ID: 1141517031

View in Genome Browser
Species Human (GRCh38)
Location 16:84552365-84552387
Sequence CTGTCTGCACAGAGGTATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141517031_1141517038 -8 Left 1141517031 16:84552365-84552387 CCCAAATACCTCTGTGCAGACAG 0: 1
1: 0
2: 0
3: 28
4: 175
Right 1141517038 16:84552380-84552402 GCAGACAGCGGCAGGGTAGAGGG 0: 1
1: 0
2: 2
3: 17
4: 267
1141517031_1141517040 9 Left 1141517031 16:84552365-84552387 CCCAAATACCTCTGTGCAGACAG 0: 1
1: 0
2: 0
3: 28
4: 175
Right 1141517040 16:84552397-84552419 AGAGGGACTGTCCACACTGGAGG 0: 1
1: 0
2: 0
3: 12
4: 149
1141517031_1141517037 -9 Left 1141517031 16:84552365-84552387 CCCAAATACCTCTGTGCAGACAG 0: 1
1: 0
2: 0
3: 28
4: 175
Right 1141517037 16:84552379-84552401 TGCAGACAGCGGCAGGGTAGAGG 0: 1
1: 0
2: 4
3: 19
4: 249
1141517031_1141517039 6 Left 1141517031 16:84552365-84552387 CCCAAATACCTCTGTGCAGACAG 0: 1
1: 0
2: 0
3: 28
4: 175
Right 1141517039 16:84552394-84552416 GGTAGAGGGACTGTCCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141517031 Original CRISPR CTGTCTGCACAGAGGTATTT GGG (reversed) Intronic
905927036 1:41758479-41758501 CTGTCTTCAGACAGGTCTTTTGG - Intronic
906594794 1:47066168-47066190 CTGGCTTCACAGAGTGATTTAGG - Intergenic
908209419 1:61884987-61885009 CTGTCTGGACATGGGTAATTGGG + Intronic
909318285 1:74251109-74251131 CTCTCTGCACAGAGGCATCATGG - Intronic
910399366 1:86823355-86823377 CTATCTTCAGAGAGGTATCTGGG - Intergenic
916505529 1:165425097-165425119 ATGTCTGTACAGAGGGATTGGGG - Intronic
916608586 1:166367370-166367392 GTTTTTGCACAGAGGTAGTTGGG - Intergenic
920093344 1:203469996-203470018 CAATTTGCACAGAGGGATTTAGG + Intergenic
920224938 1:204431630-204431652 CTATCTGCACAGAGGGATGTCGG - Intronic
1066929797 10:41743392-41743414 TTGTCTGCAAAGGGATATTTCGG + Intergenic
1069787596 10:70998567-70998589 CTCTTTGCACAGAGGTATTATGG + Intergenic
1070617481 10:77979900-77979922 CTGTCAGCACAGATGGTTTTTGG - Intronic
1072552940 10:96493182-96493204 CTGTAGGCACAGAGAGATTTAGG + Intronic
1073077805 10:100835700-100835722 CTCTCTGCCCAGAGGTCTCTGGG + Intergenic
1074335529 10:112570649-112570671 ATGTATGCACAGAGGTATTCTGG - Intronic
1076022540 10:127085915-127085937 CAGGCTGCACACAGGCATTTGGG + Intronic
1076429679 10:130393028-130393050 CTGGCTACACAGATGTACTTGGG - Intergenic
1076480664 10:130783267-130783289 CTTTGAGCACAGCGGTATTTCGG + Intergenic
1076739600 10:132476740-132476762 ATGTCTGCACTGAGGTCTTTGGG + Intergenic
1078971697 11:16420510-16420532 TTCTCTGCCCAGATGTATTTGGG - Intronic
1080144964 11:28970512-28970534 TTGACTGCTTAGAGGTATTTGGG - Intergenic
