ID: 1141515857

View in Genome Browser
Species Human (GRCh38)
Location 16:84544573-84544595
Sequence GAGGATGCCTGGGCCCTCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141515857_1141515864 -2 Left 1141515857 16:84544573-84544595 CCCACGAGGGCCCAGGCATCCTC 0: 1
1: 0
2: 1
3: 12
4: 149
Right 1141515864 16:84544594-84544616 TCTTAGGTCTGGAACAGAGAAGG No data
1141515857_1141515865 2 Left 1141515857 16:84544573-84544595 CCCACGAGGGCCCAGGCATCCTC 0: 1
1: 0
2: 1
3: 12
4: 149
Right 1141515865 16:84544598-84544620 AGGTCTGGAACAGAGAAGGAAGG 0: 1
1: 2
2: 1
3: 53
4: 457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141515857 Original CRISPR GAGGATGCCTGGGCCCTCGT GGG (reversed) Intronic
900152016 1:1182909-1182931 GAAGATGCCTTTGCCCTGGTTGG - Exonic
900235828 1:1589961-1589983 AAGGATGCCTGGGGCTTCCTTGG + Intergenic
900337511 1:2171943-2171965 GAGGATGCCGGGCCCGTGGTGGG + Intronic
900373976 1:2344928-2344950 GAGCATGCGTGGACCCTCGCGGG - Intronic
903604742 1:24567448-24567470 CAGAATGCCTGGGCCCTAGTGGG - Intronic
905226613 1:36482996-36483018 GGGGCTGCCTGTGCCCTCGAAGG - Exonic
905811580 1:40917123-40917145 CAGGATGCCAGGGCCCACTTGGG + Intergenic
907489661 1:54800864-54800886 GAGGTTGCCCGGGTGCTCGTGGG + Exonic
907644560 1:56229304-56229326 GTGGCTGCCTGAGCCTTCGTGGG + Intergenic
908154768 1:61341565-61341587 GAGGATCCCTGGGGCCTGGGAGG - Intronic
911449340 1:98045024-98045046 AAGCATGCCTGGGCACTCCTGGG - Intergenic
914816703 1:151068672-151068694 GAGGATCCCTTGACCCTGGTGGG - Intronic
918194471 1:182208538-182208560 GAGGATGACTGGAACCTTGTAGG - Intergenic
923251291 1:232181547-232181569 GAGGATGCAGAGGCCCTCATGGG + Intergenic
1062834069 10:624571-624593 GGGGCTGCCCGGGCCCCCGTGGG - Intronic
1064302167 10:14132432-14132454 GAGGCTGCCTGGGGTCTCCTGGG + Intronic
1064999754 10:21327787-21327809 GAAGATGCCGGACCCCTCGTGGG - Intergenic
1066994517 10:42551946-42551968 GAGGGTGCAGGGGCCCTCCTAGG - Intergenic
1070846110 10:79523834-79523856 GAGGGAGCCTGGGCCCTGGGAGG + Intergenic
1070927688 10:80236476-80236498 GAGGGAGCCTGGGCCCTGGGAGG - Intergenic
1072257129 10:93631142-93631164 GAGGAGGCCTGGGGCCTCCCCGG + Intronic
1076303169 10:129443205-129443227 GAAGGTGCCAGGGCCCTTGTGGG - Intergenic
1076691920 10:132228162-132228184 GAGGACGCCTGGGGACACGTGGG + Intronic
1077290039 11:1784856-1784878 GAGGATGGGTGGGCCCAGGTGGG - Intergenic
1078083972 11:8222878-8222900 AAGGATGGCTGGGCACTCCTGGG - Intergenic
1078462131 11:11522120-11522142 GAAGAGGCCTGGGGCCTCCTAGG - Intronic
1081112128 11:39149284-39149306 GAGGTTCCCTGGGCCCTGGGTGG - Intergenic
1083158448 11:60840130-60840152 GAGGATCCCTGGGGCCTGGGAGG + Intergenic
1084054650 11:66624669-66624691 GAGGCTGCCTGGGCTGTCATGGG - Exonic
1084465671 11:69321558-69321580 GAGGATGCCTGGGTCGTCCTGGG - Intronic
1085531462 11:77194573-77194595 GATGAGGCCTGGGACCTCCTTGG - Intronic
1091370000 11:135049843-135049865 AAGGCTGCCTGGGGCCTCCTAGG - Intergenic
1091703224 12:2677625-2677647 GAGGATGCCAGGGCCCTGGAGGG + Intronic
