ID: 1141535586

View in Genome Browser
Species Human (GRCh38)
Location 16:84677628-84677650
Sequence TCTCTACGGAAGCTAAGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141535586_1141535593 23 Left 1141535586 16:84677628-84677650 CCTCTGCTTAGCTTCCGTAGAGA No data
Right 1141535593 16:84677674-84677696 TGCAAAAGGCATGATGGCCAGGG No data
1141535586_1141535590 17 Left 1141535586 16:84677628-84677650 CCTCTGCTTAGCTTCCGTAGAGA No data
Right 1141535590 16:84677668-84677690 ACAGCCTGCAAAAGGCATGATGG No data
1141535586_1141535594 24 Left 1141535586 16:84677628-84677650 CCTCTGCTTAGCTTCCGTAGAGA No data
Right 1141535594 16:84677675-84677697 GCAAAAGGCATGATGGCCAGGGG No data
1141535586_1141535588 9 Left 1141535586 16:84677628-84677650 CCTCTGCTTAGCTTCCGTAGAGA No data
Right 1141535588 16:84677660-84677682 CAGCAGCCACAGCCTGCAAAAGG No data
1141535586_1141535592 22 Left 1141535586 16:84677628-84677650 CCTCTGCTTAGCTTCCGTAGAGA No data
Right 1141535592 16:84677673-84677695 CTGCAAAAGGCATGATGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141535586 Original CRISPR TCTCTACGGAAGCTAAGCAG AGG (reversed) Intergenic