ID: 1141532700

View in Genome Browser
Species Human (GRCh38)
Location 16:84657805-84657827
Sequence GACACAGTGGTGGCTCCGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 130}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141532700_1141532711 12 Left 1141532700 16:84657805-84657827 CCCGGCGGAGCCACCACTGTGTC 0: 1
1: 0
2: 2
3: 10
4: 130
Right 1141532711 16:84657840-84657862 GGCTTCATCTTCATCGCCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 37
1141532700_1141532710 9 Left 1141532700 16:84657805-84657827 CCCGGCGGAGCCACCACTGTGTC 0: 1
1: 0
2: 2
3: 10
4: 130
Right 1141532710 16:84657837-84657859 GGGGGCTTCATCTTCATCGCCGG 0: 1
1: 0
2: 0
3: 14
4: 102
1141532700_1141532713 26 Left 1141532700 16:84657805-84657827 CCCGGCGGAGCCACCACTGTGTC 0: 1
1: 0
2: 2
3: 10
4: 130
Right 1141532713 16:84657854-84657876 CGCCGGCGGCAGCTTCTCACGGG 0: 1
1: 0
2: 3
3: 2
4: 76
1141532700_1141532709 -9 Left 1141532700 16:84657805-84657827 CCCGGCGGAGCCACCACTGTGTC 0: 1
1: 0
2: 2
3: 10
4: 130
Right 1141532709 16:84657819-84657841 CACTGTGTCGCGGTGCTGGGGGG 0: 1
1: 0
2: 0
3: 6
4: 113
1141532700_1141532708 -10 Left 1141532700 16:84657805-84657827 CCCGGCGGAGCCACCACTGTGTC 0: 1
1: 0
2: 2
3: 10
4: 130
Right 1141532708 16:84657818-84657840 CCACTGTGTCGCGGTGCTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 107
1141532700_1141532712 25 Left 1141532700 16:84657805-84657827 CCCGGCGGAGCCACCACTGTGTC 0: 1
1: 0
2: 2
3: 10
4: 130
Right 1141532712 16:84657853-84657875 TCGCCGGCGGCAGCTTCTCACGG 0: 1
1: 0
2: 0
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141532700 Original CRISPR GACACAGTGGTGGCTCCGCC GGG (reversed) Exonic
900266505 1:1759888-1759910 GACAAAGGAGTGGCTCTGCCAGG + Exonic
900408016 1:2500895-2500917 GGCACAGTGGGGGCTCCAGCGGG - Intronic
900974814 1:6010542-6010564 GACACAGCTGTGGCTCATCCAGG - Intronic
900986523 1:6076376-6076398 ACCACCGTGGTGGCTCCGACAGG - Intronic
901197028 1:7445975-7445997 GACACAGCTGTGGCTGCTCCAGG + Intronic
901420965 1:9150815-9150837 GACACAGTGGTGGCTTCCCCAGG - Intergenic
902395770 1:16131882-16131904 GGCACAGTGGTGACTGGGCCTGG - Intronic
904921293 1:34010287-34010309 GCCACAGTGGTGCCACCTCCAGG + Intronic
905111388 1:35597255-35597277 GACACAGTGGGGCCTCCTCTGGG + Intergenic
920709501 1:208281543-208281565 GATTCAGTGGTGGCTCCTCTGGG + Intergenic
921806353 1:219459818-219459840 GACACAGTGCCAGCTCTGCCAGG - Intergenic
924324519 1:242882517-242882539 GACACAGTGGTGGCTATTGCTGG - Intergenic
924834570 1:247635806-247635828 GAGACAATGGTGGCTCTGGCTGG + Intergenic
1070702220 10:78612499-78612521 GACACAGAGGTGGCTCTGAGAGG + Intergenic
1073152438 10:101321266-101321288 GGCACAGTGCTGGCTGCTCCAGG + Intergenic
1074485011 10:113867641-113867663 GACACAGTGTTCCCTCTGCCTGG + Intronic
1076571905 10:131438681-131438703 GACACTGTGGTGGCCCCGGGGGG - Intergenic
1076739766 10:132477458-132477480 CAAACAGTGGGGGCCCCGCCTGG - Intergenic
