ID: 1141526960

View in Genome Browser
Species Human (GRCh38)
Location 16:84617951-84617973
Sequence CCGAGCGCGCCCCTGGCCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141526953_1141526960 3 Left 1141526953 16:84617925-84617947 CCGCAGCGGGACACTGTCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1141526960 16:84617951-84617973 CCGAGCGCGCCCCTGGCCGGCGG 0: 1
1: 0
2: 1
3: 10
4: 159
1141526947_1141526960 17 Left 1141526947 16:84617911-84617933 CCATCGCCGCGGAGCCGCAGCGG 0: 1
1: 0
2: 0
3: 12
4: 140
Right 1141526960 16:84617951-84617973 CCGAGCGCGCCCCTGGCCGGCGG 0: 1
1: 0
2: 1
3: 10
4: 159
1141526950_1141526960 11 Left 1141526950 16:84617917-84617939 CCGCGGAGCCGCAGCGGGACACT 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1141526960 16:84617951-84617973 CCGAGCGCGCCCCTGGCCGGCGG 0: 1
1: 0
2: 1
3: 10
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141526960 Original CRISPR CCGAGCGCGCCCCTGGCCGG CGG Exonic
906214257 1:44030143-44030165 CCGACCGCGCCCCTGCCCGCCGG - Intronic
911450376 1:98054012-98054034 CCAAGGGCGCCCCGGGCTGGAGG + Intergenic
915570695 1:156743741-156743763 CTGAGCCCGGCTCTGGCCGGGGG - Exonic
916694597 1:167221894-167221916 GCCCGCGCGCCCCCGGCCGGCGG + Intronic
918001618 1:180502511-180502533 CTGAGCGCGCTGTTGGCCGGAGG - Exonic
921023597 1:211258858-211258880 CAGAGCGCGCCCCTAGCTCGAGG + Intronic
921671107 1:217925064-217925086 CCGAGCGCGCCCAGGGCCTGGGG - Intergenic
922153293 1:223022832-223022854 CCCAGCCTGCCCCTGGCCTGTGG + Intergenic
922699668 1:227751347-227751369 CTGAGAGTGCACCTGGCCGGCGG - Intronic
922951043 1:229558682-229558704 CTTTGCGCGCGCCTGGCCGGCGG - Exonic
924558117 1:245134571-245134593 CCGAGCGCGCTCCTGCCTCGGGG + Intergenic
1063429656 10:5977529-5977551 GCGAGCGCTGCCCAGGCCGGGGG + Exonic
1065845126 10:29737010-29737032 CGGACCGCGCGCCAGGCCGGCGG + Intergenic
1068669665 10:59710050-59710072 CCGAGAGGGCGCCTGGCCGACGG - Exonic
1069486486 10:68827290-68827312 CAGAGCGCGCCCCTGGGGGAAGG + Intergenic
1070152100 10:73811429-73811451 CTGAGCGCGACCGTGGGCGGGGG + Intronic
1075634514 10:124021207-124021229 CCGAGCTGGCCCCTGGCAGAAGG - Intronic
1076611543 10:131729026-131729048 CCGAGGAAGCCCCTGGCTGGAGG + Intergenic
1076738944 10:132471681-132471703 CCCAGCACAACCCTGGCCGGAGG + Intergenic
1077020836 11:416576-416598 CCGCGGCCGCCCCTGCCCGGTGG + Intronic
1077976358 11:7252190-7252212 CAGAGCGCGTCCCTGGCCCCGGG - Exonic
1081812815 11:45922891-45922913 CCGAGGGCGCCCCCGGGCGCTGG + Exonic
1081814656 11:45931772-45931794 CCTTGCGTGCCCCTGGCCGATGG - Intronic
