ID: 1141529817

View in Genome Browser
Species Human (GRCh38)
Location 16:84638368-84638390
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141529810_1141529817 14 Left 1141529810 16:84638331-84638353 CCTGGCACAGACGCGTCGCTGCA No data
Right 1141529817 16:84638368-84638390 GCCTGATCCCCAGGGAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141529817 Original CRISPR GCCTGATCCCCAGGGAGCTG TGG Intergenic