ID: 1141522824

View in Genome Browser
Species Human (GRCh38)
Location 16:84592822-84592844
Sequence ACGGGTCATCCATTTGTCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 53}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141522815_1141522824 28 Left 1141522815 16:84592771-84592793 CCGGAGGGGGTAACCAGCACGTT 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1141522824 16:84592822-84592844 ACGGGTCATCCATTTGTCCCCGG 0: 1
1: 0
2: 0
3: 4
4: 53
1141522820_1141522824 3 Left 1141522820 16:84592796-84592818 CCTTCAACAAGAAGCCGGGTGGT 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1141522824 16:84592822-84592844 ACGGGTCATCCATTTGTCCCCGG 0: 1
1: 0
2: 0
3: 4
4: 53
1141522816_1141522824 15 Left 1141522816 16:84592784-84592806 CCAGCACGTTCGCCTTCAACAAG 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1141522824 16:84592822-84592844 ACGGGTCATCCATTTGTCCCCGG 0: 1
1: 0
2: 0
3: 4
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141522824 Original CRISPR ACGGGTCATCCATTTGTCCC CGG Intronic
915837629 1:159190193-159190215 ACCAGTCATCCCTTTGTCCCTGG - Intronic
921277447 1:213533851-213533873 ACAGTCCAGCCATTTGTCCCAGG + Intergenic
922159204 1:223066165-223066187 ACGTGTCCTCCATCTGTCACAGG + Intergenic
1076087426 10:127647233-127647255 TTGGTTCATCCATTTGTCCATGG - Intergenic
1084978578 11:72816463-72816485 AGTGGTCATCCTTCTGTCCCTGG + Intronic
1090239637 11:125172875-125172897 TAGGAACATCCATTTGTCCCAGG - Intronic
1108357643 13:49642014-49642036 AGGGCTCATCCAGTTGTCCTAGG - Intergenic
1112176739 13:97033263-97033285 ACAAGTCATCCAGTTGTCCGTGG + Intergenic
1113848450 13:113404992-113405014 AATGGCCATCCCTTTGTCCCCGG + Intergenic
1117334119 14:54742276-54742298 ATGGCTTATCCATATGTCCCAGG - Intronic
1117627246 14:57652390-57652412 ATGGGTCCTCATTTTGTCCCAGG + Intronic
1126240986 15:46443108-46443130 ATGGGTGACCTATTTGTCCCTGG + Intergenic
1137566480 16:49535970-49535992 AGGGGTAATTCATGTGTCCCTGG - Intronic
1138559456 16:57792020-57792042 CCAGGACATCCATTTGTACCAGG + Intronic
1141139186 16:81486392-81486414 AAGGATCATCCATTTGTTCTTGG + Intronic
1141522824 16:84592822-84592844 ACGGGTCATCCATTTGTCCCCGG + Intronic
1144714360 17:17424004-17424026 GCGGGGCTTCCACTTGTCCCAGG - Intergenic
1147304524 17:39554074-39554096 ACGGGGCATCCATCTGTGCTAGG + Intronic
1149192407 17:54079208-54079230 ACAAGTCCTCTATTTGTCCCTGG + Intergenic
1158181503 18:54720720-54720742 ACAGGTCTACCATTGGTCCCTGG - Intronic
1163551354 19:17967727-17967749 CCGGGTCTTCCATCTCTCCCCGG + Intronic
1166659331 19:44635897-44635919 ATGGGTCATCCATTTGGGCTGGG + Intronic
934502426 2:94871150-94871172 TTGGTTCATCCATTTGTTCCTGG - Intergenic
936165671 2:110117103-110117125 ACTGATCATCCCTTTTTCCCAGG + Intergenic
940810786 2:158240559-158240581 CCAGGTCATCCATTTCTTCCAGG - Intronic
947109222 2:226700392-226700414 ACAGGACATCCATTTCTCTCTGG - Intergenic
1172873679 20:38151291-38151313 ACAGGTCATACATTTATCACAGG - Intronic
1177816338 21:25981133-25981155 AGGGGCCATTCATTTGGCCCTGG + Intronic
1178208367 21:30497301-30497323 ACAAGTCATTCATTTTTCCCTGG + Intergenic
953230126 3:41057508-41057530 TTGGGTCATGCATTTCTCCCTGG - Intergenic
954456868 3:50604404-50604426 AAGGCTCATCCCTTTGTTCCTGG + Intergenic
959201893 3:103255987-103256009 AATGTTCATCCATTTGTCCCAGG + Intergenic
961038851 3:123662960-123662982 GCGGGTTTTCCATTTGTCCTTGG - Intronic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
967510760 3:190308862-190308884 ACAGATGATCCATTGGTCCCAGG + Intronic
977684249 4:99829623-99829645 AGAGGTCATGCATTTGTCTCTGG - Intronic
984575109 4:181438717-181438739 ACGGCCCCTCCATCTGTCCCAGG - Intergenic
986623275 5:9698762-9698784 GCGGTTCAGCCACTTGTCCCTGG - Intronic
996822296 5:127643685-127643707 ATGGGTCATTCATTTGTCCATGG + Intergenic
1001730589 5:173952793-173952815 AAGGGTGATCCATCTGTCCAAGG - Intronic
1002871075 6:1167715-1167737 CCGGGTCATCCCTTGGGCCCTGG - Intergenic
1004481104 6:16019966-16019988 ACTGGGTATGCATTTGTCCCAGG - Intergenic
1005141585 6:22638031-22638053 ATGGATCATCCCTTTGTCCAGGG - Intergenic
1007009576 6:38402591-38402613 ATTGGACATCCAGTTGTCCCAGG - Intronic
1018659639 6:166074033-166074055 ACGGCTCCTCCACCTGTCCCTGG - Intergenic
1021849999 7:24798132-24798154 ATGTTTCATCCAGTTGTCCCTGG + Exonic
1023993242 7:45143048-45143070 CCAGGTCAGCCATTTGGCCCTGG + Intergenic
1027534254 7:79376611-79376633 GTGGATCATCCCTTTGTCCCAGG - Intronic
1027986810 7:85303004-85303026 TCAGGTTCTCCATTTGTCCCAGG - Intergenic
1032410514 7:131690689-131690711 ACAAGTCTTCCATTTGTCACCGG + Intergenic
1034967365 7:155399660-155399682 ACGGGTCTGCCAGTGGTCCCAGG - Intergenic
1037762632 8:21752004-21752026 GAGGTTCAGCCATTTGTCCCAGG - Intronic
1041760696 8:61363018-61363040 ACGGGTCATCAACTTGTAGCAGG + Intronic
1044949464 8:97421302-97421324 TCGGGTGATCCATTTCTCCTTGG + Intergenic
1056513496 9:87328334-87328356 ACGGGGCAAACATTTGACCCTGG - Intergenic
1193099133 X:77588203-77588225 TGTGGTTATCCATTTGTCCCAGG - Intronic
1199569726 X:149255295-149255317 ACTGGCCATTTATTTGTCCCTGG - Intergenic
1200162636 X:154017284-154017306 AGGGCTCATCCCTTTGTCCCTGG + Intronic