ID: 1141513726

View in Genome Browser
Species Human (GRCh38)
Location 16:84529120-84529142
Sequence ACGGTTTCTGCCACTCTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 85}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141513720_1141513726 11 Left 1141513720 16:84529086-84529108 CCAGGCTAAGCACTGCCAAAGTG 0: 1
1: 0
2: 0
3: 26
4: 160
Right 1141513726 16:84529120-84529142 ACGGTTTCTGCCACTCTAAAGGG 0: 1
1: 0
2: 0
3: 4
4: 85
1141513723_1141513726 -4 Left 1141513723 16:84529101-84529123 CCAAAGTGTGGTGATGGACACGG 0: 1
1: 0
2: 1
3: 6
4: 74
Right 1141513726 16:84529120-84529142 ACGGTTTCTGCCACTCTAAAGGG 0: 1
1: 0
2: 0
3: 4
4: 85
1141513719_1141513726 23 Left 1141513719 16:84529074-84529096 CCTTGCTGGGCACCAGGCTAAGC 0: 1
1: 1
2: 1
3: 28
4: 248
Right 1141513726 16:84529120-84529142 ACGGTTTCTGCCACTCTAAAGGG 0: 1
1: 0
2: 0
3: 4
4: 85
1141513717_1141513726 29 Left 1141513717 16:84529068-84529090 CCTACTCCTTGCTGGGCACCAGG No data
Right 1141513726 16:84529120-84529142 ACGGTTTCTGCCACTCTAAAGGG 0: 1
1: 0
2: 0
3: 4
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141513726 Original CRISPR ACGGTTTCTGCCACTCTAAA GGG Intronic
905928695 1:41771012-41771034 ATGGTTTGTGGCCCTCTAAAGGG + Intronic
906536886 1:46555930-46555952 TCAGTTTCTTCAACTCTAAATGG - Intergenic
907163080 1:52385810-52385832 ATGGTTCCTGCCTCTCTGAAGGG + Intronic
912040745 1:105386793-105386815 ACTATTTCTGACACTCTATATGG - Intergenic
916919864 1:169453505-169453527 ACAGAATCTGCCACTCTAATGGG + Intronic
921988199 1:221335256-221335278 ACAGTTTCTGCATCACTAAATGG - Intergenic
1065711430 10:28521983-28522005 ACAGTATCTGCCACTATGAAGGG + Intergenic
1071406545 10:85339757-85339779 TGGGTTTCTGCCATTCTAACAGG - Intergenic
1073863921 10:107779451-107779473 ACGGTATCTGACACTATAACTGG + Intergenic
1075857736 10:125644694-125644716 ACAGGTTCTGCCACACTCAAGGG - Intronic
1076048649 10:127314910-127314932 AAGGTTTCTGCCACTCACATGGG + Intronic
1076054830 10:127364009-127364031 ACGGTGCCTGGCACTATAAAAGG + Intronic
1082771835 11:57213702-57213724 ACTGTCTCTGCCACCCCAAATGG - Intergenic
1083401726 11:62428009-62428031 GGGGTGTCTGCCACTCAAAATGG + Intergenic
1084417719 11:69043074-69043096 TCAGTTTCTCCCTCTCTAAAAGG + Intergenic
1092247142 12:6869999-6870021 ACCTTTTCTGCCTCTCTAAGAGG - Intronic
1092407272 12:8229793-8229815 ACGGTTTTTGCCATTAAAAATGG + Intergenic
1098575216 12:72034087-72034109 ACGGTTACTGCTATTCCAAATGG - Intronic
1103808840 12:123597191-123597213 ACGGTTTCTGCCCGTCCTAATGG + Exonic
1109956850 13:69580335-69580357 AGGGTGTCTGCCAATATAAAGGG - Intergenic
1117685349 14:58247675-58247697 ACAGTTTCTTCCCCTCTAAATGG - Intronic
1119978766 14:79055853-79055875 TCTGCTTCTGTCACTCTAAATGG - Intronic
1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG + Intronic
1124468819 15:29965064-29965086 AAGGCTTCTGCCAGTGTAAAGGG - Intronic
1127890013 15:63242057-63242079 GCGGTTTTTGCCATTCTTAATGG + Intronic
1141513726 16:84529120-84529142 ACGGTTTCTGCCACTCTAAAGGG + Intronic
1142064816 16:88055703-88055725 AGGCTTTAGGCCACTCTAAATGG + Intronic
1144000178 17:11046687-11046709 AGGGTTTCTTTAACTCTAAAAGG + Intergenic
1144269805 17:13604707-13604729 AAGCTTGCTGCCACTCTCAAGGG - Intergenic
1145109450 17:20149353-20149375 AGGGTTCCTGCCACCCTAATTGG + Intronic
1148215362 17:45831047-45831069 ATGGTTTCTGCATCTATAAAGGG + Intronic
1149438394 17:56653770-56653792 AGAGTTTCTGCCAGTCTAATTGG + Intergenic
1152716153 17:81901845-81901867 GCGGTTTCTACCACCCTAAGGGG - Intronic
1156501176 18:37559450-37559472 GTGGTTTCAGCCACTGTAAACGG + Intronic
1157866625 18:51192771-51192793 TCTGTTTCTACCTCTCTAAACGG + Intronic
1159190426 18:65034784-65034806 AAGATCACTGCCACTCTAAAAGG - Intergenic
1163515464 19:17760490-17760512 ACTTTTTCTGCCACTCTCAATGG - Intronic
