCAAGGGGAAGCAGG + Intergenic
979816013 4:125104899-125104921 TACAGGAAGCAGGGGGAGGGAGG - Intergenic
984233485 4:177129392-177129414 CACAGGAAACATGAAGAAGCAGG - Intergenic
985627255 5:995491-995513 CCCAGCAAGCAGGTGGCAGCAGG - Intergenic
985631334 5:1015620-1015642 ATCAGGAAGCAGGAGGAAGCAGG + Intronic
985665095 5:1177999-1178021 CGCAGGAAGGATGGGGCAGCTGG + Intergenic
985923868 5:3000553-3000575 CACAGGACGCAGGAGGGACCTGG - Intergenic
986361668 5:6984268-6984290 CAGAGGAAGCAGGAGGCATCTGG + Intergenic
986456762 5:7927640-7927662 CACAGAAGGCAGGTGGACGCGGG + Intergenic
986617062 5:9628549-9628571 CAAAGGAAGCAAGGACAAGCAGG - Intergenic
986664067 5:10084809-10084831 TACAGGAAGCAGGTGGATTCAGG - Intergenic
987320893 5:16768337-16768359 CACAGGAAACAGTATGAAGCAGG + Intronic
987440627 5:17951794-17951816 CCAGGGAAGCAGGGGAAAGCTGG + Intergenic
988296628 5:29371226-29371248 TAAAGGAAGTAGGGGGAAGAAGG + Intergenic
988417201 5:30960258-30960280 TACAGGAAAAAGGGGGAAGGAGG - Intergenic
988614713 5:32764337-32764359 CCCCAGAAGCAGGGGGCAGCTGG - Intronic
989409201 5:41097982-41098004 CACAGGAAGCAGTGAAGAGCTGG + Intergenic
990138100 5:52671311-52671333 CACAGGAAGGATGGGGAATTGGG - Intergenic
990990519 5:61679049-61679071 CACAGAAGGAAGGAGGAAGCAGG + Intronic
991377715 5:65984002-65984024 CACGGGAAGCAGGTGGGAGAAGG - Intronic
992195481 5:74335022-74335044 GACAGGAGGTAGGGGAAAGCTGG + Intergenic
992258664 5:74948199-74948221 CACTGCAAACAGGAGGAAGCAGG + Intergenic
992879399 5:81091275-81091297 TACTGGAGGCAGGGGAAAGCAGG - Intronic
992891875 5:81211211-81211233 CACAGGCAGCATGGGGCATCTGG - Intronic
995857215 5:116605890-116605912 CACAGGAAAGAGTGGGAAACAGG - Intergenic
997254504 5:132418037-132418059 GACAGGAGGCAGGGTGAAGCTGG - Intronic
997880985 5:137589519-137589541 CACAGGTAGCAGGAAAAAGCAGG + Intronic
1000302115 5:159965661-159965683 CAGAGGAAGAAGGAGGAAGGAGG + Intronic
1000348473 5:160333807-160333829 CACAGGATACAGGGGCAAGATGG - Intronic
1001419180 5:171573903-171573925 GCCAGGGAGCAGGGAGAAGCGGG + Intergenic
1001424509 5:171614672-171614694 CAGAGGCAGCAGTGGGAGGCTGG + Intergenic
1001853354 5:174989043-174989065 CACAGGAAGTGGAGGGAACCAGG - Intergenic
1003082410 6:3032055-3032077 CACAGGCTGCAGGTGGCAGCAGG + Intergenic
1003505203 6:6734870-6734892 CACAAGAAGCAAAGAGAAGCAGG - Intergenic
1003662396 6:8074903-8074925 CACAGGAAGAAGCGGGAAGAGGG + Intronic
1003712905 6:8613619-8613641 ACCAGGAAGGAGGGGGATGCCGG - Intergenic
1004189886 6:13454762-13454784 CACAGACAGCAGGTGGCAGCTGG + Intronic
1005225177 6:23634248-23634270 CAAAGGCAGCAGTGAGAAGCAGG - Intergenic
1005577708 6:27205511-27205533 CCCAGGACGCAGGTGGCAGCGGG - Intergenic
1006088643 6:31615124-31615146 CCCAGGAAGGAGGGGGAGCCTGG - Intergenic
1006233288 6:32604100-32604122 TGCAGGAAGCAGGGGGAGTCAGG + Intergenic
1006347704 6:33496801-33496823 CACAGGAAGCAGTCGGACCCCGG - Intergenic
