ID: 1141526579

View in Genome Browser
Species Human (GRCh38)
Location 16:84615558-84615580
Sequence CTGAATTTAGGGAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 288}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141526574_1141526579 -5 Left 1141526574 16:84615540-84615562 CCAGCGGGAGGAAAGAAGCTGAA 0: 1
1: 0
2: 0
3: 29
4: 490
Right 1141526579 16:84615558-84615580 CTGAATTTAGGGAGGGAAGCTGG 0: 1
1: 0
2: 1
3: 26
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141526579 Original CRISPR CTGAATTTAGGGAGGGAAGC TGG Intronic
901671510 1:10858765-10858787 CTGGAATTAGTGAAGGAAGCAGG + Intergenic
901692093 1:10980333-10980355 CTGAATTCAGCGAATGAAGCGGG - Intronic
902569335 1:17336873-17336895 CTGCATTTCGGGAGGGATACAGG - Intronic
902634825 1:17728447-17728469 CAGCATTTTGGGAGGGATGCAGG - Intergenic
903853210 1:26320641-26320663 TGGAATTTAGGTGGGGAAGCTGG - Intergenic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
904889917 1:33772073-33772095 TTGGATTTAGGGAGGGAAAAGGG - Intronic
907586461 1:55622191-55622213 CTGAATTTAATGATGAAAGCAGG + Intergenic
907813372 1:57894384-57894406 CTCATTTTAGGTAGGGAAGTTGG + Intronic
909261728 1:73498686-73498708 CTGATTTTAGGGAGGGGAGGCGG - Intergenic
911968529 1:104399213-104399235 CTGAGGATAGGGAGAGAAGCAGG + Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
912891380 1:113535771-113535793 CTGAATTTAGGGCTGGAAATTGG - Intronic
913583086 1:120246364-120246386 CAGAATCTATTGAGGGAAGCAGG - Intergenic
913625086 1:120651996-120652018 CAGAATCTATTGAGGGAAGCAGG + Intergenic
914226718 1:145725935-145725957 TAGAATTAAGGGAGGGGAGCTGG + Intronic
914426901 1:147586164-147586186 ATGACTTTAGGGAGCTAAGCTGG - Intronic
914565074 1:148858182-148858204 CAGAATCTATTGAGGGAAGCAGG - Intronic
914607750 1:149272060-149272082 CAGAATCTATTGAGGGAAGCAGG + Intergenic
915553488 1:156648205-156648227 CTGAGTTTAAGGGGGCAAGCAGG + Intronic
918742047 1:188144151-188144173 CTAAATTTGGGTAGGGAAGTGGG + Intergenic
919843489 1:201626351-201626373 CTGGAGATGGGGAGGGAAGCAGG - Intronic
920684934 1:208102171-208102193 CTGGAGGGAGGGAGGGAAGCTGG - Intronic
921221846 1:212979108-212979130 TGGAATCTAGAGAGGGAAGCTGG - Intronic
922378553 1:224996592-224996614 CTGAGTTAGGGTAGGGAAGCTGG + Intronic
923079461 1:230640112-230640134 CTGAATCTAGGGAGGACAGCAGG + Intergenic
1063643895 10:7859381-7859403 CTGAGTTTCAGGAGGGCAGCGGG + Intronic
1069423286 10:68266531-68266553 CTGAATTTAGTGGGGGAAAGTGG + Intergenic
1069686979 10:70324696-70324718 CTGAATCTAGTGAGAGAAGCCGG + Intronic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1071393749 10:85201005-85201027 ATGAATGTAGTGAAGGAAGCTGG - Intergenic
1074897693 10:117791374-117791396 CAGAAGTTGGGGAGGGAAACAGG - Intergenic
1077059327 11:610827-610849 CTGAGTTTATGGGCGGAAGCTGG + Intronic
