ID: 1141535106

View in Genome Browser
Species Human (GRCh38)
Location 16:84673688-84673710
Sequence CTGACTTATAGCCCCGTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141535106_1141535112 19 Left 1141535106 16:84673688-84673710 CCAAGCACGGGGCTATAAGTCAG No data
Right 1141535112 16:84673730-84673752 TGGCTCTGTCACGTGCACCTGGG No data
1141535106_1141535111 18 Left 1141535106 16:84673688-84673710 CCAAGCACGGGGCTATAAGTCAG No data
Right 1141535111 16:84673729-84673751 TTGGCTCTGTCACGTGCACCTGG No data
1141535106_1141535109 -1 Left 1141535106 16:84673688-84673710 CCAAGCACGGGGCTATAAGTCAG No data
Right 1141535109 16:84673710-84673732 GGGAGTGTGAGTTGCAGCCTTGG No data
1141535106_1141535113 24 Left 1141535106 16:84673688-84673710 CCAAGCACGGGGCTATAAGTCAG No data
Right 1141535113 16:84673735-84673757 CTGTCACGTGCACCTGGGCCAGG No data
1141535106_1141535114 25 Left 1141535106 16:84673688-84673710 CCAAGCACGGGGCTATAAGTCAG No data
Right 1141535114 16:84673736-84673758 TGTCACGTGCACCTGGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141535106 Original CRISPR CTGACTTATAGCCCCGTGCT TGG (reversed) Intergenic