1006825089 6:36928771-36928793 CCCAGGGAGCAGAGGGAGGCAGG + Intronic
1007163327 6:39810586-39810608 CACAGGATGCAGGGGAGAGGTGG - Intronic
1007223016 6:40293910-40293932 CAAAGCAAGCAGGGAGGAGCAGG + Intergenic
1008176750 6:48277553-48277575 AACAGGAAGCATGTGGAAGTGGG + Intergenic
1008198733 6:48559850-48559872 CAAAGAAAGCAGGAGGAAGTGGG - Intergenic
1009707208 6:67266778-67266800 CACAGAGAGCAAGGAGAAGCAGG - Intergenic
1010196878 6:73248426-73248448 GAGAGGAAGGAGGGGGAAGAAGG - Intronic
1011012043 6:82713620-82713642 AACAGGAAGAAAGGAGAAGCGGG + Intergenic
1011304422 6:85910839-85910861 CACGGGGAGCAAGGGAAAGCAGG + Intergenic
1012976981 6:105791419-105791441 CACAGGCAGCAGAGGGAGGCTGG + Intergenic
1013303181 6:108823122-108823144 CAGAGGATTCTGGGGGAAGCAGG - Intergenic
1014078576 6:117264777-117264799 CACCGGGAGCAGCCGGAAGCGGG + Intergenic
1014215997 6:118753378-118753400 TCCAGGAAGCAGTGGGAGGCTGG - Intergenic
1015192214 6:130484129-130484151 CCCAAGAATCAGGGGGAAGAAGG - Intergenic
1015793357 6:136986314-136986336 GAGAGGAAGCAGAGAGAAGCAGG - Intergenic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1018027889 6:159819838-159819860 AACAGCAAGGAGGGGGATGCAGG + Intronic
1018147825 6:160909546-160909568 CACGTGAAGCAGAGGAAAGCTGG + Intergenic
1018168777 6:161127100-161127122 CCCAGGAAGCAGGGGAAAGCCGG + Intergenic
1018211353 6:161484941-161484963 TCAAAGAAGCAGGGGGAAGCCGG - Intronic
1018579167 6:165292823-165292845 AACAGGCAGCAGGGGGAAAAAGG + Intronic
1018794274 6:167173897-167173919 CAGCGGCAGCAGTGGGAAGCCGG + Exonic
1018822045 6:167381170-167381192 CAGCGGCAGCAGTGGGAAGCCGG - Exonic
1018842130 6:167524986-167525008 CAGGGGAAGGAGGGGGCAGCAGG - Intergenic
1019346217 7:531975-531997 CGCAGAGAGCAGGGGGAAGCTGG + Intergenic
1019404715 7:877382-877404 CGGAGGGAGCAGGGGGAGGCTGG - Intronic
1019415094 7:923394-923416 CACAGGAAGCAGGGAGGGGCCGG + Intronic
1019488719 7:1301251-1301273 CACAGGAAGCTGGTGGCAGCAGG + Intergenic
1019931659 7:4227318-4227340 CCCAGGAAGGGGTGGGAAGCCGG - Intronic
1020121595 7:5507148-5507170 TACAGGAAGCAGGAGCAGGCTGG - Intronic
1020151927 7:5689145-5689167 CACAGGAGGGAGGTGGAAGGGGG + Intronic
1020152788 7:5696523-5696545 CACAGGAAGGAGGAGCAGGCCGG + Intronic
1020211156 7:6159070-6159092 CACAGGACGCTGGGTGAGGCGGG - Intronic
1021876606 7:25055160-25055182 CACAGGAAGCAGCAGAAATCTGG + Intergenic
1021909191 7:25367146-25367168 GACAGGAAGTAGAAGGAAGCGGG + Intergenic
1022112263 7:27239100-27239122 CCAAGGCAGAAGGGGGAAGCGGG + Intergenic
1023026590 7:36056396-36056418 GAGAAGAAGCAGGAGGAAGCAGG + Intergenic
1023465201 7:40447105-40447127 CAGTGGAAGCTGGGGGAAGATGG - Intronic
1024817883 7:53292811-53292833 CACAGGAAGCAAGGGTTGGCAGG - Intergenic
1024850221 7:53705551-53705573 AGCAGGAAGCAAGGGGAAGCAGG - Intergenic
1026280043 7:68914206-68914228 AGCAGGAAGCAGGTGGCAGCGGG - Intergenic
1026830572 7:73607582-73607604 CACCGGAAGCCGGAGGTAGCTGG - Exonic
