ID: 1141523446

View in Genome Browser
Species Human (GRCh38)
Location 16:84596625-84596647
Sequence TTCCCACGGCACCCAGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 234}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141523438_1141523446 -5 Left 1141523438 16:84596607-84596629 CCTCCTTGAACCTCTCCCTTCCC 0: 1
1: 0
2: 3
3: 59
4: 657
Right 1141523446 16:84596625-84596647 TTCCCACGGCACCCAGGGCATGG 0: 1
1: 0
2: 2
3: 22
4: 234
1141523437_1141523446 -4 Left 1141523437 16:84596606-84596628 CCCTCCTTGAACCTCTCCCTTCC 0: 1
1: 0
2: 3
3: 110
4: 975
Right 1141523446 16:84596625-84596647 TTCCCACGGCACCCAGGGCATGG 0: 1
1: 0
2: 2
3: 22
4: 234
1141523436_1141523446 11 Left 1141523436 16:84596591-84596613 CCATTATCAATTCTGCCCTCCTT 0: 1
1: 0
2: 3
3: 27
4: 344
Right 1141523446 16:84596625-84596647 TTCCCACGGCACCCAGGGCATGG 0: 1
1: 0
2: 2
3: 22
4: 234
1141523435_1141523446 30 Left 1141523435 16:84596572-84596594 CCACTGGTGGCGTTTCACGCCAT 0: 1
1: 0
2: 0
3: 6
4: 34
Right 1141523446 16:84596625-84596647 TTCCCACGGCACCCAGGGCATGG 0: 1
1: 0
2: 2
3: 22
4: 234
1141523439_1141523446 -8 Left 1141523439 16:84596610-84596632 CCTTGAACCTCTCCCTTCCCACG 0: 1
1: 0
2: 3
3: 30
4: 338
Right 1141523446 16:84596625-84596647 TTCCCACGGCACCCAGGGCATGG 0: 1
1: 0
2: 2
3: 22
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141523446 Original CRISPR TTCCCACGGCACCCAGGGCA TGG Intronic
900188740 1:1344568-1344590 TCCCCAGGCCACCCAGGGCCAGG + Intronic
900481788 1:2902895-2902917 TGCACACGGCACCCAGGAGAGGG - Intergenic
900490397 1:2946085-2946107 TTCCCACCTCACCCAGGACGAGG + Intergenic
900806867 1:4773287-4773309 CTCCCCTGGAACCCAGGGCAAGG + Intronic
901416737 1:9121726-9121748 TTCCCACTGCCCCCAGAGCAGGG + Intronic
901441603 1:9281568-9281590 GTCCCACGGCACCCTCCGCATGG - Intergenic
901527808 1:9835284-9835306 ATCCCACAACCCCCAGGGCATGG + Intergenic
901691923 1:10979276-10979298 GGGCCACCGCACCCAGGGCAAGG + Intronic
903279803 1:22244009-22244031 GCCCCTGGGCACCCAGGGCAGGG - Intergenic
903951036 1:26996089-26996111 CTCCCACAGTACCCTGGGCAGGG + Intronic
904422667 1:30404300-30404322 ACCCCACAGCACACAGGGCAGGG + Intergenic
904987651 1:34565136-34565158 TACCCACATCACCCATGGCAGGG + Intergenic
905468785 1:38176020-38176042 TGCCCCCATCACCCAGGGCATGG - Intergenic
906934499 1:50200581-50200603 CTCCCAGGGCTCCCAGAGCAAGG - Intronic
907438805 1:54465754-54465776 TTCCCAGGGCACCCTGCCCAGGG + Intergenic
913136710 1:115897909-115897931 ATTCCAAGGCACCCAGGGAAAGG + Intergenic
914825361 1:151135298-151135320 TTCCCACTGCACCTAGGGTGAGG + Exonic
915243958 1:154543348-154543370 ATCTCATGGCATCCAGGGCAGGG - Intronic
915590414 1:156867262-156867284 TTCCCAGGGCACCCTGCACAGGG + Intronic
916205679 1:162314181-162314203 TTATCACAGCCCCCAGGGCAGGG + Intronic