1104587171 12:130056748-130056770 TAAGATGCCTGGGCCCTCGGGGG + Intergenic
1105503114 13:20989189-20989211 GCCGAAGCTTGGGCCCTCGTAGG + Exonic
1113634575 13:111910673-111910695 GAGGCTGCCTGGGCCCCTGCAGG - Intergenic
1115562152 14:34592651-34592673 GAGGATGCCTTGGGCCTGGGAGG - Intronic
1121049742 14:90812592-90812614 CCGGAAGCCTAGGCCCTCGTGGG - Intronic
1121964465 14:98291178-98291200 CAGGATGGCTGGGCTCTGGTGGG + Intergenic
1124625743 15:31306629-31306651 GAGGAAGCCAGGGCCCTCCCGGG - Intergenic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1128146469 15:65334828-65334850 GAGGATGGCTGGCTCCTTGTAGG + Exonic
1128728549 15:70005622-70005644 GAGAGTGCCTGGGTCCTCGATGG - Intergenic
1129580089 15:76799689-76799711 GACAAAGCCTGGGCCGTCGTGGG - Intronic
1129795690 15:78374486-78374508 GAGGTAGCCTTGGCCCTCGTGGG - Intergenic
1133035295 16:3030872-3030894 GAGGATGCCTGGGTCCCCAGCGG - Intronic
1136153073 16:28364872-28364894 GAGGTTGCCGTGGCTCTCGTTGG - Intergenic
1136210010 16:28750401-28750423 GAGGTTGCCGTGGCTCTCGTTGG + Intergenic
1140205546 16:72929635-72929657 GAGGATGCCTGGGGCCACGCGGG + Intronic
1140320587 16:73947799-73947821 GAAGATCCCTGGGACTTCGTTGG - Intergenic
1140403464 16:74691167-74691189 GAGGAAGCCTGGGCCCTAAAGGG - Intronic
1141515857 16:84544573-84544595 GAGGATGCCTGGGCCCTCGTGGG - Intronic
1141719973 16:85750763-85750785 GGGGACGCCCGGGCCCGCGTGGG + Intronic
1141876543 16:86828892-86828914 GAGGTTGCCTGGGGCCTGCTGGG - Intergenic
1143399988 17:6637673-6637695 CAGGATGCCTGGGCCCATGGCGG - Intronic
1152441510 17:80312739-80312761 GAGGCTGCCTGGGCTTTCGGGGG + Intronic
1155619325 18:27758678-27758700 GGGGATGCCTGGGTCATCCTAGG + Intergenic
1156617231 18:38801752-38801774 GAGGATGCCAGGGCACTAGGAGG - Intergenic
1157469709 18:47979762-47979784 GAGGCTGGCTGTGGCCTCGTGGG - Intergenic
1158623473 18:59051921-59051943 CAGGATGACTGGCCCCTTGTTGG - Intergenic
1160708821 19:541437-541459 GAAGAGGTCTGAGCCCTCGTCGG - Exonic
1161169859 19:2807291-2807313 GAGGATGCTCGGCCCCTCGAGGG + Intronic
1161230521 19:3172698-3172720 TGGGATGCCTGTGCCCTCATGGG + Intronic
1161230617 19:3173121-3173143 TGGGATGCCTGTGCCCTCATGGG + Intronic
1161230649 19:3173257-3173279 TGGGATGCCTGTGCCCTCATGGG + Intronic
1161230670 19:3173352-3173374 TGGGATGCCTGTGCCCTCATGGG + Intronic
1161230698 19:3173485-3173507 TGGGATGCCTGTGCCCTCATGGG + Intronic
1161230703 19:3173504-3173526 TGGGATGCCTGTGCCCTCATGGG + Intronic
1161230834 19:3174099-3174121 TGGGATGCCTGTGCCCTCATGGG + Intronic
1161230869 19:3174235-3174257 TGGGATGCCTGTGCCCTCATGGG + Intronic
1161231163 19:3175540-3175562 TGGGATGCCTGTGCCCTCATGGG + Intronic
1161231196 19:3175676-3175698 TGGGATGCCTGTGCCCTCATGGG + Intronic
1162084946 19:8242984-8243006 CTGGATGCCTGGGCCTTCCTAGG + Intronic
1163789435 19:19297819-19297841 GAGGCTGCCTGCCCCCACGTGGG - Intronic
1165769112 19:38368116-38368138 CTCGATGCCTGGGCTCTCGTGGG - Exonic
1166297806 19:41897327-41897349 GTGGGTGCCTGGGCCCTGGGTGG + Intronic
925376838 2:3392273-3392295 GAGGATGCCTGGGACATGGCAGG - Intronic