1081907687 11:46679885-46679907 CAGAGGGCGCCCCTGGGAGGAGG - Intronic
1083655267 11:64226344-64226366 CCCCGCGCGCCCCGGGTCGGAGG + Exonic
1083922308 11:65787490-65787512 CCGCGGGTGCCCCAGGCCGGAGG - Intronic
1084527219 11:69704708-69704730 CCGGGCGCGCTCTCGGCCGGCGG + Intergenic
1087761983 11:102111211-102111233 CCGAGCGCCCCCCCGGTCTGAGG - Intronic
1090472362 11:126991253-126991275 CTGAGAGGGCCCCTGGCAGGAGG - Intronic
1091563705 12:1632732-1632754 CCGGGCTCTCCCCTGGCCAGAGG + Exonic
1092462507 12:8698425-8698447 CCGAGCGCGCCCGGGGTCCGGGG + Intronic
1093057216 12:14567554-14567576 CAGAGCGCGCCCTGGGCGGGGGG - Intronic
1096598658 12:52714305-52714327 CCGAGGACGCCCCTGGCGCGGGG + Intergenic
1100611542 12:96194932-96194954 CCGAGCTCGCGCCGGGCCCGGGG + Intronic
1101692413 12:107093999-107094021 CCGAGCGCGCTCCTGCCCGCCGG - Intergenic
1102477858 12:113200531-113200553 CCGAGGGGGCCCCTGGTGGGGGG - Intronic
1105800985 13:23903360-23903382 CCGGCCGCGCCCCTGCTCGGAGG + Intergenic
1106665390 13:31846510-31846532 CCGAGCGCGCCGGTGCCCGCAGG + Intergenic
1112503553 13:99959758-99959780 CCTAGAGCGCCCCTCGCCGGTGG + Intergenic
1112509430 13:99997070-99997092 GCGCGCGCGCCCCTGGGCGCAGG + Intergenic
1113485852 13:110651963-110651985 CGGAGCGCGTCCCTGGCCAGGGG - Intronic
1117029236 14:51651873-51651895 CGGAGCGCCCCTCTGGCTGGCGG + Intronic
1122220825 14:100238511-100238533 CCGAGTGCGGCCCCGGCCCGAGG + Intronic
1122779088 14:104136165-104136187 CCCCGCGCGCCACTGGGCGGAGG - Intergenic
1124790111 15:32718787-32718809 CGGGGCGCGGCCCTGGCCGCGGG + Intronic
1127221713 15:56887310-56887332 CCGCGCGCGGCCCGGCCCGGCGG - Intronic
1127342863 15:58065710-58065732 GCGAGCGCGCCCCCGGGCCGCGG - Exonic
1128528912 15:68431209-68431231 CCGCGCGCCCCTCGGGCCGGAGG + Intronic
1129287980 15:74541165-74541187 CCGCCCCCGCCCCTGGCTGGCGG + Exonic
1131160429 15:90101868-90101890 CCGCGCGCTCCCCTGGCGAGAGG - Intronic
1131517612 15:93089322-93089344 CCGCGCGCGCCCCCCGCCCGCGG - Intergenic
1131838015 15:96409498-96409520 CAGATCGCGCCCCGCGCCGGCGG - Intergenic
1136365000 16:29805912-29805934 GCGAGCGCGCGCGTGGCCAGCGG - Intergenic
1138178718 16:54928827-54928849 CCGCGCGCGCCGCCCGCCGGGGG - Intergenic
1138247904 16:55480549-55480571 GCGTGCGCGCGCCTGGCTGGAGG + Intronic
1139850933 16:69951377-69951399 CAGAGACCTCCCCTGGCCGGGGG + Exonic
1139879915 16:70174289-70174311 CAGAGACCTCCCCTGGCCGGGGG + Exonic
1140372599 16:74421238-74421260 CAGAGACCTCCCCTGGCCGGGGG - Exonic
1141526960 16:84617951-84617973 CCGAGCGCGCCCCTGGCCGGCGG + Exonic
1142764098 17:2056166-2056188 CCTGGCGCCGCCCTGGCCGGGGG - Intronic