916308055 1:163361852-163361874 TTGGCACAGCACCCAGTGCATGG + Intergenic
918415106 1:184298409-184298431 TTCCCACAGCACACAGGACACGG + Intergenic
920341754 1:205279557-205279579 TTCCCACAGCCCCCAGGGCTTGG - Intergenic
921064319 1:211611914-211611936 TTCAGAAGGCTCCCAGGGCATGG - Intergenic
922176349 1:223200848-223200870 TTCCCAAGGCACCTAGAGGAAGG - Intergenic
922801104 1:228365130-228365152 ATCCCAGGGCAGGCAGGGCAGGG + Intronic
923068512 1:230541810-230541832 TTCCCCCTGCCCCCAGTGCATGG - Intergenic
1062821503 10:537587-537609 TGCCCAGGGCACCCAGGACACGG + Intronic
1063174728 10:3540936-3540958 TTCCCACAGCAACAAGGGCTGGG - Intergenic
1066374290 10:34843572-34843594 TTCACACAGCACACAGGGCTGGG - Intergenic
1066374297 10:34843615-34843637 TTCACACAGCACACAGGGCTGGG - Intergenic
1066374304 10:34843658-34843680 TTCACACAGCACACAGGGCTGGG - Intergenic
1068881235 10:62051165-62051187 AGCCCACGGCAACCAGGGGAAGG - Intronic
1070678965 10:78435405-78435427 TTCCCAAAGGACACAGGGCAGGG - Intergenic
1072488171 10:95875887-95875909 TTCCCACAGGACCCAGGGGGAGG - Exonic
1072609194 10:97005174-97005196 TCCCCAAGGCCCACAGGGCAAGG - Intronic
1075253565 10:120905687-120905709 TGCCTACGGGACCCAGGGCCTGG - Intronic
1075684823 10:124356462-124356484 GTCCGACGGCAGCCAGGACAGGG + Intergenic
1076783923 10:132739632-132739654 CTCACCCGGCTCCCAGGGCAAGG - Intronic
1077535734 11:3123066-3123088 TGCCCACGGCTCCCAGGGGATGG - Intronic
1077550200 11:3196806-3196828 TTCCCAGGGCACACAGTGCCTGG - Intergenic
1078448371 11:11421928-11421950 ATGCCAGGGCACCCAGGCCAGGG - Intronic
1079450942 11:20599286-20599308 GTCCCACTGCACCCAAGGCAAGG - Intergenic
1079710946 11:23680907-23680929 CTCCCACCTCACCGAGGGCAGGG - Intergenic
1081991140 11:47338282-47338304 CTCCCACGGCACTCTGGACATGG + Intronic
1083197961 11:61102300-61102322 TGCCCAAGGTACCCAGGGCTGGG - Intergenic
1083946244 11:65924698-65924720 GTCCAGCAGCACCCAGGGCAGGG - Intergenic
1083955066 11:65978471-65978493 TTCCCACTGCACCCCAGGCCTGG + Intronic
1084567556 11:69940020-69940042 TTCTCACAGCACACAGGCCAGGG - Intergenic
1084935231 11:72583379-72583401 TTCCCCGGGGACCCAGGGCCAGG - Intronic
1085053318 11:73390746-73390768 CTCCCACAGGACCCAGGGCAGGG + Exonic
1085344973 11:75762849-75762871 TACCCACAGCACCCAGCACAAGG + Intronic
1087175472 11:95091197-95091219 TTCCCCCAGCAGCCTGGGCAGGG - Intronic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1089708347 11:120297283-120297305 TTCCCAGGTGTCCCAGGGCAGGG - Intronic
1090996602 11:131871757-131871779 TCCCCAGGGAGCCCAGGGCAGGG - Intronic
1092126793 12:6080232-6080254 TTCCCAGGGCACTCATGGCAGGG + Intronic
1093548080 12:20370219-20370241 TTCCCTCGGTATACAGGGCAGGG - Exonic
1097020293 12:56016008-56016030 TTCCCTAGGAAGCCAGGGCATGG - Intronic
1099698090 12:86046378-86046400 TTCCCATGGCAGTCAGGGAAGGG - Intronic