1079274824 11:19025498-19025520 CTTAATTTAAAGAGGCAAGCTGG - Intergenic
1079357410 11:19741421-19741443 CTGAAGTGGGGGAGGGAAGTGGG - Intronic
1081226615 11:40531582-40531604 CTGAATTGAAAGAGTGAAGCTGG - Intronic
1081354991 11:42101755-42101777 CAGAATTTCAGGAGGGAAGTTGG + Intergenic
1081501381 11:43669996-43670018 CTTAAGGGAGGGAGGGAAGCTGG + Intronic
1081567028 11:44266351-44266373 CTGAGTTTAGGGAGGGAGAGGGG + Intronic
1082820872 11:57543836-57543858 GTGAAAGGAGGGAGGGAAGCTGG - Intronic
1083516631 11:63265049-63265071 ATGAATCTAGAGAGGGAGGCAGG - Intronic
1083731198 11:64653617-64653639 TGGGATTTAGGGAGGGAGGCTGG - Intronic
1083857435 11:65400095-65400117 CTGAGTGGAGGGAGGGCAGCAGG + Intronic
1084415230 11:69028345-69028367 CTGAGTTTGGAGAGGAAAGCAGG - Intergenic
1085203614 11:74717145-74717167 ATGGATTTAGGGGGGGAAACAGG + Intronic
1085407919 11:76275004-76275026 CTGACTTTGAGGAGGGAAGGGGG + Intergenic
1089147043 11:116336679-116336701 CTGAATAAAGGGAAGGGAGCTGG - Intergenic
1089277189 11:117345413-117345435 CTCACTTTAGGGAGACAAGCTGG - Intronic
1089326588 11:117661645-117661667 CTGGCCTTAGGGAGGGATGCAGG - Intronic
1090265772 11:125351956-125351978 CTGATCTGAGGGATGGAAGCTGG - Intronic
1090269655 11:125377279-125377301 CACAATTTAGGGTGGGAAGCTGG - Intronic
1090649418 11:128793358-128793380 GTGAATTTATGGAGGGACACGGG - Intronic
1090768044 11:129894378-129894400 CTTATTTGAGGAAGGGAAGCTGG + Intronic
1090924621 11:131238584-131238606 CTGAATTGGGGGTGGGAAGGAGG + Intergenic
1090973437 11:131662240-131662262 CCTAATTTAGAGGGGGAAGCTGG - Intronic
1092763657 12:11832507-11832529 CTGATTTTAGGAAGAGAAGCTGG + Intronic
1095858097 12:46884233-46884255 ATGAATTTAGAGAGGGAGGTAGG - Intergenic
1097158158 12:57027505-57027527 GTGAGTTAAGGGAAGGAAGCGGG + Intronic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1100184497 12:92124788-92124810 ATGAGTTTAGGGAAGGAAGCCGG - Intronic
1100476623 12:94941135-94941157 CTGGAATTAGGGATGGAAGAAGG - Intronic
1100793308 12:98153955-98153977 CTGAAATTAGGCTGGGAAGATGG - Intergenic
1101607050 12:106255121-106255143 TTGAATTGAGGAAGGGAAGGAGG - Intronic
1101909439 12:108850582-108850604 GGGGATTTAGGGAGGGGAGCTGG + Intronic
1104680032 12:130743766-130743788 CTGAATTCAGAATGGGAAGCAGG - Intergenic
1106112492 13:26789298-26789320 CTGAATTTAGTGAGGCAAGGAGG - Intergenic
1106395177 13:29372875-29372897 CTGAATTTAGTGGGAGAAGAAGG - Intronic
1106398296 13:29403048-29403070 CTGAACTTCAGGAGGGAAGGAGG + Intronic
1106763799 13:32893841-32893863 TTGAAGGTAGGCAGGGAAGCCGG - Intergenic
1107630135 13:42334502-42334524 CTGAATCTGAGGAGGGAACCTGG - Intergenic
1108527381 13:51297355-51297377 CTGGAATTAGGGAGGGATGAAGG + Intergenic
1110718758 13:78737930-78737952 CAAAATTTAGGGATGGGAGCGGG - Intergenic
1111205642 13:85006410-85006432 CTTAATTTAAGGAGAAAAGCTGG + Intergenic