1142876315 17:2853715-2853737 CGGGGCGCGGCCCGGGCCGGCGG - Intronic
1144724498 17:17495031-17495053 CCGCGCGCGCTCCCGGCCTGGGG + Exonic
1147608309 17:41786447-41786469 CCCAGCGCGCCCCCTGCCGCCGG + Intronic
1147830707 17:43296882-43296904 CCGGGCGCGCCTCTGCCTGGGGG + Intergenic
1150423211 17:65056705-65056727 CCGAGCGCGCCCAGGGAGGGAGG + Exonic
1152174923 17:78781600-78781622 CGGAGCCCGCGCCTCGCCGGCGG + Intronic
1152321575 17:79610936-79610958 CCTCGCGCGCCCCTTGCCGCTGG - Intergenic
1152349676 17:79777894-79777916 GCGGGCGGGCCCCTGGCTGGGGG - Intergenic
1152357395 17:79813715-79813737 CAAAGCCCGCCCCGGGCCGGCGG + Intergenic
1152809544 17:82375071-82375093 GCGCGCGCGCCCCCGGCCGCCGG - Exonic
1154218518 18:12432934-12432956 CCGAGTCCGCTTCTGGCCGGCGG - Intergenic
1160025063 18:75209650-75209672 CCGAGCGCGGCCCGGGCGGCGGG + Intergenic
1162485869 19:10960513-10960535 CCAGGCGCGCCCTTGGCCCGCGG + Intergenic
1163783282 19:19261552-19261574 CCGAGCGCACACCTGGGGGGCGG + Exonic
1163850991 19:19663551-19663573 CCGCGCGCGCTCCTTGCCGCCGG - Exonic
1165686890 19:37829633-37829655 CCGTGCTCGCCCTTGGCCTGAGG - Intergenic
1166092517 19:40519528-40519550 GAGAGCGCGCCCCGGGCCGGCGG + Exonic
1166250216 19:41564688-41564710 CCGAGCCCGTCCCTTGGCGGTGG + Intronic
1166809587 19:45507506-45507528 CAGCGCGCACCCCTTGCCGGTGG - Exonic
1166809649 19:45507707-45507729 CCCGGGGCGCCCCTGGCTGGAGG - Exonic
1168072950 19:53962953-53962975 CAGAGCGCGGCCATGGTCGGCGG - Intergenic
924987713 2:287550-287572 CCGAGCGCGCCCGAGGGCCGGGG - Intronic
925027505 2:621281-621303 CTGCGCGCGCCCCAGGGCGGAGG - Intergenic
925181142 2:1817643-1817665 CCCAGCGCGGCCCTGGGGGGTGG + Intronic
925984615 2:9206353-9206375 CGGAGCTCGCCCCCTGCCGGAGG - Intergenic
926268188 2:11344696-11344718 CGGAGCGCGCGCAGGGCCGGCGG - Intronic
927904819 2:26848634-26848656 GCGGGGGCGCCTCTGGCCGGGGG + Intronic
930032903 2:47069277-47069299 CCCATCGGGCCCCTGGCCGCTGG + Intronic
931428967 2:62195260-62195282 CCAAGGCCGCCTCTGGCCGGCGG + Intergenic
934933278 2:98445336-98445358 CCGAGCGGGCGCGTGGCCGCGGG + Intronic
935145376 2:100391804-100391826 CCACGCGCGCCCCAGGCAGGTGG - Intergenic
935650063 2:105374357-105374379 CCCACCTCGCCCCTGGCCTGTGG - Intronic
943669678 2:190648431-190648453 CCAGGTGCGCCCCTGCCCGGGGG - Intronic
946313673 2:218896520-218896542 CCCAGCTAGCCCCTGGCAGGGGG + Intronic
947435457 2:230068518-230068540 CCGCGCGCGCCGCGGGCCTGGGG - Intronic
947860473 2:233354434-233354456 CCGAGGGCGGGCCGGGCCGGGGG - Intergenic
948487354 2:238289207-238289229 GGGGGCGCGCCTCTGGCCGGTGG - Intronic