1081800996 11:45859238-45859260 CTGTGTGAACAGAGGTCTGTTGG - Intronic
1082306422 11:50582219-50582241 GTGTCTGCAAAGGGATATTTGGG + Intergenic
1082312308 11:50666742-50666764 CAATCTGCACAGGGCTATTTGGG - Intergenic
1082602592 11:55177021-55177043 CTATCTGCAAAGGGATATTTGGG - Intergenic
1084962544 11:72724900-72724922 CTGTCTGAACATAGCCATTTAGG - Intronic
1089182923 11:116595323-116595345 GTGTCTGCCCAGAGGTATCAAGG + Intergenic
1089700033 11:120239217-120239239 CTGTCTGCACACAGCTTTCTGGG + Intronic
1090667831 11:128926638-128926660 CTGTCTGCGGAGAGCTATTCTGG + Intergenic
1090917155 11:131175565-131175587 CTGTGTTCACATTGGTATTTTGG + Intergenic
1092960472 12:13592325-13592347 CTGTTTGGAAGGAGGTATTTGGG - Intronic
1094310814 12:29080289-29080311 CTTTCTTCACAGAGGTATTCTGG + Intergenic
1094863732 12:34502793-34502815 CAATCTGCACAGGGATATTTTGG - Intergenic
1094869554 12:34584989-34585011 GAATCTGCAAAGAGGTATTTGGG - Intergenic
1096145622 12:49276784-49276806 ATGTCTGGGCAGAGGTGTTTTGG + Intergenic
1102654626 12:114471515-114471537 CTGTCTACACAGAGGTGATTTGG + Intergenic
1103642075 12:122359525-122359547 CTGTCTGAACACAGGGGTTTGGG + Intronic
1104759880 12:131290572-131290594 GTGTGTACACAGAGGTATATGGG - Intergenic
1106119724 13:26850022-26850044 CTGTCTGCACAAACTTATTTTGG - Intergenic
1109698190 13:65989458-65989480 CTGTCTGCACATAGTTCTGTTGG + Intergenic
1109985948 13:69984809-69984831 CAGCCTGCACAGAAGTTTTTAGG - Intronic
1110507267 13:76301513-76301535 CTGTCTGAACATAGGTACATGGG - Intergenic
1111727082 13:92025344-92025366 CTGTGTACACAGAAGTGTTTTGG - Intronic
1113647451 13:112008985-112009007 CTGTCAGCACGGAGGAATCTAGG + Intergenic
1115088335 14:29544000-29544022 CTGTCTGGACAGTGCTATTCAGG - Intergenic
1115523803 14:34259329-34259351 CTGTCTGCAAAGAGGAAAGTGGG + Intronic
1118182009 14:63503168-63503190 CTGTATGTACAGAGGGATTTTGG + Intronic
1122629681 14:103101875-103101897 CTGGCTGAACAGAGCAATTTGGG - Intronic
1122994521 14:105255679-105255701 CTGTCTGCACAGGGGTCCCTGGG + Intronic
1124391446 15:29262396-29262418 CTGTCTGCTCAGAGTTTTCTTGG - Intronic
1127625731 15:60778453-60778475 TTGTCTGCACCGAGGTAACTGGG - Intronic
1128335128 15:66780896-66780918 CTGTCTGCACAGTGGGAGCTGGG - Intronic
1129748419 15:78041777-78041799 CATTCTTCACAGAGGTTTTTGGG - Intronic
1130153919 15:81333394-81333416 TTGTGTGCACAGAGACATTTGGG + Intronic
1130617842 15:85429376-85429398 CTTGCTGCACAGAGGTAGTCAGG - Intronic
1131442298 15:92468145-92468167 CAGTGTGCACAGAGGTAATCTGG - Exonic
1134515931 16:14886951-14886973 ATTTCTGCAGAGTGGTATTTAGG - Intronic
