ID: 1141535585

View in Genome Browser
Species Human (GRCh38)
Location 16:84677625-84677647
Sequence CTACGGAAGCTAAGCAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141535585_1141535588 12 Left 1141535585 16:84677625-84677647 CCTCCTCTGCTTAGCTTCCGTAG No data
Right 1141535588 16:84677660-84677682 CAGCAGCCACAGCCTGCAAAAGG No data
1141535585_1141535590 20 Left 1141535585 16:84677625-84677647 CCTCCTCTGCTTAGCTTCCGTAG No data
Right 1141535590 16:84677668-84677690 ACAGCCTGCAAAAGGCATGATGG No data
1141535585_1141535593 26 Left 1141535585 16:84677625-84677647 CCTCCTCTGCTTAGCTTCCGTAG No data
Right 1141535593 16:84677674-84677696 TGCAAAAGGCATGATGGCCAGGG No data
1141535585_1141535592 25 Left 1141535585 16:84677625-84677647 CCTCCTCTGCTTAGCTTCCGTAG No data
Right 1141535592 16:84677673-84677695 CTGCAAAAGGCATGATGGCCAGG No data
1141535585_1141535594 27 Left 1141535585 16:84677625-84677647 CCTCCTCTGCTTAGCTTCCGTAG No data
Right 1141535594 16:84677675-84677697 GCAAAAGGCATGATGGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141535585 Original CRISPR CTACGGAAGCTAAGCAGAGG AGG (reversed) Intergenic
No off target data available for this crispr