1077016225 11:400184-400206 GTCACTGTGGGGACTCCGCCTGG + Intronic
1077179400 11:1205519-1205541 CACACAGGCGTGGCTCCCCCAGG + Intergenic
1086940332 11:92790924-92790946 AACACAGTGGGGGCTCTGACAGG - Intronic
1094649796 12:32364445-32364467 GACACATCCGTGGCTCAGCCAGG + Intronic
1096236643 12:49932851-49932873 GACACAGTGGTGACTAAGGCAGG - Intergenic
1098382584 12:69884388-69884410 GACACAGTTGTGGCTTCCCTGGG - Intronic
1104395390 12:128428010-128428032 GCCAGAGTGCTGGCTCCTCCGGG + Intronic
1106487563 13:30185720-30185742 AACACAGTGGTGGGTCCCCCAGG - Intergenic
1106636661 13:31535895-31535917 GACACAGGGGTGGCTTCATCAGG - Intergenic
1107464364 13:40635922-40635944 GCCACAGTGCTGGCTCCCACTGG - Intronic
1108541895 13:51452993-51453015 GAGAAAGTGGTGACACCGCCGGG - Exonic
1112491818 13:99872647-99872669 GACACAGTGCTGGCCCAGACTGG - Intronic
1113455191 13:110443760-110443782 GACCCAGTGGAGGCTCCGCCGGG - Intronic
1113949296 13:114062504-114062526 GACACAGTGGTTCCACCCCCAGG + Intronic
1113992945 14:16042584-16042606 CACACAGGGGTGGCTCCGGAAGG - Intergenic
1119379512 14:74219561-74219583 GACACAGAGGGGGCTCCGTTTGG + Intergenic
1122267931 14:100555300-100555322 GGCACAGGAGAGGCTCCGCCAGG - Intronic
1127005547 15:54565251-54565273 GACACAGTGGTTGCTCCAAAAGG - Intronic
1128543919 15:68554980-68555002 TGCACAGTGGTGGCTCTCCCAGG + Intergenic
1132092936 15:98960394-98960416 GACAGCCTGGTGGCTCCCCCAGG - Exonic
1132463515 16:67118-67140 GACTCAGAGGTGGCCCCTCCTGG - Intronic
1132553305 16:562001-562023 GGCACAGAGGTGGCTTCTCCGGG + Intronic
1132639566 16:971381-971403 CACGCAGTGGTAGCACCGCCAGG - Intronic
1133980967 16:10633072-10633094 GCCACAGTGGCGGCCCCGCCAGG - Intronic
1136347209 16:29683830-29683852 GACACAGTGGGGCCTCTGCCTGG - Intronic
1138340317 16:56284938-56284960 CCCACAGCGGTGGCTCAGCCTGG + Intronic
1138343788 16:56307726-56307748 GACACCATGGTGTCTCCACCAGG - Intronic
1141171274 16:81693271-81693293 GAGGCAGTGGTGGCTCCTCTTGG + Intronic
1141532700 16:84657805-84657827 GACACAGTGGTGGCTCCGCCGGG - Exonic
1143032843 17:3977262-3977284 GACACAGTGGGGGCTCAGGGTGG + Intergenic
1143163562 17:4886425-4886447 GAAACAGTGGTGGCTCACACTGG - Intronic
1144599162 17:16597848-16597870 GACACAGAGGTGGGACAGCCTGG - Intergenic
1144661078 17:17071405-17071427 GACACCGTGGTGACTCTCCCAGG - Intronic
1146670047 17:34731029-34731051 GACACCGTGGTGACTCCTCTTGG + Intergenic
1147224555 17:38966628-38966650 GACACAGTGAAGTCCCCGCCTGG - Intronic
1150600329 17:66645631-66645653 GAGACAGTGATGGCTCCACCAGG - Intronic
1152557403 17:81060371-81060393 GACACAGTGGTGTGGCTGCCAGG - Intronic
1154309340 18:13255241-13255263 TACACAGTGGGAGCTCCTCCTGG + Intronic
1155381077 18:25223385-25223407 GCCACAGGGGGGCCTCCGCCAGG + Intronic
1155797206 18:30054867-30054889 GACACTGTGGGGGCTTCGTCAGG + Intergenic
1156483634 18:37451170-37451192 GACAGAGTGGTGGCTCCCTTGGG + Intronic