1111385619 13:87522670-87522692 CTGAATTTAGCAAAGGGAGCAGG - Intergenic
1112378609 13:98866777-98866799 ATGAATTTTGGGGGTGAAGCAGG + Intronic
1113058011 13:106290337-106290359 CTGAATTTGGGAAGGTAAGCAGG + Intergenic
1113186122 13:107687301-107687323 CTGGATGGAGGGAGGGAAGGAGG + Intronic
1115090051 14:29564173-29564195 CTGGATTGAGGCAGAGAAGCAGG - Intergenic
1115872185 14:37816972-37816994 CTGAAGTTAGGGAAGTCAGCTGG - Intronic
1116958485 14:50946529-50946551 CTGAATTAAGAGTGGGAAGGGGG + Intergenic
1117729117 14:58703786-58703808 CTGAATTCTGAGTGGGAAGCTGG + Intergenic
1118949806 14:70425841-70425863 CTAAATTTAGAGAGGGAAAGAGG + Intergenic
1119191903 14:72688661-72688683 ATGAATGAAGGGAGGGCAGCTGG - Intronic
1119288755 14:73477544-73477566 CAGTATTTAGGAAAGGAAGCTGG + Intergenic
1119983045 14:79103535-79103557 CTGGAGTTCGGGAGGGAAGTTGG + Intronic
1123677083 15:22721100-22721122 TAGAATTTTGGGAGGGAAGGTGG + Intergenic
1124803805 15:32860928-32860950 CTCAAGGTAGGCAGGGAAGCAGG + Intronic
1125750076 15:42021905-42021927 CTGAATGCAGGGATGGAACCTGG + Intronic
1126952499 15:53897071-53897093 ATGAAGTGAGGGAGGAAAGCAGG - Intergenic
1127221538 15:56886052-56886074 GAGAATTTAGGGATGGAAACTGG + Intronic
1130460782 15:84157145-84157167 CTTAGTTCAGGGTGGGAAGCAGG + Intergenic
1130678677 15:85977386-85977408 CTGATGTTAGGGAGAAAAGCTGG - Intergenic
1130882818 15:88069808-88069830 CTGAACTCACAGAGGGAAGCTGG + Intronic
1131078649 15:89515344-89515366 CTGCAACTAGAGAGGGAAGCAGG - Intergenic
1133899396 16:9959308-9959330 CTAGGTTTAGGGATGGAAGCTGG - Intronic
1134322232 16:13174496-13174518 CTGAATTAAGGCAGGCAAACTGG + Intronic
1134504001 16:14790798-14790820 CTGAGGTCAGGGAGGGAGGCAGG + Intronic
1134576571 16:15338110-15338132 CTGAGGTCAGGGAGGGAGGCAGG - Intergenic
1134725868 16:16418389-16418411 CTGAGGTCAGGGAGGGAGGCAGG + Intergenic
1134941565 16:18293470-18293492 CTGAGGTCAGGGAGGGAGGCAGG - Intergenic
1135486060 16:22865794-22865816 GAGAATTTAGGGAGGCAAGGTGG + Intronic
1135640275 16:24113813-24113835 CTGAATGCAGACAGGGAAGCAGG - Intronic
1135703941 16:24658145-24658167 GTGAATTTGGGGTGGGAAGCTGG + Intergenic
1135942991 16:26839113-26839135 CTGAATCTAATGAGCGAAGCAGG - Intergenic
1137718536 16:50613463-50613485 CTGAACTGAGGGAGAGGAGCCGG - Intronic
1140302970 16:73775844-73775866 CAGAATTGAGGGAGAGGAGCAGG - Intergenic
1140968857 16:79993714-79993736 CATAATCTAGTGAGGGAAGCAGG + Intergenic
1141475124 16:84267756-84267778 CTGAGGTCAGGGAGGGAACCTGG + Intergenic
1141526579 16:84615558-84615580 CTGAATTTAGGGAGGGAAGCTGG + Intronic
1141890080 16:86920434-86920456 CTTATTTCAGTGAGGGAAGCAGG + Intergenic
1142287585 16:89177663-89177685 CTGAACTTGGTGAGGGCAGCAGG - Intronic
1143046418 17:4083797-4083819 TAGAAATAAGGGAGGGAAGCCGG - Intronic
1144237287 17:13273936-13273958 CAGAATATAGGGAGGGAAGGAGG - Intergenic