1027855614 7:83507552-83507574 AGCAGCAAGCAGGGGCAAGCAGG + Intronic
1028477221 7:91265298-91265320 CACACGAACCAGGAGGACGCGGG + Exonic
1028615521 7:92762376-92762398 GGAAGGAAGCAGAGGGAAGCAGG + Intronic
1029550733 7:101235914-101235936 CACAGGCAGGAGAGGGGAGCCGG - Intronic
1029616168 7:101659259-101659281 CACAGGGAGCAGGCTGAAGCAGG + Intergenic
1029627329 7:101728255-101728277 CACAGGATTCAGGGAGCAGCTGG + Intergenic
1029906500 7:104098633-104098655 CACAGGAAGCAGGTGGAAGGCGG + Intergenic
1030413745 7:109213753-109213775 CACAGAAAGCAAGGAAAAGCAGG - Intergenic
1030570864 7:111221974-111221996 CACAGTCAGCAGGGGGATGATGG + Intronic
1031854634 7:126907312-126907334 AAGAGGAAGGAGGGGGAAGAAGG + Intronic
1032085505 7:128881427-128881449 CCCATGAGGCAGGGGGAAGCTGG - Intronic
1032684903 7:134223420-134223442 CAGAGGCAGCAGGGGGTAGGTGG + Intronic
1033685019 7:143630988-143631010 CACTGGAGACAGGGAGAAGCCGG + Intronic
1033688192 7:143710207-143710229 CACTGGAGACAGGGAGAAGCCGG + Intronic
1033699594 7:143826633-143826655 CACTGGAGACAGGGAGAAGCCGG - Intergenic
1034721674 7:153299495-153299517 CCCAGGAAGCGGGGAGAACCGGG + Intergenic
1035593476 8:836216-836238 CACTGGAAGCAGGAGGCGGCCGG - Intergenic
1035649496 8:1254214-1254236 CACAGGCACCATGGTGAAGCCGG + Intergenic
1035785822 8:2260026-2260048 CACACGAAGGAGGCAGAAGCGGG - Intergenic
1035806985 8:2461690-2461712 CACACGAAGGAGGCAGAAGCGGG + Intergenic
1036743735 8:11389637-11389659 CCCAGGGAGCAGGGACAAGCAGG + Intergenic
1037167365 8:15847154-15847176 GACTGGAAGCAGGGAGAGGCAGG + Intergenic
1037214160 8:16428062-16428084 CAGAGGAAGCAGGCCAAAGCAGG + Intronic
1037524779 8:19714048-19714070 CAAAAGAAGAAGGGTGAAGCTGG - Intronic
1037579837 8:20238629-20238651 CTCAGGAAGCAGGGGGAGGCAGG + Intergenic
1037670800 8:21013601-21013623 CAGAGGAAGGAGGGGGGTGCAGG - Intergenic
1037858363 8:22387759-22387781 CAAAGGAAGCAGGAGGAACCTGG - Intronic
1038213480 8:25540903-25540925 GACAGGGAGCAGGAGGAGGCAGG - Intergenic
1038235843 8:25753619-25753641 AACAGTAAGCAAGGGGAAGTTGG + Intergenic
1039634399 8:39147623-39147645 CAGAGGAAGAAGGTGGATGCTGG - Intronic
1040298502 8:46175777-46175799 GACAGGAAGTGGGTGGAAGCCGG + Intergenic
1040589251 8:48774236-48774258 CAGCTGAAGCAGGAGGAAGCAGG - Intergenic
1040619759 8:49078430-49078452 CACAGGAAGCTGTGGGGAGCAGG - Intergenic
1040627864 8:49172579-49172601 AAAAGGAAGCAGAAGGAAGCTGG - Intergenic
1040743884 8:50616534-50616556 CACAGGAAGCACGAGCAGGCAGG + Intronic
1041330656 8:56720101-56720123 CTCAGGAAGCACAGGGAAGAAGG - Intergenic
1041464648 8:58146251-58146273 GACAGGTAGCATGGTGAAGCCGG + Exonic
1041654438 8:60335062-60335084 CAGAGGATGCAGAGGGAAGGGGG + Intergenic
1041893487 8:62897849-62897871 GTCAGAAAGCAGAGGGAAGCTGG - Intronic
1042955913 8:74250510-74250532 CTGAGGAAGCAGGGGGGACCGGG - Intronic
1042963990 8:74331224-74331246 CACAGGAAGCAGGAGTAGGCGGG - Intronic
1043575900 8:81655977-81655999 CACAGGAAGCACTTGGAAGATGG + Intergenic