1134703603 16:16285595-16285617 ATTTCTGCAGAGTGGTATTTAGG - Intronic
1134963940 16:18426519-18426541 ATTTCTGCAGAGTGGTATTTAGG + Intronic
1134968227 16:18509055-18509077 ATTTCTGCAGAGTGGTATTTAGG + Intronic
1136690066 16:32022522-32022544 CTGTCTCCAAAGAGGTCTTTAGG + Intergenic
1136739548 16:32504060-32504082 GTGTCTGCAGAGGGATATTTGGG - Intergenic
1136774243 16:32863128-32863150 CTGGCTTCACAGAGGTATTGAGG + Intergenic
1136790655 16:32966083-32966105 CTGTCTCCAAAGAGGTCTTTAGG + Intergenic
1136879160 16:33887849-33887871 CTGTCTCCAAAGAGGTCTTTAGG - Intergenic
1136896368 16:33998386-33998408 CTGGCTTCACAGAGGTATTGAGG - Intergenic
1137497960 16:48985359-48985381 CTGACTCCCCAGAGATATTTGGG - Intergenic
1141517031 16:84552365-84552387 CTGTCTGCACAGAGGTATTTGGG - Intronic
1141530624 16:84644011-84644033 GTTTCTGCACAGAGGTATTGAGG + Intergenic
1142115731 16:88355200-88355222 CTGTCTGCACAGTGGACTCTGGG - Intergenic
1203013366 16_KI270728v1_random:323277-323299 GTGTCTGCAGAGGGATATTTGGG + Intergenic
1203014474 16_KI270728v1_random:340258-340280 GAATCTGCACAGGGGTATTTGGG - Intergenic
1203031701 16_KI270728v1_random:596436-596458 GTGTCTGCAGAGGGATATTTGGG + Intergenic
1203032809 16_KI270728v1_random:613417-613439 GAATCTGCACAGGGGTATTTGGG - Intergenic
1203040020 16_KI270728v1_random:737995-738017 GTGTCTGCAGAGGGATATTTGGG - Intergenic
1203076667 16_KI270728v1_random:1125247-1125269 CTGGCTTCACAGAGGTATTGAGG + Intergenic
1203092856 16_KI270728v1_random:1227541-1227563 CTGTCTCCAAAGAGGTCTTTAGG + Intergenic
1144824807 17:18099905-18099927 CAGCCAGCACAGAGGTATCTTGG + Intronic
1146888234 17:36486751-36486773 CAGGCTGGACAGCGGTATTTGGG - Exonic
1148255261 17:46125527-46125549 CTATATGGACAGATGTATTTGGG - Intronic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1155236370 18:23823519-23823541 CAGTTTGGACAGTGGTATTTGGG - Intronic
1156172048 18:34497058-34497080 CTATTTGCAAAGAGTTATTTAGG + Intronic
1158850232 18:61488839-61488861 CTGTCTACAGGGAGGTGTTTGGG - Intronic
1164365341 19:27574994-27575016 GAATCTGCACAGAGATATTTGGG + Intergenic
1164561870 19:29297999-29298021 CTGGATGCACAGAGGCATTGAGG + Intergenic
1167057835 19:47123854-47123876 CTGCCAGCCCAGAGATATTTTGG - Intronic
924965269 2:70808-70830 CAATCTCCACAGTGGTATTTAGG + Intergenic
925550456 2:5068422-5068444 CCGTCTGGACACAGGCATTTGGG - Intergenic
926085445 2:10016938-10016960 CTCTCTGCCCGGAGGTGTTTGGG + Intergenic
926218108 2:10917826-10917848 CTCACTGCACGGAGTTATTTTGG - Intergenic
928082420 2:28322934-28322956 TTTTCTGCTCAGAGGTATGTGGG - Intronic
928289565 2:30025532-30025554 TTGTCTGCAGAAAGGCATTTAGG - Intergenic