1146207259 17:30915502-30915524 TTGAATTTAGGCATGGAGGCAGG + Intronic
1146503238 17:33382214-33382236 CTGAACTTAGGGCAGGAATCTGG + Intronic
1146634999 17:34497275-34497297 CAGAAATCAGGGAGGGAAGGAGG - Intergenic
1146683631 17:34825933-34825955 AGGAATTTAGGAAGGGCAGCAGG - Intergenic
1146804522 17:35854772-35854794 CTTGATTTAGGGAGGCAGGCTGG + Intronic
1146820903 17:35983001-35983023 ATGGATGGAGGGAGGGAAGCAGG - Intergenic
1147421864 17:40325955-40325977 TTGGATTTAGGGAGGGGAGAAGG - Intronic
1147611988 17:41807240-41807262 ATGAAGGTAGGGAGGGGAGCAGG + Intronic
1147844366 17:43394504-43394526 CTGAAGTAAGGGAGGGTAGGAGG - Intergenic
1149893739 17:60412819-60412841 CAGAATTCAGGGAGATAAGCAGG - Intronic
1151524706 17:74656730-74656752 CTCAATTTGGGGAGTGAAGTGGG + Intergenic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1153484041 18:5577509-5577531 TTGAATTTAAGGAGAGAATCTGG - Intronic
1153702639 18:7711766-7711788 AGGAATTTAGGGAGGCAATCTGG - Intronic
1155490424 18:26395972-26395994 GTGAATCTAGGGAGGGGAGCAGG - Intergenic
1156376534 18:36519708-36519730 CTGAGGTAAGAGAGGGAAGCTGG + Intronic
1156409294 18:36812350-36812372 CTGACCTCAGGGAGGGAAGAGGG + Intronic
1157850299 18:51042380-51042402 CTGAAGTAAGGGAGGGAGGCAGG - Intronic
1159773965 18:72583054-72583076 CTGAAGTGAAGGATGGAAGCTGG + Intronic
1160180707 18:76633496-76633518 CTAAAATTAGGAATGGAAGCAGG + Intergenic
1161590506 19:5127212-5127234 CTGGCCTGAGGGAGGGAAGCGGG - Intronic
1161941651 19:7408518-7408540 CTAAATTTGGCGAGGGATGCGGG + Intronic
1162377983 19:10316317-10316339 CAGAGTCAAGGGAGGGAAGCTGG + Exonic
1162930265 19:13953988-13954010 CAGCCTTCAGGGAGGGAAGCAGG + Intronic
1164933016 19:32189713-32189735 CTGGAATTAGGGAGGGAGGCTGG - Intergenic
1165028289 19:32978034-32978056 CTGCATCTAGTGAGGGAAGCAGG + Exonic
1167022374 19:46887633-46887655 CTGAGTTGAAGGAGGGAAGTGGG - Intergenic
1167456456 19:49598834-49598856 CTGGGTTTAGGGAGAGAGGCAGG + Intronic
1167747812 19:51363123-51363145 GTGATTTTAAGGAGGCAAGCAGG + Intronic
1168165337 19:54543255-54543277 CTGAATTTAGTGGGGGAGGCTGG + Intronic
1168527268 19:57099240-57099262 ATGAACTTAGGGAGGGAGGCAGG - Intergenic
925509862 2:4613336-4613358 ATGAATTTAGGGATGGGGGCAGG + Intergenic
926614693 2:14984253-14984275 CTGAATCTAGGAAGGGTAGGGGG - Intergenic
927474378 2:23401299-23401321 CTGAATGGAGAGAGGGAAACCGG - Intronic
927672067 2:25076974-25076996 ATGAATTTGGGGAAGGAGGCAGG - Intronic
927935651 2:27074682-27074704 CTGAATATTGGGAGGGAAAAAGG - Intergenic
928113987 2:28532710-28532732 CTGAATTTAGGAAATAAAGCAGG + Intronic
928398343 2:30960255-30960277 CTCTAATCAGGGAGGGAAGCAGG + Intronic
929211910 2:39366539-39366561 CTGAATTCAGAAAGGGAAGAGGG + Intronic
931578058 2:63741102-63741124 CTGCCTTTAGGGAAGGAAGCTGG + Intronic
935831529 2:107005699-107005721 CTGAAGCTAAGGAGGGAAGGAGG - Intergenic
