ID: 1141535594

View in Genome Browser
Species Human (GRCh38)
Location 16:84677675-84677697
Sequence GCAAAAGGCATGATGGCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141535585_1141535594 27 Left 1141535585 16:84677625-84677647 CCTCCTCTGCTTAGCTTCCGTAG No data
Right 1141535594 16:84677675-84677697 GCAAAAGGCATGATGGCCAGGGG No data
1141535586_1141535594 24 Left 1141535586 16:84677628-84677650 CCTCTGCTTAGCTTCCGTAGAGA No data
Right 1141535594 16:84677675-84677697 GCAAAAGGCATGATGGCCAGGGG No data
1141535587_1141535594 10 Left 1141535587 16:84677642-84677664 CCGTAGAGATTGCAACAGCAGCA No data
Right 1141535594 16:84677675-84677697 GCAAAAGGCATGATGGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141535594 Original CRISPR GCAAAAGGCATGATGGCCAG GGG Intergenic
No off target data available for this crispr