925748818 2:7068896-7068918 GAGGCTGCCTGGCACCTCCTGGG + Intergenic
929544056 2:42844251-42844273 GAGGGTGCCAGGGCACTTGTTGG + Intergenic
936221246 2:110605190-110605212 GAGGAGGCAGGGGCCCTCGATGG - Intergenic
940625177 2:156166446-156166468 TATGATGCCTCGGCCCTTGTGGG - Intergenic
947615979 2:231557230-231557252 GAAGTTGGCTGGGCCCTCTTGGG - Intergenic
947893246 2:233644691-233644713 GAGAATCCCTGAGCCCTGGTGGG - Intronic
1168805376 20:669588-669610 GAGGAGGGCTGGGCCCTGCTGGG + Intronic
1169084159 20:2816499-2816521 GAAGATGCCTGGGACCTTGGGGG - Intronic
1170148618 20:13204977-13204999 GAGGATACCTAGGACCTTGTGGG + Intergenic
1171991553 20:31700432-31700454 GAGGATTCCAAGGCCCTCCTTGG - Intronic
1172213303 20:33216052-33216074 GAGGATGCAGGGACCCTCCTGGG + Intergenic
1172273266 20:33666534-33666556 GAGGCTGCCTGGGTCCTCAAGGG + Exonic
1173916186 20:46709985-46710007 GAGAGTGCCTGGGCCCGAGTGGG - Intronic
1175256741 20:57652416-57652438 GAGGGTGCAGGGGCCCTGGTAGG + Exonic
1175735738 20:61385839-61385861 CAGGAGGCCTGGGCACTCGGGGG - Intronic
1176115851 20:63431686-63431708 GAGGATGCCAGAGCCCTTGGCGG - Intronic
1179084657 21:38206488-38206510 GAGGATCCCTGGGACCTTGGTGG - Intronic
1180091366 21:45535225-45535247 GAGGTTGCCTGGGCCCCCGCTGG - Intronic
1180702754 22:17790630-17790652 GAGGAGGCCTGGCACCTCCTTGG - Exonic
1182099944 22:27650749-27650771 GAGGCTGCCTGGTCCCCCGTGGG - Intergenic
1182475724 22:30575303-30575325 GAGGATTCCTGGCCCCTGGCAGG - Intergenic
1182763649 22:32743213-32743235 GTGGATGCCTAAGCCCTGGTGGG + Intronic
1184036973 22:41922904-41922926 GTGGATGGCTGGGCCCATGTGGG + Intergenic
1184421515 22:44385209-44385231 GAGGCTGGCTGGGCCCTCACAGG - Intergenic
954686909 3:52376034-52376056 GAGGAGCCCTGGGCTCTGGTTGG + Intronic
955397455 3:58567171-58567193 GAGGATGCGTGGTCCCTGCTGGG + Intronic
956206730 3:66762626-66762648 GACGATGACAGGGCCCTCCTTGG + Intergenic
961102342 3:124210744-124210766 GTAGATGCCTGGGCCCCAGTTGG + Intronic
961475235 3:127141844-127141866 GAGGAGGCCTGGGGCCTTGAGGG - Intergenic
962317447 3:134367630-134367652 GAGGAGGCCTGGGCACTCACTGG + Exonic
964089886 3:152862850-152862872 CAGGGTGCCTGAGCCCTGGTGGG + Intergenic
968703567 4:2067687-2067709 GGGGCTGTGTGGGCCCTCGTGGG + Exonic
968932289 4:3587454-3587476 GAGGAGGCCTGGGCCCAAGGTGG + Intronic
971431608 4:26574010-26574032 AAGCATGCCTGGTCCCTGGTAGG - Intergenic
980158235 4:129132294-129132316 GAGGATCCCTGGGCCCCAGGAGG - Intergenic
984648851 4:182247707-182247729 GAGGTTGCCTGAGCCATCCTTGG - Intronic
985725556 5:1514145-1514167 GGAGATGCCAGGGCCCTCCTGGG + Intronic
985931140 5:3058686-3058708 GTGTATGCCTGGCCCCTCCTGGG + Intergenic
991443312 5:66674335-66674357 GAGGGTTTCTGGACCCTCGTGGG + Intronic
992614576 5:78535940-78535962 GAGAATGCCTAGGTCCCCGTAGG - Intronic
996016257 5:118537427-118537449 GAAGGTGCCTGAGCCCTAGTAGG + Intergenic
1000138371 5:158376990-158377012 GAGGTTGTCTGGGCCCTGCTGGG + Intergenic
1001924616 5:175627179-175627201 GAGGATGGCTGAGGCCTCGGCGG + Intergenic