1044064626 8:87684444-87684466 CACAGGACACATGGGGAAGAGGG - Intergenic
1044616762 8:94150356-94150378 GGCTGGAAGCAGGGAGAAGCAGG + Intronic
1045128925 8:99126250-99126272 CAGAGTAAGCATGGGGAAGGAGG + Intronic
1045135718 8:99215587-99215609 CACAGGAGGCAGGGGGCAAAAGG - Intronic
1045355232 8:101381607-101381629 CACAGAAAGGAGGGGGAAAATGG - Intergenic
1047029568 8:120861949-120861971 CGCAGGAAGCAGGGGATAGCAGG + Intergenic
1047446863 8:124927617-124927639 CAAAGGAAGGAGGAGGAAGCCGG + Intergenic
1047867263 8:129040118-129040140 CAAAGTAAGCATGAGGAAGCTGG - Intergenic
1048169740 8:132094665-132094687 ACCATGAAGCAGGGGAAAGCCGG - Intronic
1049306442 8:141906743-141906765 CACACGGAGCAGGTGGAAGGCGG - Intergenic
1049361320 8:142213710-142213732 CACAGGAAGCAGGGAGGCGAGGG + Intronic
1049388186 8:142354774-142354796 CACGAAAAGCAGGGGGAAGAGGG + Intronic
1049435232 8:142583432-142583454 GTCAGGGAGCAGGGGGCAGCAGG - Intergenic
1049583157 8:143421776-143421798 CAGAGGCTGCAGGGAGAAGCTGG + Intronic
1049796170 8:144498199-144498221 CACAGGGAGCTGTGGGAAGGTGG + Intronic
1049945618 9:592320-592342 CCCAGGGAGCAGCGGGAAGCCGG + Intronic
1050367680 9:4887622-4887644 CACTGGATGCTGGGTGAAGCTGG + Intergenic
1051186938 9:14470305-14470327 AACAGGAACCAGGAGCAAGCAGG - Intergenic
1051901294 9:22044689-22044711 CACAGGAAGGAGGGGGAGGGAGG - Intergenic
1052895965 9:33748708-33748730 CTCAGGAGGCCGGGGGAAGTCGG - Intergenic
1052997160 9:34557246-34557268 AACATGCAGCAGGGGGAAGGGGG - Intronic
1053678640 9:40464457-40464479 CACAGGGAGCAAGGAAAAGCAGG + Intergenic
1053800106 9:41758651-41758673 GGCAGGGGGCAGGGGGAAGCAGG - Intergenic
1053928624 9:43092811-43092833 CACAGGGAGCAAGGAAAAGCAGG + Intergenic
1054145084 9:61556184-61556206 GGCAGGCGGCAGGGGGAAGCAGG + Intergenic
1054188534 9:61970803-61970825 GGCAGGGGGCAGGGGGAAGCAGG - Intergenic
1054285084 9:63160485-63160507 CACAGGGAGCAAGGAAAAGCAGG - Intergenic
1054291718 9:63299995-63300017 CACAGGGAGCAAGGAAAAGCAGG + Intergenic
1054389735 9:64604538-64604560 CACAGGGAGCAAGGAAAAGCAGG + Intergenic
1054464782 9:65487141-65487163 GGCAGGGGGCAGGGGGAAGCAGG + Intergenic
1054505978 9:65911838-65911860 CACAGGGAGCAAGGAAAAGCAGG - Intergenic
1054649987 9:67617814-67617836 GGCAGGGGGCAGGGGGAAGCAGG + Intergenic
1054828609 9:69598566-69598588 GATAGGAAGCAGAGGGAAGGTGG + Intronic
1055001392 9:71453512-71453534 CAGAGGAATCCGAGGGAAGCTGG - Intergenic
1055486222 9:76759274-76759296 AACAGGAAGCAGGGAGATACTGG + Intronic
1056682778 9:88733729-88733751 CCCAGGAAGCAGGGGGTGCCCGG + Intergenic
1057794607 9:98146289-98146311 CAAAGGCAGCAGGGGAAGGCTGG - Intronic
1058642970 9:107105148-107105170 CACATTAACCAGGGGGAACCTGG + Intergenic
1059663589 9:116425285-116425307 CACAGGTAGCAGGAAGAGGCAGG + Exonic
1060750470 9:126165272-126165294 AACAGGAGGAAGTGGGAAGCCGG - Intergenic
1060781593 9:126417058-126417080 CACAGGAAGCAGGGGACATGGGG - Intronic