1101436714 12:104670328-104670350 TCTGCACGGCACCCAGGGCAGGG + Intronic
1102205977 12:111091183-111091205 TTCCCACTCCAGCCAGGGCCAGG + Intronic
1102250171 12:111381330-111381352 TTCCCAGGGCAGGAAGGGCAAGG + Intergenic
1103722048 12:122980443-122980465 TTCCCAGGGCACCGGGGGCGTGG + Exonic
1105801163 13:23903971-23903993 TTCCCACGGACCCCAGGCCCCGG - Intergenic
1105847714 13:24307965-24307987 TTCCCACGGACCCCAGGCCCCGG + Intronic
1108623520 13:52206170-52206192 TTCCCACAGCCCCAAGGGGATGG + Intergenic
1113807834 13:113120309-113120331 CTCCCACTGCAGCCAGGGCCTGG - Exonic
1117912510 14:60648868-60648890 TGCCCACGGCGCCCAGGGGTCGG + Exonic
1119179733 14:72597765-72597787 GTCCCACGGCACCCAAGTCCAGG - Intergenic
1119692233 14:76683554-76683576 TTCACATGGCAGCCATGGCAAGG + Intergenic
1121017779 14:90558843-90558865 TCCCCAGGGCCCCCAGGGCTTGG + Intronic
1122319691 14:100846322-100846344 TTCCCCAGGCCCCCTGGGCAAGG - Intergenic
1122330201 14:100906695-100906717 TTCCGGTGGCACCCAGGGCTGGG - Intergenic
1122695925 14:103552051-103552073 TTCCAACAGCACCGAGGACATGG + Intergenic
1122903695 14:104792423-104792445 TTCCCATGGCATGGAGGGCACGG - Intronic
1125255537 15:37758842-37758864 TGCTCACCTCACCCAGGGCAGGG - Intergenic
1130397291 15:83513708-83513730 TTCCCACTCTACCCAGGGCATGG + Intronic
1132505600 16:306961-306983 TTCCCGCTGCACCCGGGGCCTGG + Intronic
1134269696 16:12722818-12722840 TTCCCACGGACCCCAAGGCTGGG + Intronic
1134745572 16:16585490-16585512 TTCCCAAGGCATCCAAGGGACGG + Intergenic
1134999904 16:18768254-18768276 TTCCCAAGGCATCCAAGGGACGG - Intergenic
1135752887 16:25070933-25070955 TTACAAGGGCACTCAGGGCAGGG - Intergenic
1136070610 16:27784868-27784890 ATCCCACGGCAGCCAGGCCTGGG + Intergenic
1136612021 16:31372106-31372128 TGCCCCTGGCCCCCAGGGCAAGG - Intronic
1137444836 16:48525412-48525434 TCCCCACGGCCACCAGTGCAGGG + Intergenic
1137609482 16:49809312-49809334 TTCCAAGGGCCCCCAGGGCCGGG - Intronic
1139483035 16:67241205-67241227 TGCCCAAGGCACCCTGGGGAGGG - Intronic
1141192929 16:81837542-81837564 TTGCCATGGCACCCACGACACGG - Intronic
1141523446 16:84596625-84596647 TTCCCACGGCACCCAGGGCATGG + Intronic
1142001808 16:87668576-87668598 TTCCCACCGGACCCTTGGCAAGG - Intronic
1142318659 16:89366781-89366803 TTCCGGGGGCACCCAGGGCAGGG + Intronic
1142602208 17:1059179-1059201 GCCCCACGTCACCCAGGGCCAGG + Intronic
1143608405 17:8003649-8003671 TGTCCACGGCACTCAGGGCCCGG + Exonic
1145157089 17:20550804-20550826 TTCCCTCGGAGCACAGGGCAGGG - Intergenic
1145378880 17:22376275-22376297 TTCCCTTGGCACTCAGGGAAAGG + Intergenic
1145379356 17:22378645-22378667 TTCCCTTGGCACTCAGGGAAAGG + Intergenic
1145379834 17:22381015-22381037 TTCCCTTGGCACTCAGGGAAAGG + Intergenic
1145380314 17:22383390-22383412 TTCCCTTGGCACTCAGGGAAAGG + Intergenic