1001959544 5:175871959-175871981 GAGGAAGCGTGGGCCCTAGCCGG + Intronic
1002426437 5:179179233-179179255 GACCATGCCTGGCCCCTAGTAGG + Intronic
1003094421 6:3131374-3131396 GAGGAGGACTGGGCCCTCGAGGG - Intronic
1003507400 6:6751283-6751305 TAGGATGCCAGGGCCCTCAGAGG + Intergenic
1005952410 6:30641787-30641809 GAGGAACCCAGGGTCCTCGTTGG + Intronic
1007935427 6:45728178-45728200 GCTGATGCCTGGACCCTGGTCGG - Intergenic
1010339548 6:74732308-74732330 GAGAATGTCTGTGACCTCGTAGG - Intergenic
1010927643 6:81763323-81763345 GAGAATGCCTGGTCCTTTGTAGG + Intergenic
1013203840 6:107928397-107928419 GAGGATGCCTGAGCCCAAGGAGG + Intronic
1017113917 6:150959286-150959308 GAGAATGGCTGTGCCCTGGTGGG - Intronic
1017162639 6:151380471-151380493 GAGGATGCCAGGGCCCTAGCTGG - Intronic
1018639796 6:165895775-165895797 GAGGATGCCGAGGCCCTCACAGG - Intronic
1019026117 6:168964273-168964295 GAGGAAGCCAGGCCCCTCTTGGG + Intergenic
1019519288 7:1453433-1453455 GAGCAGGGCTGGGCCCTCCTGGG - Intronic
1024422776 7:49188757-49188779 AAGAATTCCTGGGCCCTCTTTGG + Intergenic
1024604185 7:51011278-51011300 GAGGATGCCTGGTCTCCCATGGG + Intergenic
1024647516 7:51382649-51382671 GAGGAGCCCTGGGCCCTCAGGGG + Intergenic
1025025818 7:55515285-55515307 GAGGTTACCTGGGCCTTCCTCGG - Intronic
1025263561 7:57438510-57438532 GAGGATGCCTCGGTCCCCCTAGG - Intergenic
1025635676 7:63317623-63317645 GAGGATGCCTCGGTCCCCCTAGG + Intergenic
1025647020 7:63430557-63430579 GAGGATGCCTCGGTCCCCCTAGG - Intergenic
1026891462 7:73985260-73985282 GAGGATGCCTGGGGCGTGGGGGG + Intergenic
1026979856 7:74519800-74519822 CAGGATGCCTGGGCCCTCTTAGG + Intronic
1028257738 7:88621233-88621255 GGGGATGCCTGGGCTCCTGTTGG - Intergenic
1030059395 7:105610897-105610919 GGAGATGCCTGGCCCCTCCTGGG + Intronic
1032495686 7:132360383-132360405 GATGATGCCTGGGACCTGGCGGG - Intronic
1033569762 7:142616334-142616356 CAGGATGCTGGGGCCCTCTTTGG - Intergenic
1034933840 7:155185471-155185493 GAGGATGCCTGGACCCAAGCAGG - Intergenic
1035293558 7:157854934-157854956 GAGGATGGCTGTGCCGTTGTAGG + Intronic
1035336674 7:158133786-158133808 CCAGATGCCTGGGCCCTCGAAGG - Exonic
1049463655 8:142741408-142741430 GAGGAGGGCTGGGCCCTGGGTGG - Intronic
1054457842 9:65444474-65444496 GAGGAGGCCTGGGCCCAAGGTGG - Intergenic
1057093170 9:92278981-92279003 GAGGATACCTGGGGCATCCTAGG + Intronic
1060053930 9:120397115-120397137 GAGGAAGCCTGAGGCCTCCTGGG - Intronic
1061244066 9:129392272-129392294 CAGGAGGCCTGGGCCCTGGGTGG - Intergenic
1061407990 9:130403260-130403282 GGGGATGCCTGAGGCCTCGCAGG - Intronic
1062309832 9:135929727-135929749 GAGGATGCCTGGTGCCTGGCTGG - Intergenic
1062359139 9:136179158-136179180 GAGGCTGGCTGGGCCCTCTGTGG - Intergenic
1062360724 9:136186680-136186702 GGGGATGCCTCAGACCTCGTGGG + Intergenic
1195908275 X:109865956-109865978 AAGGTTGCCTGGGACCACGTTGG + Intergenic
1197881974 X:131176526-131176548 GAGGATGCCTGGGACATAATAGG - Intergenic
1200069220 X:153519551-153519573 GGGGATGCCTGGGCCCCTGTGGG + Intronic
1201469952 Y:14322238-14322260 GAGGATGCCTCTGACCTAGTAGG - Intergenic