936528700 2:113259897-113259919 CTGCGTTTGGGGAGGGAAACAGG + Intronic
936886490 2:117317306-117317328 GTGAATTTAGCAAAGGAAGCTGG - Intergenic
937048257 2:118864555-118864577 CTGAATTTATGGAGGGATGTAGG - Intergenic
937981765 2:127619945-127619967 CTGCATTCAGGGAGGGAGGTGGG + Intronic
939033885 2:137108451-137108473 CTAAATTGAGGGAGGAAAGGGGG - Intronic
941182320 2:162274484-162274506 CTGCATCTAGGGAGGGGAGCTGG + Intronic
942766946 2:179468650-179468672 CTGAATCTAGAGAGGAAAGAGGG - Intronic
942773769 2:179555720-179555742 CTGAATTTAGGAAGTGAATAGGG + Intronic
945322504 2:208441373-208441395 CTGAATTTACGGAGGCTTGCAGG - Intronic
946014444 2:216592743-216592765 TTGACTCAAGGGAGGGAAGCAGG - Intergenic
946148280 2:217747264-217747286 CCGATTTCAGGGAGGGCAGCTGG - Intronic
948041647 2:234905999-234906021 CTGCTGCTAGGGAGGGAAGCAGG - Intergenic
948073009 2:235142568-235142590 CTGAATTGAGGGAATAAAGCAGG - Intergenic
948132971 2:235614439-235614461 ATGTATTTGGGGAGGGAAGAAGG + Intronic
948571916 2:238923014-238923036 CTGCAGGTGGGGAGGGAAGCAGG - Intergenic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1170890647 20:20372693-20372715 CAGAATATAGGAAGGGAATCAGG + Intergenic
1172694270 20:36811202-36811224 CTGAGTTCAGGGAGGAAACCAGG - Intronic
1173487663 20:43453313-43453335 TTAAATTTAGGAATGGAAGCTGG - Intergenic
1174920695 20:54698708-54698730 CTGAATGAAGGGAGGTAAGGTGG + Intergenic
1175218167 20:57402367-57402389 GAGAATTGAGGGATGGAAGCAGG + Intronic
1175830595 20:61963317-61963339 CGGGATTGAGAGAGGGAAGCAGG - Intronic
1179113526 21:38468338-38468360 CTGAATATAGAGAGGGAAATTGG + Intronic
1179975151 21:44861189-44861211 CTCAATTTACAAAGGGAAGCCGG + Exonic
1181944185 22:26503018-26503040 TTGAATTTATGGGGGAAAGCAGG - Intronic
1182212188 22:28685898-28685920 CAGCATTTTGGGAGGGAGGCGGG + Intergenic
1182246533 22:28962675-28962697 CTGTATTTGGGGAGGTATGCAGG + Intronic
1183027719 22:35078495-35078517 GTGGACTTAGGGAGGGAAGGGGG + Intronic
1183540861 22:38428562-38428584 TGGAATCCAGGGAGGGAAGCGGG - Intronic
1183785856 22:40028735-40028757 CTGCCTGTAGGGAGGGAAGGGGG - Intronic
949442257 3:4094627-4094649 TTAAAATTAGGGAGTGAAGCTGG - Intronic
949858224 3:8481702-8481724 TTGAATTTGGGGAGGTAAGGGGG + Intergenic
949987648 3:9553121-9553143 CTGAATTTAGGGAGCTCAGAAGG + Intronic
951460397 3:22945534-22945556 CTGGAATTAGGGAGGGAAGACGG + Intergenic
953062615 3:39439871-39439893 ATGAATCTGGAGAGGGAAGCAGG - Intergenic
953775263 3:45811266-45811288 CTGGCTTTAGGAAGGGAAGTGGG - Intergenic
954476258 3:50749037-50749059 CTTAATTTTGGGAGGGAGGGAGG - Intronic
954746813 3:52792074-52792096 CTGATTTTGGGGAGGGAGGATGG + Intergenic
955570340 3:60298252-60298274 CTGACTCTAGGGAGGGGAGAGGG - Intronic
959582013 3:107992046-107992068 CAGACTTTGGGGAGTGAAGCTGG + Intergenic
960184691 3:114624252-114624274 CAGAAATTAGGGAGGGGAGGTGG + Intronic