1145380793 17:22385737-22385759 TTCCCTTGGCACTCAGGGAAAGG + Intergenic
1145381272 17:22388112-22388134 TTCCCTTGGCACTCAGGGAAAGG + Intergenic
1145382005 17:22391887-22391909 TTCCCTTGGCACTCAGGGAAAGG + Intergenic
1145382480 17:22394251-22394273 TTCCCTTGGCACTCAGGGAAAGG + Intergenic
1145383334 17:22398437-22398459 TTCCCTTGGCACTCAGGGAAAGG + Intergenic
1145383702 17:22400172-22400194 TTCCCTTGGCACTCAGGGAAAGG + Intergenic
1145383847 17:22400905-22400927 TTCCCTTGGCACTCAGGGAAAGG + Intergenic
1145384285 17:22403107-22403129 TTCCCTTGGCACTCAGGGAAAGG + Intergenic
1145384604 17:22404569-22404591 TTCCCTTGGCACTCAGGGAAAGG + Intergenic
1145385388 17:22408641-22408663 TTCCCTTGGCACTCAGGGAAAGG + Intergenic
1145971031 17:28956649-28956671 TTCTCACGGCTCCCAGGTCATGG - Intronic
1147381983 17:40061782-40061804 TTCCCACGGCTCTCAGGGTGGGG - Intronic
1160001594 18:75029508-75029530 TTTCCATGCCACCCTGGGCATGG + Intronic
1160519522 18:79496469-79496491 TTGCCAGGGCAGCCAGGGCCGGG + Intronic
1160662144 19:306186-306208 TGCCCACGACCCCCAGGGCTGGG + Exonic
1160773921 19:846215-846237 GCCCCACGGCACCCAGTGCCTGG + Exonic
1160961807 19:1725509-1725531 CTCCCCCAGCACCCAGGCCAGGG - Intergenic
1161719315 19:5894425-5894447 TTCCCCCAGTTCCCAGGGCAGGG - Intronic
1161898224 19:7098845-7098867 TCCCCATGGCACCCTGGGCTCGG - Intergenic
1162551671 19:11361582-11361604 TTCCAACAGCACCCGGGGCGTGG - Intronic
1164502098 19:28828727-28828749 AGCCCACGGCACCCAGGCCATGG + Intergenic
1168147870 19:54429806-54429828 CTCCCACAGCACCCAGTGCCTGG - Intronic
1168160518 19:54507627-54507649 TTCCCACGTGACCCTGAGCAAGG + Intronic
1168435975 19:56317267-56317289 TTACTAAAGCACCCAGGGCAAGG - Intronic
925097674 2:1220271-1220293 CTCTGACGGCACCCAGTGCAGGG - Intronic
926336750 2:11869004-11869026 CTCCCACAGCACCGAGGGAAAGG + Intergenic
926724194 2:15984623-15984645 TCCACACGGCTCCCTGGGCATGG + Intergenic
927894975 2:26775774-26775796 TACCCACCTCACCCAGGGCTTGG - Intronic
927913369 2:26917247-26917269 TTACCACATCATCCAGGGCATGG - Intronic
927926792 2:27019239-27019261 ATCCTACAGCACCCTGGGCACGG - Intronic
928184458 2:29097150-29097172 TTGCCACATCACCCAGGGCAAGG - Intergenic
928209348 2:29312097-29312119 TTGCCAGGCTACCCAGGGCAGGG + Intronic
929562064 2:42962211-42962233 CTCCCAAGGCACCCACAGCATGG - Intergenic
929788621 2:45008789-45008811 TGCCCACGGCGCCCAGGGGTCGG + Exonic
931066753 2:58596363-58596385 TTCCCACTGCTCCTAGGGCTAGG - Intergenic
932764951 2:74463573-74463595 CTCCCAGGGCACCCAGTGCAAGG - Intronic
933637074 2:84720178-84720200 TTCCCACACCACCCATGGCCAGG - Intronic
934718127 2:96554890-96554912 TTCCCAGAGGCCCCAGGGCATGG - Intergenic
934756485 2:96828083-96828105 TTGCCACTCCTCCCAGGGCAGGG + Exonic
937705407 2:124914713-124914735 TTACCATAGAACCCAGGGCAGGG + Exonic