1159945424 18:74441277-74441299 GACACTGTGGGGCCTCCTCCGGG + Intronic
1160441905 18:78899494-78899516 GACAAGGTGGCGGCTCCACCTGG + Intergenic
1160869641 19:1271393-1271415 GGTACCGTGGTGGCTCTGCCGGG + Exonic
1161530393 19:4785472-4785494 GACACAGTGGGGGCTACGATTGG - Intergenic
1165621756 19:37253943-37253965 GACAAAATGGTGGCTCAGCAGGG - Intergenic
1167357840 19:49014985-49015007 GGGACAGGGGTGGCTCAGCCGGG - Intronic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
924973317 2:151123-151145 GACACAATAGTGGCTCCTTCTGG + Intergenic
924987646 2:287041-287063 CACACAGTCGGGGCTCAGCCAGG - Intronic
926341029 2:11904383-11904405 TCCACAGGGGTGGCTCTGCCGGG + Intergenic
948020689 2:234730834-234730856 GAAACAGTTGTGGCACCTCCAGG - Intergenic
948542964 2:238703137-238703159 GACACACTGGGGGCTCAGCCAGG + Intergenic
1171104776 20:22422075-22422097 GACACCGTGGTGGCTCAGCGGGG - Intergenic
1172161290 20:32870246-32870268 GACACAGTGGTGGCACTTCCTGG - Intronic
1174479542 20:50821095-50821117 GATACAGTGCTGGCTGCTCCCGG + Intronic
1175293293 20:57892578-57892600 GACACCCTGGATGCTCCGCCAGG - Intergenic
1175484594 20:59336926-59336948 GACAGAGTGGAGGCTGCGCTGGG + Intergenic
1175570187 20:60012296-60012318 GACACAGTGGTGGCCGCCCCAGG - Intronic
1176118679 20:63444522-63444544 GAGTCAGTGGTGGCTCTGGCTGG - Intronic
1179779400 21:43689758-43689780 GACACACGGGTGGCTCCGGCAGG - Intronic
1180563944 22:16647208-16647230 CCCACATTGGTGGCTCCACCTGG + Intergenic
1180964554 22:19779889-19779911 CTCACCGTGGTGCCTCCGCCTGG - Intronic
1182397416 22:30046346-30046368 GGCACAGTGGGGGCTCCCTCAGG - Intergenic
1184066959 22:42126628-42126650 GACACCATGGTGGCTGGGCCGGG + Exonic
1184111761 22:42399641-42399663 GTCACAGTGGAGGCTGGGCCGGG + Intronic
1184519504 22:44984461-44984483 GACCCAGTGGTGGATTCCCCAGG + Intronic
954155947 3:48685139-48685161 GTCTCAGTGGTGGCTCCAACGGG + Intronic
954917541 3:54161869-54161891 CACACAGTGGTGACTCCCCAAGG - Intronic
957288802 3:78250352-78250374 GACACAGTGGTGGGTTCTCTGGG + Intergenic
965667459 3:171110602-171110624 CACACAGTGGTGGCCATGCCTGG + Intronic
968902607 4:3438600-3438622 GACACAGTTGTGTCTATGCCAGG - Intronic
971567732 4:28167480-28167502 GTCACAGTGGTGGCCCCACAAGG - Intergenic
972331402 4:38067613-38067635 GACAAAGTGGTGTTTCTGCCTGG + Intronic
979259969 4:118636472-118636494 GAGACAGTGGTGGGGCAGCCAGG + Intergenic
982745919 4:159103784-159103806 GGGACAGTGGCGGCTCCTCCTGG - Intergenic
986128304 5:4904291-4904313 GACACAGGGAAGGCTCAGCCAGG - Intergenic
994991702 5:107004798-107004820 GACACAGTGGTGCCTCACTCCGG - Intergenic
1003056097 6:2821750-2821772 GACACAGTGATCGCTTCTCCTGG + Intergenic
1003360862 6:5423811-5423833 GTCACAGTGGTGGCATTGCCAGG + Intronic
1004296026 6:14411847-14411869 GAAACAGTGGAGGCCCCGACAGG + Intergenic
1007023865 6:38549970-38549992 GACAAAGTGGTGGCTCAGCGAGG - Intronic
1007221871 6:40285198-40285220 GACACAGTGCTGGGTCCCCAGGG + Intergenic