960340494 3:116469134-116469156 CTGAATTTCGAGAAGGGAGCTGG - Intronic
961345042 3:126258819-126258841 GTGAACTGAGGGAGGGGAGCTGG - Intergenic
965220519 3:165921092-165921114 CTGAGTGTTGGGAGAGAAGCTGG + Intergenic
965562620 3:170076111-170076133 TTGTATCTAGGGAGGGAAACTGG + Intronic
965959441 3:174411512-174411534 CTTCACTTAGGGAGAGAAGCAGG - Intergenic
967293805 3:187946705-187946727 GTGAGTTTAGGGAGGCAGGCAGG + Intergenic
968068463 3:195771839-195771861 CAGCATTCAGGGAGGGAAGTGGG + Intronic
969954094 4:10870465-10870487 GTGAATTTGGAGAGGGTAGCAGG + Intergenic
972276269 4:37560676-37560698 CTAGATGCAGGGAGGGAAGCTGG - Intronic
973148200 4:46856382-46856404 GTGAATTTGTGGAGTGAAGCAGG - Intronic
973890623 4:55364063-55364085 CTGAATTGTAGGAGGGGAGCTGG + Exonic
973958375 4:56086194-56086216 CTGAATCTTGGGAGGGAGCCAGG + Intergenic
976965851 4:91039946-91039968 TTGAATTTTGGGAGTAAAGCAGG - Intronic
977149611 4:93493981-93494003 TTAAATTTCGGGAGGGAATCTGG - Intronic
981409377 4:144410835-144410857 CTGAAGTTTTGGAGGGAAGAGGG - Intergenic
982711504 4:158762554-158762576 ATGAATTTAGCGAGGAAGGCAGG + Intergenic
983558910 4:169082238-169082260 CTGGAGTTAGAGAGAGAAGCAGG - Intergenic
983674958 4:170281452-170281474 CTGACTTATGGTAGGGAAGCAGG - Intergenic
984314689 4:178112966-178112988 CAGAATATAGGGAGGGAACTGGG + Intergenic
985189788 4:187360316-187360338 TTGTATTTGGGGAGGGAAGAAGG + Intergenic
985191363 4:187376909-187376931 CTCCAGTTAAGGAGGGAAGCAGG + Intergenic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
985919705 5:2960648-2960670 GTGAATTTAAGGAGGAAAGTGGG - Intergenic
986986981 5:13511519-13511541 GTGAATGTAGGGAAGGCAGCAGG + Intergenic
991607380 5:68416583-68416605 AGGAATTGTGGGAGGGAAGCAGG + Intergenic
993991443 5:94662781-94662803 GTTAAATTAGGGAGGGAATCGGG + Intronic
994780839 5:104088062-104088084 CTGAATTTAAAGATGGAAGAAGG - Intergenic
996315148 5:122152942-122152964 TTGAATTTAGGGAGTAAAGGAGG + Exonic
996551273 5:124732942-124732964 CTGTATAGAGGGAGGGAAGAAGG - Intronic
996883927 5:128333325-128333347 CTGAATCTGGGCAGGGAAGAAGG - Intronic
997275391 5:132582934-132582956 CTGGATTTAAGGAATGAAGCAGG + Intronic
997430197 5:133832625-133832647 ATGTATGTAGGGAGGAAAGCTGG - Intergenic
1000253216 5:159514523-159514545 CTGAATTTGTGCAGGGAATCAGG - Intergenic
1000337335 5:160251595-160251617 CTGATTTGAGAGAGGGAAGGAGG + Intergenic
1000555261 5:162718072-162718094 AAGAGTTTAGGGAGGGAGGCTGG - Intergenic
1003116441 6:3286814-3286836 CTGGGTGCAGGGAGGGAAGCTGG - Intronic
1003770264 6:9291353-9291375 CTGAATTTATTGAGGGAAGGGGG - Intergenic
1005194011 6:23261181-23261203 CTGAATTGAGGTAAGGGAGCTGG - Intergenic
1007562484 6:42821506-42821528 CTGCATTTAGAGAGAGAAGAGGG - Intronic
1009569716 6:65368780-65368802 CTGACTCTTGGGAGGGAAGTTGG - Intronic
1009882524 6:69586218-69586240 CTGCAATTAGGGAAGGAAACTGG - Intergenic