1171012909 20:21518180-21518202 CCCAGCATGCCCCGGGCCGGAGG + Intergenic
1174054055 20:47785834-47785856 CCGCGCGTCCCCCAGGCCGGAGG - Exonic
1175679308 20:60974139-60974161 CTGAGCGCTCTCCTGGCCCGAGG + Intergenic
1175715816 20:61253399-61253421 CCGGGGGCGCCCCTGGGCGGAGG + Intronic
1176306858 21:5128212-5128234 ACCAGCGCGACCCTGGCCGCGGG + Exonic
1176952633 21:15064842-15064864 CCGTGAGCGCCGCTGGTCGGAGG - Exonic
1179850199 21:44133818-44133840 ACCAGCGCGACCCTGGCCGCGGG - Exonic
1180005434 21:45018609-45018631 CCGAGCGCGCCCTTGAGAGGCGG + Intergenic
1181023933 22:20117140-20117162 CGGCGCGGGCCCCTGGCGGGCGG - Exonic
1183743145 22:39679354-39679376 CCCCGGGCGCCCCTGGCCGAGGG + Exonic
1184164824 22:42720901-42720923 CTGACCCCGCCCCGGGCCGGAGG - Intronic
1184663779 22:45977191-45977213 GCGAGCGCGCCCCAGGTAGGAGG + Intergenic
1185259282 22:49852967-49852989 CGGAGCCCGCCCCTGCCCCGCGG - Intergenic
950094528 3:10321156-10321178 CCGAGCGCGTTGCTGCCCGGAGG - Intronic
950345222 3:12287564-12287586 CCCAGACCGGCCCTGGCCGGGGG + Intronic
951902088 3:27666897-27666919 CCCAGCCCGGCCCTGGCTGGTGG - Intergenic
952241367 3:31533461-31533483 CCGGGCGCGCCCCCTGCCCGTGG + Intronic
953748719 3:45594085-45594107 CCGAGCCCGCGCCGGGGCGGAGG - Intronic
954110141 3:48429158-48429180 CCCAGGCCGCCCCTGCCCGGCGG + Intronic
954327179 3:49869936-49869958 CCCAGCCCGCCCCCGGCCCGGGG - Exonic
956080247 3:65549450-65549472 CCGAGCGCGCGCCTGGGCTCCGG - Intronic
958719002 3:97822181-97822203 CCGAGGGGGCCGCTGGCCCGGGG - Exonic
961446306 3:126983265-126983287 CGGGGCGCGCCCCGGGGCGGCGG + Intergenic
965590556 3:170357366-170357388 CCGGGCGCGCGCCTGGGGGGAGG + Intergenic
968081552 3:195849852-195849874 CTGCGCGCGCCCCCTGCCGGCGG - Intergenic
968809373 4:2793113-2793135 CCGAGCGCTCTCCTGGCCCGCGG - Intronic
969303123 4:6309122-6309144 CCGAGCCTCCCCCTGGCCGTGGG - Intergenic
969379052 4:6782611-6782633 TGGAGCGCGCCCCTGGTTGGCGG + Intronic
969491201 4:7500137-7500159 CGGAGCACACCCCTGCCCGGTGG + Intronic
969559555 4:7938881-7938903 CCGTCCTCTCCCCTGGCCGGCGG - Intronic
969638224 4:8381793-8381815 CCCAGGGCCCCCCTGGCTGGAGG + Intronic
979674672 4:123398333-123398355 CGGGGAGCGCTCCTGGCCGGTGG + Intronic
982564673 4:156971910-156971932 CGGAGCGCGCGCCTGGCGAGCGG + Intergenic
985646473 5:1087055-1087077 CCAAGTGCGCCCCTGACCCGCGG - Intronic
996871898 5:128201461-128201483 CCCAGCGCACACCTGCCCGGCGG - Intergenic
1001462134 5:171925084-171925106 CGGAGCGCGGCCCTGGGCAGGGG + Intronic
1002096651 5:176835176-176835198 ACAAGCCAGCCCCTGGCCGGAGG - Intronic