937863837 2:126733239-126733261 CTGCCATGGCACCCAGGGGAAGG + Intergenic
938397711 2:130963410-130963432 CTCCCACGCCATCCAGGGCGAGG - Intronic
938494490 2:131786387-131786409 ATCCCACTGCAGCCTGGGCATGG + Intergenic
939215847 2:139237223-139237245 CTCCCAGGGCACACAGAGCAGGG + Intergenic
941921988 2:170860277-170860299 TTCCCTCGGCCCCTAGGACATGG - Exonic
944563309 2:200963335-200963357 TTCCCTCGGCACTTGGGGCATGG - Intronic
946181344 2:217950907-217950929 TTCCCTCGGAGCCCGGGGCAGGG - Intronic
947715500 2:232337019-232337041 TGCCCCTTGCACCCAGGGCAAGG + Exonic
947734523 2:232447790-232447812 TGCCCCTTGCACCCAGGGCAAGG + Intergenic
947874779 2:233460919-233460941 TGCCCTCGGGAGCCAGGGCAGGG - Intronic
948690073 2:239696440-239696462 TTCCCATGTCACCCAGGCAATGG - Intergenic
1169353348 20:4888015-4888037 TTCTCTCTGCACCCAAGGCACGG + Intronic
1171793322 20:29547917-29547939 TTCCCTTGGCACTCAGGGAAAGG + Intergenic
1171855131 20:30336462-30336484 TTCCCTTGGCACTCAGGGAAAGG - Intergenic
1172952209 20:38729419-38729441 TTCCCACGCCTCCCAGCGCCAGG - Intergenic
1173546276 20:43900677-43900699 TTCCCGGGGCCCCCAGGGGAGGG - Intergenic
1174058665 20:47817079-47817101 TTCCCTGGGCACCCAGGAAAGGG + Intergenic
1174960357 20:55149629-55149651 TTGCCATAGCACCCAGTGCAAGG + Intergenic
1176418015 21:6490698-6490720 TCCCCAGGCCACCCAGTGCAGGG + Intergenic
1178663094 21:34522961-34522983 GCCCCAGGGCACCCACGGCAGGG - Intronic
1179440626 21:41391028-41391050 CTTCCAGGGCATCCAGGGCATGG + Intronic
1179693509 21:43099028-43099050 TCCCCAGGCCACCCAGTGCAGGG + Intronic
1179957707 21:44750463-44750485 TGCACACGGCACACAAGGCAGGG - Intergenic
1180865607 22:19117438-19117460 TTCCCACGTGACACAGGGCTTGG + Intronic
1181033021 22:20157319-20157341 TTCCCATGGGGCCTAGGGCAGGG + Intergenic
1181044146 22:20206744-20206766 GGCACACGGTACCCAGGGCAGGG + Intergenic
1181055459 22:20258671-20258693 CTCCCCTGGCTCCCAGGGCAGGG + Intronic
1181490128 22:23256383-23256405 TTCCCACAGCACCCCGGGCAAGG - Intronic
1181624794 22:24115934-24115956 TTCCCTCGGTACCCAGTGCATGG - Intronic
1182145922 22:27996628-27996650 TCCCCATGGCCCCCATGGCAAGG - Intronic
1183617728 22:38955402-38955424 GTCCCCCTGCAGCCAGGGCAAGG - Intronic
1184152892 22:42648998-42649020 GCCCCACGGCGGCCAGGGCAGGG + Intronic
1185284784 22:49995345-49995367 TTCCCAGGGGACTCAGGACAGGG + Exonic
950264296 3:11562933-11562955 TGCCCACGGCACACGTGGCAAGG - Intronic
950432362 3:12958222-12958244 TGCCCACAGCACCCAGCACAGGG + Intronic
952125328 3:30293016-30293038 TTCCCACAGCACAAAGGGCTGGG + Intergenic
952539805 3:34356103-34356125 TTTCCATGACACCCAGGCCAGGG + Intergenic
952883296 3:37998516-37998538 CTCTCAGGGCTCCCAGGGCAGGG - Intronic
953133894 3:40166550-40166572 TTCCCACGGACCCCAAGGCTTGG - Intronic
953878205 3:46678383-46678405 TTCTCCTGGCTCCCAGGGCAAGG - Exonic