1010161257 6:72859555-72859577 CTGGAATAAGTGAGGGAAGCAGG - Intronic
1010641012 6:78327297-78327319 ATGTATTTAAGGAGGGAAACAGG - Intergenic
1012150533 6:95745102-95745124 ATGATTTTAGGGAGAGAAGAAGG - Intergenic
1012996826 6:105982815-105982837 CAGGATTTAGTGAGGGAAACTGG - Intergenic
1014015886 6:116529452-116529474 CTAACTGTAGGGTGGGAAGCAGG - Intronic
1014410877 6:121118764-121118786 CTGACTTTGGGAAAGGAAGCAGG - Intronic
1015007663 6:128303071-128303093 GTGAGTTTAGGGAAGGAAGGCGG - Intronic
1016475939 6:144428025-144428047 ATGAATTCAGGGAGGGAAGTGGG + Intronic
1016995859 6:149962187-149962209 CTGACTTCAGGGAGGGTGGCAGG + Intergenic
1017002720 6:150006981-150007003 CTGACTTCAGGGAGGGCGGCAGG - Intergenic
1017121460 6:151028100-151028122 CTGGGTTGAGGCAGGGAAGCAGG + Intronic
1017353949 6:153480071-153480093 CTGACTTTAAGGAGGGAAACTGG - Intergenic
1017605242 6:156126546-156126568 CTGTAATTAGAAAGGGAAGCAGG - Intergenic
1017615577 6:156243508-156243530 CTGAACTGGGGGAGGGGAGCAGG - Intergenic
1018609750 6:165636614-165636636 TTGCATTTAGGGTGGGAAGCTGG - Intronic
1018929397 6:168230659-168230681 CTGAATATACGAAGGGACGCTGG + Intergenic
1019918933 7:4150636-4150658 CTGAATGTAGGGAGGGAGGCAGG + Intronic
1021809613 7:24390603-24390625 CTGCATTCAGGGTGGGAAGAGGG - Intergenic
1025079119 7:55966891-55966913 CTGAATGTAGGAGGGGGAGCTGG + Intronic
1025300256 7:57814331-57814353 ATGTGTTCAGGGAGGGAAGCAGG - Intergenic
1026982255 7:74533668-74533690 CTTCCCTTAGGGAGGGAAGCAGG - Intronic
1028482389 7:91321783-91321805 AGGAAGTTAGGGAGGGAAGATGG - Intergenic
1030962516 7:115944726-115944748 CTGAATTGAGAGAGGAAACCTGG - Intronic
1031069683 7:117148753-117148775 CCTGATTTAGGGTGGGAAGCAGG - Intronic
1031270364 7:119641723-119641745 CTGAATTTAAAGAGAGAAGAAGG - Intergenic
1033423349 7:141221736-141221758 CTGAAGATGGGGAGGGCAGCAGG + Intronic
1033534373 7:142298582-142298604 CTGAGATGAGGGAGGGGAGCTGG + Intergenic
1035192217 7:157180886-157180908 CTGATTGTAGGGCGGGATGCAGG + Intronic
1036124609 8:6051595-6051617 CTGCTTTTGGGAAGGGAAGCTGG - Intergenic
1037106044 8:15110193-15110215 CTGTCTTTAGGGAGGGAGGTAGG + Intronic
1037251097 8:16895152-16895174 CTGAATTTAGGTAGAGGAGATGG + Intergenic
1037986555 8:23294104-23294126 CAGCATTTAGGGAGGGAACAGGG + Intronic
1039740406 8:40377760-40377782 CTGAGTTTAGGGAAGGGAGATGG + Intergenic
1040618401 8:49062900-49062922 CAGAATTTACGGAGTGAAGGAGG + Intronic
1042745111 8:72098787-72098809 CTGAAAGAATGGAGGGAAGCTGG - Intronic
1043527863 8:81115655-81115677 TGGAATTTAGGGATGGAAGAAGG + Intergenic
1044560375 8:93606521-93606543 CTGAATATAGGGATGGGAGGTGG + Intergenic
1044946701 8:97396294-97396316 CAGAAGATGGGGAGGGAAGCGGG - Intergenic
1046380118 8:113438744-113438766 CTGAATTTAATGAGGTCAGCTGG - Intergenic
1046892894 8:119442417-119442439 CTGAATTGGGGGTGGGAAGATGG + Intergenic