928371201 2:30741474-30741496 CTGTGTGCACATAGGTGGTTTGG + Intronic
929517229 2:42614850-42614872 CTGTATTCCCAGAAGTATTTGGG + Intronic
934901984 2:98166838-98166860 ATTTCTGCATAGAGTTATTTTGG - Intronic
941091926 2:161186623-161186645 CTGTCTGGGCAAAGATATTTTGG + Intronic
943066194 2:183089299-183089321 CTGCCTGTCCAGAGGTATTTTGG - Intronic
944204586 2:197144169-197144191 CTGTCTGCTCAGAGGCATTCAGG + Intronic
945904093 2:215571159-215571181 CTGTCTTCAGAGAAGTCTTTAGG + Intergenic
946808475 2:223496832-223496854 TTGCCTGCACAGAGATTTTTTGG + Intergenic
948392109 2:237619662-237619684 CTTTCTCCACAGAATTATTTTGG + Intergenic
1169058267 20:2641584-2641606 CTGTCTGAACCAAGATATTTGGG - Exonic
1171522696 20:25787655-25787677 CTGTCTGGTCAGAGGAACTTGGG + Intronic
1171530441 20:25849624-25849646 CTGTCTGGTCAGAGGAACTTGGG + Intronic
1171554131 20:26068228-26068250 CTGTCTGGTCAGAGGAACTTGGG - Intergenic
1173661433 20:44736974-44736996 CTGTCTGCACAGTGGAAGCTGGG - Intergenic
1174908108 20:54573791-54573813 ATGTTTGCAGAGAGGTATATAGG + Intronic
1176313073 21:5164919-5164941 ATGTCCGAACAGAGGTAATTGGG - Intergenic
1176368693 21:6049512-6049534 CTGTCTGCACAGAGATCCTTGGG + Intergenic
1179754826 21:43489030-43489052 CTGTCTGCACAGAGATCCTTGGG - Intergenic
1179843975 21:44097111-44097133 ATGTCCGAACAGAGGTAATTGGG + Intronic
1182254364 22:29027582-29027604 CTGTCAGCCCAGTGGTATGTCGG - Intronic
1184232261 22:43164659-43164681 CTGTCTGCACAGAGCTCTGGAGG - Intergenic
949990150 3:9572242-9572264 CTGTCTGCACATAGGGCTTTTGG + Intergenic
950175514 3:10870885-10870907 TTGTCTGCACTGTGGTCTTTGGG + Intronic
951183716 3:19688337-19688359 CTGGCCTCACAGAGGTCTTTTGG + Intergenic
952503788 3:33989240-33989262 CAGTCTGCACAGTGGTGTGTTGG + Intergenic
952710096 3:36421769-36421791 CTGTCTGCAGAAAGGTAATCTGG - Intronic
954904996 3:54053919-54053941 CTGTCTGCTCAGTGCTATGTTGG - Intergenic
956319180 3:67976463-67976485 CTGTGTGCACACAGATATTGTGG - Intergenic
959348745 3:105233085-105233107 CTGAATGCATAGAGCTATTTGGG + Intergenic
959941635 3:112086812-112086834 CTGTCTTCAGAGAGGTATTCCGG + Intronic
964468277 3:157022894-157022916 CTGAATGCAAAGAGTTATTTTGG - Intronic
967584609 3:191196576-191196598 TTGACTGCAAAGAGGCATTTAGG + Intergenic
971185906 4:24375777-24375799 TTCTCTGAACGGAGGTATTTAGG + Intergenic
972027682 4:34406007-34406029 CTGTGTGCACAGATATATGTGGG + Intergenic
974129176 4:57731531-57731553 CTGTGTGCAAAGAGGTTGTTTGG - Intergenic
974547440 4:63331094-63331116 GAATCTGCACAGAGATATTTGGG - Intergenic
976358707 4:84151749-84151771 GCGTCTGCACAGAGGGAATTAGG - Intergenic
