ID: 1141532565

View in Genome Browser
Species Human (GRCh38)
Location 16:84656983-84657005
Sequence CACGGCCAGCAGGTTGCGAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 55}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141532565_1141532572 20 Left 1141532565 16:84656983-84657005 CCCATCGCAACCTGCTGGCCGTG 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1141532572 16:84657026-84657048 CATGTTCACCATCGGCATGCGGG 0: 1
1: 0
2: 2
3: 7
4: 80
1141532565_1141532569 12 Left 1141532565 16:84656983-84657005 CCCATCGCAACCTGCTGGCCGTG 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1141532569 16:84657018-84657040 TTCAACTCCATGTTCACCATCGG 0: 1
1: 0
2: 0
3: 9
4: 150
1141532565_1141532571 19 Left 1141532565 16:84656983-84657005 CCCATCGCAACCTGCTGGCCGTG 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1141532571 16:84657025-84657047 CCATGTTCACCATCGGCATGCGG 0: 1
1: 0
2: 1
3: 8
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141532565 Original CRISPR CACGGCCAGCAGGTTGCGAT GGG (reversed) Exonic
901520972 1:9784719-9784741 CACTGCCAGCAGGTGGTGACAGG + Intronic
902808512 1:18875305-18875327 CACGTCCAGGAGGTGGGGATGGG + Intronic
903032966 1:20476604-20476626 CCAGGCCAGCCGGTTGCCATGGG - Intergenic
903344288 1:22674318-22674340 CACTGCCACCAGGTGGCGGTAGG + Intergenic
907248387 1:53122259-53122281 CACTGCCAGGAGGTTGTGACTGG - Intronic
910838081 1:91535636-91535658 CACGGCCAGGCGGTGGCGAGCGG + Intergenic
920845756 1:209591895-209591917 CACGGCCAGCTGGCTGGGGTTGG - Intronic
921552114 1:216549918-216549940 CACTGCCAGCAGTTTCTGATGGG + Intronic
923149259 1:231219071-231219093 CAAAGCCAGCAGGTGGCCATGGG - Intronic
923387780 1:233482581-233482603 AAAGGTCAGCAGGTTGGGATAGG - Intergenic
1070797410 10:79224655-79224677 CACGGCCACCTGATTGGGATAGG + Intronic
1076206674 10:128609705-128609727 CAGGGCCAGCAAGTGGCGACTGG - Intergenic
1077146512 11:1048923-1048945 CAGAGCCAGGAGGTGGCGATAGG - Intergenic
1084198383 11:67539385-67539407 CAAGTCCAGCAGGTTGTGGTCGG - Intergenic
1087173031 11:95069848-95069870 CGCGTCCAGCAGGTGGCGAAGGG + Exonic
1097728461 12:63100791-63100813 CAGGGCCAGCAGATTGAGTTGGG + Intergenic
1101530929 12:105573079-105573101 CATGGCCAGCAGGCTGAGTTGGG + Intergenic
1102040656 12:109798671-109798693 CACGGCCTCCAGGTTGCTGTCGG + Exonic
1102133822 12:110555604-110555626 CACTGCCAGCAGATTGCGAGTGG - Intronic
1105024289 12:132838224-132838246 CAGGGCCAGCAGGATGGGAGTGG - Intronic
1112036949 13:95505909-95505931 CACGCCCAGCTAGTTGAGATGGG + Intronic
1202947487 14_KI270726v1_random:41958-41980 CACGGCCAGCAGGGGGCGCGCGG + Intergenic
1124654569 15:31497994-31498016 CCTGGCCAGCAGGTTGCACTGGG - Intronic
1141532565 16:84656983-84657005 CACGGCCAGCAGGTTGCGATGGG - Exonic
