ID: 1141538644

View in Genome Browser
Species Human (GRCh38)
Location 16:84700460-84700482
Sequence GGGAGGCGGCCCGGGGGCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141538618_1141538644 30 Left 1141538618 16:84700407-84700429 CCGCGGGGCGAGCCCGGGGTGTG 0: 1
1: 0
2: 1
3: 15
4: 143
Right 1141538644 16:84700460-84700482 GGGAGGCGGCCCGGGGGCTCCGG No data
1141538635_1141538644 -7 Left 1141538635 16:84700444-84700466 CCGCCGCGCCGGCCGGGGGAGGC 0: 1
1: 0
2: 3
3: 27
4: 299
Right 1141538644 16:84700460-84700482 GGGAGGCGGCCCGGGGGCTCCGG No data
1141538624_1141538644 17 Left 1141538624 16:84700420-84700442 CCGGGGTGTGGAGTGGGGCCCTC 0: 1
1: 0
2: 6
3: 38
4: 324
Right 1141538644 16:84700460-84700482 GGGAGGCGGCCCGGGGGCTCCGG No data
1141538632_1141538644 -5 Left 1141538632 16:84700442-84700464 CCCCGCCGCGCCGGCCGGGGGAG 0: 1
1: 0
2: 7
3: 38
4: 259
Right 1141538644 16:84700460-84700482 GGGAGGCGGCCCGGGGGCTCCGG No data
1141538627_1141538644 -1 Left 1141538627 16:84700438-84700460 CCCTCCCCGCCGCGCCGGCCGGG 0: 1
1: 0
2: 8
3: 54
4: 536
Right 1141538644 16:84700460-84700482 GGGAGGCGGCCCGGGGGCTCCGG No data
1141538637_1141538644 -10 Left 1141538637 16:84700447-84700469 CCGCGCCGGCCGGGGGAGGCGGC No data
Right 1141538644 16:84700460-84700482 GGGAGGCGGCCCGGGGGCTCCGG No data
1141538623_1141538644 18 Left 1141538623 16:84700419-84700441 CCCGGGGTGTGGAGTGGGGCCCT No data
Right 1141538644 16:84700460-84700482 GGGAGGCGGCCCGGGGGCTCCGG No data
1141538633_1141538644 -6 Left 1141538633 16:84700443-84700465 CCCGCCGCGCCGGCCGGGGGAGG 0: 1
1: 0
2: 5
3: 40
4: 446
Right 1141538644 16:84700460-84700482 GGGAGGCGGCCCGGGGGCTCCGG No data
1141538629_1141538644 -2 Left 1141538629 16:84700439-84700461 CCTCCCCGCCGCGCCGGCCGGGG No data
Right 1141538644 16:84700460-84700482 GGGAGGCGGCCCGGGGGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141538644 Original CRISPR GGGAGGCGGCCCGGGGGCTC CGG Intronic
No off target data available for this crispr