977171269 4:93765736-93765758 CTTTCTTCTCAGTGGTATTTGGG - Intronic
978148593 4:105407853-105407875 TTGACTGCACAGGGGTATGTGGG + Intronic
979748774 4:124249778-124249800 CAGGCAGCACAGAGTTATTTGGG - Intergenic
979893335 4:126128598-126128620 GTGTCAGAACAGAGGTATCTGGG + Intergenic
982382304 4:154761899-154761921 CTTTCAGCATAGAGGTGTTTTGG - Intergenic
983030149 4:162790562-162790584 CTGCCTACACAGAGGTAGCTAGG + Intergenic
989830516 5:45912111-45912133 GAATCTGCACAGAGATATTTGGG - Intergenic
989849359 5:46189455-46189477 TTATCTGCAAAGAGATATTTGGG + Intergenic
989856030 5:46292856-46292878 CTCTCTGCAAAGGGATATTTGGG - Intergenic
991949157 5:71931256-71931278 CTGTCTCCAAAGATGAATTTGGG + Intergenic
993714667 5:91264145-91264167 CTGACTGAAAAGAGGTATTAGGG + Intergenic
993877453 5:93324832-93324854 CTGTCTACACATGGGTATCTTGG + Intergenic
994796981 5:104316336-104316358 CTGTCTTCACAGAGATAGTATGG + Intergenic
995886499 5:116900474-116900496 CTGTCTTGTCAGAGGTCTTTGGG + Intergenic
1000095366 5:157966806-157966828 CTGGCTGCTCAGAGGGATTTGGG - Intergenic
1002868820 6:1147516-1147538 CTGTCAGCACAGAGGTACCCTGG - Intergenic
1004747148 6:18522462-18522484 GTGTTTGGAAAGAGGTATTTTGG + Intergenic
1005129672 6:22491491-22491513 CTGTCTGGTCAGAGTTCTTTCGG + Intergenic
1005894629 6:30167398-30167420 GTGGCTGCACAAAGGCATTTGGG + Intronic
1006839860 6:37021806-37021828 CTGTCTGCACAGCTGTCTTGGGG + Intronic
1009799970 6:68524648-68524670 CTGGCTTCACAGAATTATTTAGG + Intergenic
1012180240 6:96143774-96143796 TTGTTTGCACAGAGGTAAGTGGG + Intronic
1013001363 6:106026023-106026045 CTGTATTAACAGAGGTACTTAGG + Intergenic
1014270308 6:119329033-119329055 CTGGCTGCACAGAGGTTTTCTGG - Intronic
1016286344 6:142477468-142477490 CTGTCTGCACAAAAGTATGGCGG + Intergenic
1017639084 6:156472959-156472981 CTTTCTGCCCACAGGTGTTTTGG - Intergenic
1018251689 6:161877878-161877900 CTGTCTACACGGGGGAATTTAGG - Intronic
1020053860 7:5103347-5103369 CTCTCTGGAGATAGGTATTTTGG + Intergenic
1021005130 7:15385234-15385256 CATTCTGCACAGAAGCATTTTGG + Intronic
1021292481 7:18863583-18863605 CTTTGTTCACAGATGTATTTTGG - Intronic
1021842163 7:24729613-24729635 CTGTCTGCACAGAGGCATGAAGG - Intronic
1021994841 7:26169516-26169538 CTGGCTGCCCACAGGTATGTGGG + Intronic
1024740029 7:52343396-52343418 TTGGGTGGACAGAGGTATTTTGG - Intergenic
1025524486 7:61787278-61787300 GTATCTGCAAAGAGATATTTTGG - Intergenic
1025527058 7:61827726-61827748 GTGTCTGCAGAGGGATATTTGGG - Intergenic
1025547847 7:62199496-62199518 GTATCTGCAAAGAGATATTTTGG - Intergenic
1025578658 7:62681749-62681771 CAATCTGCAAAGAGATATTTGGG + Intergenic