1164299529 19:23948813-23948835 ACGGTTTATGACACTTTCAAAGG - Intergenic
1165631740 19:37307040-37307062 AGGATTTCTGCCACTCAGAATGG - Intergenic
1166930797 19:46300076-46300098 TCAGTTTCTGCCTCTTTAAAAGG + Intronic
1167574433 19:50311201-50311223 CCTGTTTCCACCACTCTAAAAGG - Intergenic
929060478 2:37919266-37919288 ACAGTTTCTGCTTCTTTAAAAGG + Intergenic
931373884 2:61689771-61689793 TCATTTTCTCCCACTCTAAAAGG - Intergenic
936263098 2:110979213-110979235 ATGGTTTCAGCCACTTTAGATGG - Intronic
944134943 2:196388932-196388954 ATGGTTACTGCCACTCTGAGGGG + Intronic
945813992 2:214581628-214581650 ACAGTGTCTGCCACTCAGAAGGG - Intergenic
1174867414 20:54150884-54150906 ACAGGTTCTGCCCCTGTAAAGGG - Intergenic
1177891366 21:26808012-26808034 CCTGTTTATGCCACTCTACATGG + Intergenic
1178776377 21:35554940-35554962 AGGGTTTCTGTACCTCTAAATGG - Intronic
1182787738 22:32921677-32921699 TCAGTTTCTTCCTCTCTAAATGG + Intronic
1184345143 22:43908640-43908662 TCAGTTTCTGCAACTGTAAAAGG - Intergenic
949159572 3:864116-864138 ACTGTATCTGCTACTGTAAATGG + Intergenic
949535151 3:4989604-4989626 AAGGTTTCTTCCACTATAGATGG + Intergenic
952498091 3:33933840-33933862 CCGGTTTTTGCCACTTTTAATGG - Intergenic
956456381 3:69424662-69424684 TCTGTTTCTGCCAATCTAATAGG - Intronic
958531228 3:95333400-95333422 ATGGTTTTTGCCACCCTTAAAGG - Intergenic
961885934 3:130096394-130096416 ACGGTTTTTGCCATTAAAAATGG + Intronic
968995120 4:3940541-3940563 ACGGTTTTTGCCATTAAAAATGG + Intergenic
969758867 4:9168251-9168273 ACGGTTTTTGCCATTAAAAATGG - Intergenic
973832958 4:54780311-54780333 AATGCTTGTGCCACTCTAAAAGG + Intergenic
974135737 4:57814976-57814998 AGGATTTCTGCCACTTTACAAGG - Intergenic
977439353 4:97042849-97042871 AAGGTTTCTTTCACTCAAAATGG + Intergenic
977888633 4:102281031-102281053 ACTATTTATACCACTCTAAAAGG + Intronic
978614031 4:110575653-110575675 AAGCTTTGTGCCACTCTAGAAGG - Intergenic
980641645 4:135587549-135587571 ACGTTTTCTTCTACTCTAGAAGG + Intergenic
990054579 5:51556237-51556259 GAGGTTTCTGCCACTATTAATGG + Intergenic
990604402 5:57394472-57394494 AGGGTTATTGCCAGTCTAAAGGG - Intergenic
991449367 5:66735704-66735726 ACGGGATCTGCGACTCTTAAAGG + Intronic
993707361 5:91186271-91186293 ACGGTTTCTGGCACCCAACATGG + Intergenic
995005959 5:107195598-107195620 ACGGTTTCTGCCTCCCCAAGAGG + Intergenic
995648133 5:114336759-114336781 GCGCTTTCTGTCACTCTGAATGG - Intergenic
999610469 5:153363965-153363987 ACAGTTTCTGTCAGTCCAAAGGG - Intergenic
1008818360 6:55598333-55598355 AATGTTTCTGCCACAGTAAATGG + Intergenic
1011663908 6:89617167-89617189 GCGGTCTCTGCCCCTCTGAATGG + Intronic
1015836971 6:137431182-137431204 ACAGTTTCTGTCCCACTAAAGGG - Intergenic
1017076924 6:150627404-150627426 AGGGTTTCTTCCACTCAGAAGGG + Intronic
1018047658 6:159979493-159979515 ACGCTGCCTGTCACTCTAAAGGG - Intronic
1021093624 7:16510746-16510768 AGGGCTATTGCCACTCTAAATGG + Intronic
1021901135 7:25286879-25286901 ACAGTTTCTGGCACCCAAAAAGG - Intergenic
1024125125 7:46286501-46286523 ACGGTTTCAACCATTCTAATAGG + Intergenic
1028391207 7:90320012-90320034 AGGGTTTCTGCCACTTTTAAAGG - Intergenic
1030585136 7:111409193-111409215 ATGGTTTCTTCAACTTTAAATGG - Intronic
1030898102 7:115086480-115086502 ATGGTTTCTGCTACTCTTTATGG + Intergenic
1044484478 8:92735008-92735030 AGGGTGTCTGCACCTCTAAATGG + Intergenic
1050076062 9:1865478-1865500 ACAGTTCCTGCCACTCTAACTGG + Intergenic
1051735983 9:20199528-20199550 AGAGATTCTCCCACTCTAAAAGG - Intergenic
1192156218 X:68748517-68748539 CCTGTTTCTGCACCTCTAAATGG - Intergenic
1194432981 X:93834209-93834231 ATGGTTTGTGACCCTCTAAATGG - Intergenic
1195714276 X:107803422-107803444 GCCATTTTTGCCACTCTAAAAGG - Intergenic
1197811113 X:130443913-130443935 ACTATCCCTGCCACTCTAAATGG - Intergenic