954142832 3:48618790-48618812 GCCCCACGGCACCCAGTGCTGGG + Intergenic
955414910 3:58683204-58683226 TTCTCAGGACACCCAGGGCTTGG + Intergenic
955661581 3:61304973-61304995 TTTGCACGGCACCCTGGGTAGGG + Intergenic
961633418 3:128317943-128317965 TTCCCATGGCCCACATGGCAAGG - Intronic
963080010 3:141382759-141382781 TTCCCACAGTTCCCAGGGCCTGG + Intronic
967873657 3:194251917-194251939 TCCCCACAGCACCCAGAACAAGG - Intergenic
967975345 3:195031285-195031307 GTCCCTCGGCAGCCAGGGCAGGG + Intergenic
968289278 3:197526253-197526275 TTCCCACAGCCCTCAGGGCTGGG - Intronic
968313886 3:197706174-197706196 TTTCCACGCCACCCAGGTCAGGG + Intronic
968808215 4:2788487-2788509 TCCCCATCCCACCCAGGGCAAGG + Intergenic
970010817 4:11457056-11457078 ATCCCGAGGCACCCAAGGCATGG - Intergenic
973734456 4:53856760-53856782 TTCCAAAGTCACCCTGGGCATGG + Intronic
976269504 4:83217105-83217127 CTCCCACTGCACCCAGGCCTTGG - Intergenic
982213516 4:153060261-153060283 TTCCCACCACAGCCAGGGGAGGG - Intergenic
985758933 5:1734817-1734839 TGCTCATGACACCCAGGGCAGGG - Intergenic
985930153 5:3050980-3051002 GTGCCAGTGCACCCAGGGCAGGG - Intergenic
986227277 5:5827458-5827480 TCCCCAAGCCACGCAGGGCAGGG - Intergenic
990266627 5:54084012-54084034 TTCCCATGGCACCCTGGCTATGG - Intronic
997581253 5:135018809-135018831 TTCCCATGCCTCCCAGGCCAGGG + Intergenic
999458777 5:151740046-151740068 TTCCCTCTGCACACAGAGCAAGG - Intergenic
1001131680 5:169069509-169069531 TTCCCTCGGCACCCAGGGTAGGG - Intronic
1001605905 5:172959521-172959543 TTCCCGCGACACATAGGGCAGGG - Intronic
1001661545 5:173396951-173396973 TTCCCACGGCAGGCAGGGGAGGG + Intergenic
1002053908 5:176587571-176587593 TTCCCACACCACCGAGGGCTGGG + Intronic
1002536864 5:179880518-179880540 GTCCCACTCCACCCAGGGCTGGG + Intronic
1003803984 6:9704359-9704381 TTCACACTGCACCCAGGACTGGG - Intronic
1004560455 6:16744492-16744514 TACCCACTGCTCCCAGGACAGGG + Intronic
1011161332 6:84393569-84393591 AACCCACAGCAGCCAGGGCATGG + Intergenic
1012006637 6:93720780-93720802 TTCCCCTGGCACCTAGAGCAGGG + Intergenic
1013819302 6:114135599-114135621 CTCCCTCTCCACCCAGGGCACGG + Intronic
1018299683 6:162388292-162388314 TTCCCAAGACACCCAGCACAAGG + Intronic
1019356212 7:580916-580938 TTCCCACGAACCCCAGGGCCGGG + Intronic
1019611175 7:1937426-1937448 TTCCCACGAAACCCAGGGCCGGG + Intronic
1019729415 7:2622207-2622229 TTCCCACAGCTCTCAGGGCAAGG - Intergenic
1020093080 7:5352282-5352304 TGACCGAGGCACCCAGGGCAAGG - Intronic
1021766701 7:23956956-23956978 ATTCCACAGCACCCAGGCCAGGG + Intergenic
1021841173 7:24723024-24723046 TTCCCTGGGCAACCAAGGCAGGG + Intronic
1024477454 7:49828976-49828998 TTCCCACGGAACCCACACCAAGG + Intronic
1026800237 7:73395847-73395869 TACCCTCAGCGCCCAGGGCATGG + Intergenic
1029284768 7:99457962-99457984 TGCCCACAGCACTCATGGCAAGG + Intronic