1007448178 6:41923057-41923079 GAGACTGTGGTGGCTACGACAGG - Intronic
1013013846 6:106143712-106143734 GGCACAGTGGGGCCACCGCCCGG - Intergenic
1013174385 6:107664793-107664815 CACACAGTTGTGGCACAGCCTGG + Intergenic
1018378905 6:163240146-163240168 GAGACGGTGGTGGCTCCCCGGGG + Intronic
1019321147 7:415870-415892 GACACAGAGGTGGGTCCCACAGG + Intergenic
1020260041 7:6526147-6526169 GGCCCCGTGGTGGCTCTGCCGGG - Intronic
1020725269 7:11805095-11805117 GACACAGTAGAGGCTCAGGCAGG - Intronic
1021940903 7:25678240-25678262 GCCACAGTGGTGGCCCAGGCTGG - Intergenic
1021962602 7:25887490-25887512 GACAAAGTGGGGGAACCGCCAGG - Intergenic
1022468271 7:30665704-30665726 GACACAGAGGTGGCCACGGCTGG - Intronic
1024212024 7:47214271-47214293 GACTCTGTGCTGGCTCCGTCCGG + Intergenic
1025036304 7:55594371-55594393 GCCATAGTGGTGGCTGCTCCTGG + Intergenic
1028418673 7:90608546-90608568 AACAAAGTGTTGGCTCTGCCTGG + Intronic
1035567326 8:650242-650264 GACAGAGTGCTGACTCGGCCTGG - Intronic
1039960609 8:42244371-42244393 GACACAGTGCTGGAACTGCCCGG - Intergenic
1040322931 8:46327583-46327605 GAGCCAGTGCTGGCTCCTCCTGG - Intergenic
1043499119 8:80835949-80835971 GAGACAGTGGTGGCTTAACCAGG - Intronic
1043568253 8:81571366-81571388 GACCCTGGGGTGGGTCCGCCTGG + Intergenic
1046123238 8:109870988-109871010 GAGACAGTGGTGGCACCGGAAGG - Intergenic
1048376852 8:133830327-133830349 GACACACTGGGGGCTCCACATGG - Intergenic
1049566910 8:143345088-143345110 GACACAATCCTGGCTCCACCTGG + Intronic
1049615750 8:143575211-143575233 GCCGCAGTAGTGGCTCCACCTGG + Exonic
1050113816 9:2242603-2242625 GTGACTGTGGTTGCTCCGCCCGG - Intergenic
1054994015 9:71363855-71363877 GACACAGTGGGGTCTATGCCAGG - Intronic
1055759688 9:79593692-79593714 GACACAGGGATGCCTCTGCCTGG - Intronic
1058906193 9:109484450-109484472 TCCACAGAGGTGGCTCGGCCAGG - Intronic
1062250724 9:135592349-135592371 GACACAGTGGGGTCTCTTCCAGG - Intergenic
1062423939 9:136497540-136497562 GAAACAGGGGTGTCTCCTCCTGG + Exonic
1185935857 X:4256895-4256917 GCAGCAGTGGTGGCACCGCCAGG + Intergenic
1186137335 X:6533780-6533802 GACTCAGTGGTTCCTCCACCTGG + Exonic
1186137346 X:6533840-6533862 GACTCAGTGGTTCCTCCACCTGG + Exonic
1186137356 X:6533900-6533922 GACTCAGTGGTTCCTCCACCTGG + Exonic
1186267078 X:7843779-7843801 GACTCAGTGGTTCCTCCACCTGG - Exonic
1186267088 X:7843839-7843861 GACTCAGTGGTTCCTCCACCTGG - Exonic
1186267099 X:7843899-7843921 GACTCAGTGGTTCCTCCACCTGG - Exonic
1186324767 X:8466026-8466048 GACTCAGTGGTTCCTCCACCTGG - Exonic
1186324777 X:8466086-8466108 GACTCAGTGGTTCCTCCACCTGG - Exonic
1186324792 X:8466176-8466198 GACTCAGTGGTTCCTCCACCTGG - Exonic
1186324802 X:8466236-8466258 GACTCAGTGGTTCCTCCACCTGG - Exonic
1186324811 X:8466296-8466318 GACTCAGTGGTTCCTCCACCTGG - Exonic
1186401417 X:9263710-9263732 TCCACAGAGGTGGCTTCGCCTGG + Intergenic
1190983781 X:55482446-55482468 CACACAGTAGTGGCTACTCCAGG - Intergenic