1061188775 9:129070102-129070124 CAGAGGAAGCAGTGGGAGGGAGG + Intronic
1061517531 9:131098279-131098301 CCCAGGAAGCAGGGTGAGGGTGG - Intronic
1061920256 9:133778700-133778722 CCCAGGGAGCAGGGAGGAGCTGG + Intronic
1062038445 9:134393057-134393079 CCCGGGAATCATGGGGAAGCGGG + Intronic
1062043073 9:134412907-134412929 CACAGGAAGCAAAGGCAGGCAGG - Intronic
1062097918 9:134712289-134712311 GACAGGAAGAAGGGGGAAGGAGG - Intronic
1062191644 9:135250913-135250935 CCCAGGAAGCAGGGTGGAGCCGG + Intergenic
1062478081 9:136739340-136739362 CACAGAAAGATGGGGGAAGGAGG - Intronic
1062578858 9:137221058-137221080 GGCGGGAAGCAGGGGGCAGCCGG + Exonic
1062606692 9:137351695-137351717 CACAGAAAGCAGGGGGCAGCTGG - Intronic
1185765567 X:2723343-2723365 CACAGGAAAGAAGGGGAAGAGGG + Exonic
1186334314 X:8570330-8570352 CACAGAATGCAGGGGCATGCCGG - Intronic
1186701583 X:12095897-12095919 CACAGGAAGCAGGATGGAGAGGG - Intergenic
1186740254 X:12509579-12509601 CAGAGGAAAGAGTGGGAAGCAGG + Intronic
1186994678 X:15107364-15107386 CACAGGAAACAGTGGCAAACAGG - Intergenic
1187209972 X:17219886-17219908 GGCAGAAAGCAAGGGGAAGCAGG - Intergenic
1188284860 X:28315217-28315239 CCAAGGAAGGAGAGGGAAGCAGG + Intergenic
1189025963 X:37394707-37394729 CACAGGAAGCCTGGGAAAGAGGG + Intronic
1189316862 X:40062710-40062732 CACAGGCCCCAGAGGGAAGCCGG + Intronic
1189831677 X:44980978-44981000 AACATGAAGTAGGGGGAAGAGGG - Intronic
1190087122 X:47405089-47405111 CACAAGAAGAAGGGGGAGGCCGG + Intronic
1190233860 X:48601461-48601483 GCCAGGGAGCAGGGGAAAGCTGG + Intronic
1191805147 X:65127789-65127811 GTCAGGAAGTAGGGGAAAGCTGG + Intergenic
1192789303 X:74365674-74365696 TACAGGCAGCAGAGGGAACCTGG + Intergenic
1194048442 X:89037194-89037216 CACAGGGAGAGAGGGGAAGCAGG + Intergenic
1194241568 X:91456324-91456346 CACAGGGAGCAGAGAGTAGCAGG - Intergenic
1194901715 X:99520238-99520260 CATAGGCAGCAGAGGGTAGCAGG - Intergenic
1196175036 X:112630927-112630949 CACAAGGTGCGGGGGGAAGCAGG + Exonic
1196804995 X:119575312-119575334 CAGATGAAGCAGGGAGAAGGGGG + Intronic
1197755030 X:129987435-129987457 CCCAGGAAGCAGAGGTTAGCTGG + Intronic
1199159226 X:144587611-144587633 CACAGGGAGCAGGGGGTAACAGG + Intergenic
1199586812 X:149423549-149423571 CCAAGGAAGTAGGGGAAAGCTGG - Intergenic
1199616683 X:149661342-149661364 CATACGAAGCAGGGGGATGGGGG + Intergenic
1199625958 X:149741906-149741928 CATACGAAGCAGGGGGATGGGGG - Intergenic
1199800791 X:151248645-151248667 CAGAGCCAGAAGGGGGAAGCTGG + Intergenic
1200063070 X:153492152-153492174 GGGAGGAGGCAGGGGGAAGCAGG - Intronic
1200150737 X:153950181-153950203 CCCAGGAAGCCGGGTGCAGCAGG - Intronic
1200254499 X:154572733-154572755 CACAGGAAGCGGGGAGATCCAGG + Intergenic
1200263270 X:154631675-154631697 CACAGGAAGCGGGGAGATCCAGG - Intergenic
1200332659 X:155313911-155313933 CCAAGGAAGTAGGGGAAAGCTGG - Intronic
1201365764 Y:13204773-13204795 CACAGGAAAGAGGAGGAAACTGG - Intergenic