1029331528 7:99860366-99860388 TGCCCAGCGCACCCAGGGCCAGG - Intronic
1033425446 7:141239631-141239653 ATCCCACGGCACCCACCACAGGG + Intronic
1033469608 7:141633054-141633076 TTCCCACCACAGCCAGTGCAAGG - Intronic
1033570137 7:142619348-142619370 TACCGACAGGACCCAGGGCAAGG + Intergenic
1034944309 7:155252013-155252035 TTCCCATGGTGCACAGGGCAAGG + Intergenic
1034967461 7:155400128-155400150 TTCCCACGGTGCCCGGGGCCGGG + Intergenic
1035261141 7:157662426-157662448 CTCCCACGCCACCCAGAGCTGGG + Intronic
1036773864 8:11596784-11596806 GAGCCATGGCACCCAGGGCAGGG + Intergenic
1037860426 8:22401319-22401341 TTACCCAGGCACCCAGGGCTCGG - Intronic
1037892207 8:22629364-22629386 TTCCCTCGGTCCCCAGGGCGGGG - Intronic
1038421649 8:27437660-27437682 CTCCCACCGCCCCCAGGGAAGGG + Intronic
1038974383 8:32676716-32676738 TTCCCCAGGCACCAAGGACAAGG - Intronic
1040877466 8:52168122-52168144 GTCCCACGGCACTTGGGGCACGG + Intronic
1041678713 8:60564288-60564310 TACCCACAGCACCAAGGGAAAGG - Intronic
1044704337 8:94994095-94994117 TTCCCATGGAGCACAGGGCAGGG - Intronic
1044802769 8:95974329-95974351 TTCCCATGGCCCCCAGGCCTAGG - Intergenic
1045252237 8:100491748-100491770 CTCCCAGGGCATTCAGGGCAAGG - Intergenic
1049303292 8:141883212-141883234 TTCCCAGAGCCCCCAGGGCAGGG - Intergenic
1049341171 8:142113418-142113440 TTCCCACATCACCCACGGGAAGG - Intergenic
1053792963 9:41699751-41699773 TTCCCTTGGCACTCAGGGAAAGG - Intergenic
1054152215 9:61615074-61615096 TTCCCTTGGCACTCAGGGAAAGG + Intergenic
1054181374 9:61911772-61911794 TTCCCTTGGCACTCAGGGAAAGG - Intergenic
1054471986 9:65546217-65546239 TTCCCTTGGCACTCAGGGAAAGG + Intergenic
1056349781 9:85738697-85738719 ATCCCAGGGCACCCAGCTCAGGG + Intronic
1056754576 9:89373710-89373732 TCCCCCAGCCACCCAGGGCAGGG - Intronic
1057576100 9:96244088-96244110 CTCCTCCAGCACCCAGGGCACGG + Intronic
1060149836 9:121281601-121281623 TTCCCTGGGCAGCCAGGGCGGGG - Intronic
1062048562 9:134435560-134435582 CTCCCACGGCACCTTGTGCAGGG - Intronic
1062202320 9:135310039-135310061 GTGCCCCGGGACCCAGGGCAGGG + Intergenic
1062334314 9:136058327-136058349 TCCCCACGGCTCCCAGTGCCTGG + Intronic
1186455890 X:9709531-9709553 TGCACACGGGGCCCAGGGCAGGG - Intronic
1186627194 X:11306973-11306995 TTGCCATGGCAACCAGGGTAAGG + Intronic
1192639052 X:72846053-72846075 CTCCCACGGCATCAAGGACAAGG - Intronic
1192642660 X:72874755-72874777 CTCCCACGGCATCAAGGACAAGG + Intronic
1196090458 X:111735887-111735909 TTTCCACAGCACCCAGTACAGGG - Intronic
1197147310 X:123184728-123184750 TTCCCAGGCCACGCAGGACAGGG - Intronic
1197722825 X:129756424-129756446 CTCCCACGTGACCCAGTGCAGGG + Intronic
1200076079 X:153551897-153551919 GTCCCAGGGCCCTCAGGGCAAGG + Intronic
1200115731 X:153768953-153768975 TCTCCACGGCTCCCAGGGCCAGG + Exonic
1200120291 X:153787004-153787026 AGCCCAGGGCACTCAGGGCAGGG + Intronic