1046966210 8:120168576-120168598 TTGAATTTAGGCAGGCAAGTGGG - Intronic
1047091271 8:121578317-121578339 CATAATTTAGGGTGGGAAGACGG - Intergenic
1047188985 8:122661019-122661041 CTGAATGTAGGGGAGGAAGGTGG - Intergenic
1047682151 8:127265139-127265161 CTGAATTCAGGCAGGGAACAAGG + Intergenic
1047733188 8:127743417-127743439 CTGACTTTCGGGAAGGAAGTTGG - Intergenic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1048482105 8:134807573-134807595 CTGAAATAAGGCAGGGCAGCTGG + Intergenic
1048817866 8:138350923-138350945 ATGACTTTGGGGAGGTAAGCAGG - Intronic
1052495485 9:29218414-29218436 ATGAATTTGGGGTGGGAAGAAGG + Intergenic
1055172485 9:73275989-73276011 CTGAATTTTGGGGGGAAAGAAGG + Intergenic
1055787966 9:79891457-79891479 GTGAAATTTGGGAGGGAAACTGG + Intergenic
1056435127 9:86568602-86568624 CTGAATTTGGGCAAGGAGGCTGG + Intergenic
1056981999 9:91322426-91322448 CTGAAGCTGGGGAGAGAAGCAGG + Intronic
1057310031 9:93936918-93936940 CTGAATCTTGAAAGGGAAGCAGG + Intergenic
1058551083 9:106115812-106115834 CTGAATCTAAGCTGGGAAGCTGG + Intergenic
1059358071 9:113716745-113716767 TTGAATTAAGGCAGGGAGGCTGG + Intergenic
1060488619 9:124065519-124065541 CTGAATGGAGGGAGGGAGGCAGG + Intergenic
1061777911 9:132978090-132978112 CTGAACTTGGGGAGGGAGGGAGG + Intronic
1062010837 9:134265821-134265843 ATGAAGGTAGGGAGGGAAGGAGG - Intergenic
1062521111 9:136958395-136958417 CTGCCTTGGGGGAGGGAAGCTGG - Intergenic
1185612794 X:1402447-1402469 CTGAATTTTGGGAGGGGGGAAGG - Intergenic
1186060153 X:5696145-5696167 CTAAATCTAGGGAGGGTAGTGGG + Intergenic
1186493357 X:9992537-9992559 CTGAAATCACGGATGGAAGCCGG - Intergenic
1187447419 X:19371834-19371856 CTGAAATAAGGGAGGGGGGCCGG + Intronic
1188679128 X:32979896-32979918 CGTAATTTAGGGAGGGAGGTTGG + Intronic
1190378170 X:49811644-49811666 CTGGTTGTAGGGAGGGGAGCAGG + Intergenic
1190391430 X:49935596-49935618 CTGAATTTATAGAGAGAAGAAGG + Intronic
1191670064 X:63740726-63740748 CTGAGTGAAGGGTGGGAAGCAGG - Intronic
1192490931 X:71577121-71577143 CTGTATTTAGGTAGGCAATCTGG + Intergenic
1193138362 X:77998663-77998685 CGGAATTTAAGGCGGGAAGAAGG + Exonic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1195441229 X:104900865-104900887 ATGAATTTAGGGAGAGACGAAGG + Intronic
1195667627 X:107445157-107445179 ATGAATTTTGACAGGGAAGCAGG + Intergenic
1196136657 X:112217136-112217158 CTGATTGGAGGGAAGGAAGCTGG + Intergenic
1196889107 X:120275240-120275262 CAGAGTCTGGGGAGGGAAGCTGG + Intronic
1198773927 X:140159579-140159601 CTGTAATGATGGAGGGAAGCTGG + Intergenic
1199356828 X:146872117-146872139 CTAAATTTAGGGAGTGAATGTGG + Intergenic
1200228130 X:154430657-154430679 CGGCCTTTAGGGAAGGAAGCAGG + Intronic
1202378467 Y:24258035-24258057 CTTAGTTCAGGGTGGGAAGCAGG - Intergenic
1202492315 Y:25412086-25412108 CTTAGTTCAGGGTGGGAAGCAGG + Intergenic