1025578881 7:62685001-62685023 GTATCTGCAAAGAGATATTTGGG + Intergenic
1025580909 7:62715588-62715610 GTATCTGCAAAGAGATATTTGGG + Intergenic
1025589291 7:62835643-62835665 CAGTCTGCAAAGGGATATTTGGG + Intergenic
1026382533 7:69813877-69813899 CTGTGGGCACACAGGGATTTTGG + Intronic
1026847664 7:73706794-73706816 CTGTGCGCCCAGAGGTATCTGGG - Intronic
1032615211 7:133461569-133461591 CTGTCTCCAGAGAGTAATTTGGG + Intronic
1033494948 7:141884653-141884675 CTGTCTTCACATATGTATTTAGG - Intergenic
1033900176 7:146128293-146128315 ATTACAGCACAGAGGTATTTGGG - Intronic
1035834742 8:2737261-2737283 CAGGCTGCACAGAATTATTTCGG + Intergenic
1035861642 8:3035085-3035107 ATGTCAGCACAGAGGTACTCAGG - Intronic
1040131059 8:43797275-43797297 GTATCTGCAAAGAGATATTTGGG + Intergenic
1040418895 8:47220984-47221006 CTGACAGAACAGAGGTTTTTTGG - Intergenic
1043468880 8:80542078-80542100 CTGATTCCACAGAGATATTTTGG + Intergenic
1045499425 8:102733577-102733599 CTGTATGCACACAGGTATGGAGG + Intergenic
1047628505 8:126680872-126680894 CTGTATGCACACAGGTTTTTTGG - Intergenic
1047715247 8:127589332-127589354 CCGTCAGCCCACAGGTATTTGGG + Intergenic
1050860734 9:10427028-10427050 ATTGCTGCAAAGAGGTATTTTGG + Intronic
1050891247 9:10827295-10827317 CTGGCTTCACAGAAGGATTTGGG + Intergenic
1051398529 9:16654047-16654069 CAGTCTGCACAGAGTGATCTGGG + Intronic
1056397003 9:86191011-86191033 CTGGCTTCACAGAGTGATTTAGG - Intergenic
1056588415 9:87944482-87944504 CTGTCTGCACACACGGACTTCGG - Intergenic
1059295813 9:113269351-113269373 TTGTTTTCACAAAGGTATTTAGG - Intronic
1186171964 X:6886640-6886662 CTATCTCCACAGAGATATCTTGG - Intergenic
1191668886 X:63730812-63730834 ATGTCTGCAAAAGGGTATTTGGG + Intronic
1192083732 X:68073289-68073311 CTTTCTCCACAGATCTATTTAGG - Exonic
1192205540 X:69093663-69093685 CTCCCTGCCCAGAGGTATGTGGG + Intergenic
1192433786 X:71129783-71129805 CTGTCTCCACAGAGATGTTGCGG - Exonic
1194527613 X:94996885-94996907 CTATCTGAACAGTGGTATATTGG - Intergenic
1196375018 X:115024415-115024437 CTGTTTGCAAACAAGTATTTGGG - Intergenic
1198616802 X:138466820-138466842 CTGGCTTCATAGAAGTATTTAGG - Intergenic
1198807494 X:140505521-140505543 TTGTCTGCACGGAGGTTTTCTGG + Intergenic
1199183140 X:144881921-144881943 TTGTATGCATAGAGGTATTCAGG - Intergenic
1199670873 X:150147220-150147242 CTGTCAGCACTGAGGTAGTTGGG - Intergenic
1199811930 X:151358308-151358330 CTGTCTGCAAAAAGGAATTCTGG + Intergenic
1201079149 Y:10218488-10218510 CAGTCTGCAAAGGGATATTTAGG - Intergenic
1201769611 Y:17606960-17606982 CTGCATGCACAGATGTGTTTGGG + Intergenic
1201831943 Y:18299025-18299047 CTGCATGCACAGATGTGTTTGGG - Intergenic