1141830868 16:86509581-86509603 CTCGCCCAGCAGCTTGCGAGCGG - Intergenic
1141985528 16:87577312-87577334 CGAGTCCAGAAGGTTGCGATTGG - Intergenic
1142190685 16:88715989-88716011 CATGGGCAGCAGGTTGCAGTCGG + Exonic
1147791463 17:43016502-43016524 CAGGGCCATCAGGTTCCGTTTGG + Exonic
1151947011 17:77325381-77325403 CACGCCCAGCTGGTTCCGCTGGG + Intronic
1160809658 19:1007927-1007949 CACGGTCAGCAGTTTGCAGTCGG - Exonic
1161199770 19:3008155-3008177 CACGCCCAGCTGGTGGCGACTGG + Intronic
927988197 2:27428557-27428579 CACCGCCGGCAGGTTTCCATTGG - Exonic
928077513 2:28278718-28278740 AAAGGCCAGCAGCTGGCGATGGG + Intronic
935603754 2:104948831-104948853 CAAGGCCAGCAGGTTGCAAAAGG - Intergenic
946352371 2:219163624-219163646 CAGGGCAAGCAGGTTGTAATGGG + Intronic
947582932 2:231332898-231332920 CACGGCCAGCAGGTTGGTGTTGG + Intronic
1173183996 20:40825998-40826020 CACGGCCAGCAAGTTGATATTGG + Intergenic
1175062030 20:56252272-56252294 CTCGGCCAGCAAGTAGAGATAGG + Intergenic
1176160067 20:63643167-63643189 CAGGGCCAGCAGGATGCTAGGGG - Intronic
1180922342 22:19527415-19527437 CAGGGCCTGCAGGTGGAGATCGG + Exonic
1181021825 22:20107576-20107598 CATGCCCAGCAGGCTGGGATAGG - Intronic
1181093289 22:20489002-20489024 CGCAGCCAGCAGGATGCGATGGG + Exonic
1182128027 22:27830308-27830330 TAAGGCCAGCAGTTTGTGATGGG + Intergenic
1185227206 22:49659930-49659952 CTGGGCCAGCAGGATGGGATTGG - Intergenic
952942058 3:38453251-38453273 GAGGGCCAGCAGGTTGCCAGAGG + Intergenic
953877951 3:46677010-46677032 CACGCCCAGCTGCCTGCGATGGG + Exonic
958677068 3:97278758-97278780 CATGGCCAGCAGGTTTCTCTAGG + Intronic
963323768 3:143838327-143838349 CACATCAAGCAGTTTGCGATGGG + Intronic
971230936 4:24799910-24799932 CACGGCCAGCGGGTTGTAGTGGG - Exonic
971298872 4:25425589-25425611 CACGGGCAGCAGGGTGGGACTGG + Intergenic
979455543 4:120922515-120922537 CACGGCCCGCAGAGTGCGAAAGG - Exonic
987999697 5:25331848-25331870 CACTGCACACAGGTTGCGATGGG - Intergenic
998354638 5:141524888-141524910 CTCAGCCAGCAGGTGGCGCTGGG - Intronic
1001998802 5:176183634-176183656 CACAGCCATCAGGTGGCGGTTGG - Intergenic
1006333493 6:33408875-33408897 CCCGGCCAGGAGGTTCCTATTGG - Intronic
1014146458 6:118003422-118003444 CACAGCCGGCAGGTTGCCATGGG - Intronic
1018853910 6:167662320-167662342 CAGGGCCTGCAGGTGGTGATGGG + Intergenic
1019318770 7:405489-405511 CACGGCCAGGAGGGTGCTGTGGG - Intergenic
1026658596 7:72278728-72278750 CACTGCCAGCAGAGAGCGATCGG + Exonic
1044727874 8:95207932-95207954 CAGGGCCAGCAGGATGGGCTGGG - Intergenic
1049716678 8:144096189-144096211 CACGCCCACCAGGTGGCGGTAGG - Exonic
1057563581 9:96148170-96148192 CACAGCCAGCAGGTTGCATGTGG + Intergenic
1190925372 X:54898941-54898963 CAAGGCCAGCAGGTTGTGCTGGG + Intergenic