1002190146 5:177473638-177473660 CCGAGCGAGCCAGCGGCCGGGGG + Intronic
1002415997 5:179121339-179121361 CCGAGCCCGTCCCGGCCCGGGGG - Intronic
1003345294 6:5260999-5261021 CCGATCCCGCCCCCGCCCGGAGG + Intergenic
1004864378 6:19838281-19838303 CCTGGCCCGCCCCTGCCCGGAGG - Intronic
1007431556 6:41780056-41780078 CAGAGGGCGCTCCTGGCCAGGGG + Intronic
1014943904 6:127475162-127475184 CCCAGCGCGGCCCTGAGCGGGGG + Intronic
1015999703 6:139029688-139029710 GTGAGCGCGCCCCAGACCGGAGG + Intronic
1017174959 6:151494101-151494123 CCGAGCGCGCCCCCGGGCTCGGG + Exonic
1019153425 6:170023727-170023749 CCGAGGCCGCCCCAGGCCGCAGG + Intergenic
1019199952 6:170306347-170306369 GCGAGCGCGGCCCAGGCGGGTGG - Intronic
1019478450 7:1255234-1255256 CAGAGCAGGCCCCAGGCCGGAGG - Intergenic
1020234984 7:6348514-6348536 CCGAGCGCCCGCCTCGCCCGCGG - Intronic
1022859565 7:34353448-34353470 CCCAGCGCGCCCCTGCCTGAAGG + Intergenic
1026776690 7:73235135-73235157 CCGAGGGCGCCCCTGCCCCCAGG - Intergenic
1027017542 7:74788505-74788527 CCGAGGGCGCCCCTGCCCCCAGG - Intronic
1027070481 7:75157427-75157449 CCGAGGGCGCCCCTGCCCCCAGG + Intergenic
1028709377 7:93890461-93890483 CCGCGCGCTCCGCTGGCAGGGGG - Intronic
1029629808 7:101743305-101743327 CCACGCGCGCGCCTGGCAGGGGG + Intergenic
1031966550 7:128031651-128031673 CCGCGCGCTCCTCCGGCCGGCGG - Intronic
1033640982 7:143263316-143263338 CCCACCCCGCCCCTGGCTGGGGG + Intronic
1034440495 7:151083381-151083403 CCGACCGGGGCCCTGGGCGGCGG + Intronic
1035266100 7:157691003-157691025 CCCGGCGCGCACCCGGCCGGCGG + Intronic
1035425069 7:158765161-158765183 CAGAGCGCGCTCCTGGCAGAGGG + Intronic
1043174000 8:77000735-77000757 GCCAGCGCGCGCCTGGCCTGAGG + Intronic
1043388154 8:79768013-79768035 CCGCGCCCGCCCCTGCCCGGCGG + Intergenic
1049710277 8:144060239-144060261 CCGAGCGAGAGCCTGGCCGGCGG + Intronic
1058908186 9:109498148-109498170 CCGAGCGCGACCCCGGCCCCCGG + Intronic
1061222147 9:129258504-129258526 CCGAGCGCGCCCGGAGCAGGAGG - Intergenic
1061382314 9:130265855-130265877 CCGAGCGCGGCTCTGGCTGCGGG - Intergenic
1061975993 9:134068208-134068230 CCGAGAGCGGGCCTGGCCCGGGG + Intronic
1062482092 9:136757237-136757259 CCCAGCAGGCCCCTGCCCGGGGG - Intronic
1062629915 9:137458956-137458978 CCGAGTCCGCCCCTGCCCCGCGG - Intronic
1062689718 9:137834958-137834980 CCGAGCGCCCCGCTGGCCGGCGG - Exonic
1062696504 9:137878551-137878573 CCGTGCGCGCGCCTGGCTGCAGG + Intronic
1187163863 X:16786981-16787003 CCCAGCGAGCCCCCGGACGGCGG - Intronic
1189001941 X:36957510-36957532 CCTACCGCGGCCCTGGCCCGCGG - Intergenic
1197925871 X:131646775-131646797 CTGAGCCCGGCTCTGGCCGGGGG + Intergenic