ID: 1141541863

View in Genome Browser
Species Human (GRCh38)
Location 16:84729784-84729806
Sequence CAGTGTTAAGGAAATTAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 223}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141541863 Original CRISPR CAGTGTTAAGGAAATTAAGT TGG Intronic
902998478 1:20246929-20246951 CAGTGAAAACTAAATTAAGTTGG - Intergenic
903633200 1:24793033-24793055 CAGTGTTAAAATCATTAAGTTGG - Intronic
905536846 1:38728999-38729021 TAGTGTTTAGGAAATTAGCTAGG + Intergenic
908741897 1:67337305-67337327 CACTGTTGAGGAAATTAGCTTGG + Intronic
908944157 1:69474333-69474355 TAGTGTTAAGTAAATTAAAATGG + Intergenic
909505685 1:76387184-76387206 CATTGTTAAGGAAATTTAAAGGG - Intronic
909998894 1:82317673-82317695 CAGAATGAAGGAAATTAAGGAGG - Intergenic
913082041 1:115397137-115397159 CAGTTTTAAAAATATTAAGTAGG - Intergenic
913118257 1:115716402-115716424 CTGTGCTTAGGAAATGAAGTAGG - Intronic
913956514 1:143302310-143302332 CAGTTTCAAGGAAAATATGTTGG - Intergenic
914075291 1:144339785-144339807 CAGTTTCAAGGAAAATATGTTGG + Intergenic
914103887 1:144626711-144626733 CAGTTTCAAGGAAAATATGTTGG - Intergenic
915053200 1:153099035-153099057 TAGTGTTAATGAGATTAAGAAGG + Intronic
915542977 1:156580425-156580447 CAGTGTGAAGGAAGTTATGGAGG + Intronic
917310970 1:173677905-173677927 CAGTGTACAGGATATTATGTTGG + Intergenic
917778464 1:178364162-178364184 CAGAGTTAAGTAAATTGTGTAGG - Intronic
919442925 1:197661144-197661166 AAGAGTTAAGTAATTTAAGTAGG - Intronic
920063045 1:203241374-203241396 CAGTTTATAGAAAATTAAGTTGG + Intronic
920077344 1:203347091-203347113 CAGTGCTAAGACAATTCAGTGGG - Intronic
921099566 1:211916587-211916609 AAGTGTTCAGAAAATAAAGTAGG - Intergenic
921754304 1:218836149-218836171 AAATGTTAAGGATATAAAGTAGG + Intergenic
924917899 1:248592808-248592830 AAGTGTGAAAGAACTTAAGTTGG - Exonic
1063595173 10:7428519-7428541 GACTGTTAAGAAGATTAAGTGGG - Intergenic
1064067176 10:12192177-12192199 CACTTTGAAAGAAATTAAGTGGG + Intronic
1065103299 10:22353446-22353468 AAGTTTTAAGGAACTCAAGTGGG - Intronic
1069151863 10:64972281-64972303 AAGTGTTAAGTAAATTGAATTGG + Intergenic
1070258954 10:74834819-74834841 AAGGGATAAAGAAATTAAGTTGG - Intronic
1072174509 10:92904777-92904799 TAGTTTTAATGAAATTAAATTGG + Intronic
1072200351 10:93152197-93152219 CAGTGTTGAGGGTATTAAATAGG + Intergenic
1074921698 10:118020706-118020728 CAGGGTTAAGGACATCAAGAAGG - Intronic
1077822627 11:5764425-5764447 CAGTGTTCTGTAAATTCAGTTGG - Intronic
1078561993 11:12380254-12380276 CAGGGTTAAGGGAACTAAGAAGG + Intronic
1082262376 11:50086616-50086638 CAGTGTTCTGGATATTAACTGGG - Intergenic
1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG + Intronic
1085573500 11:77581324-77581346 CAGTGTACAGAAAATTATGTTGG - Intronic
1086800379 11:91166823-91166845 CAGTGTAAAGGAAATTTGGATGG + Intergenic
1087430635 11:98048839-98048861 CAGTGTTTAGAAAAACAAGTGGG + Intergenic
1087461136 11:98449453-98449475 TATTGTTAAGGAAATTGAGTAGG + Intergenic
1087509466 11:99072255-99072277 TTGTCTTAAGGAAATTCAGTTGG - Intronic
1088646679 11:111922914-111922936 TAGATTTAAGGAAACTAAGTGGG - Intronic
1090062522 11:123476399-123476421 CAGTCTTAAAGAAGTTAAATGGG - Intergenic
1090480738 11:127065908-127065930 CAGTGTTAAAGAAAGTAGTTTGG - Intergenic
1091310500 11:134572076-134572098 CAGCGTTAAGGAAATTGGATAGG + Intergenic
1092998898 12:13977455-13977477 CACAGTTAAGGACATTAGGTGGG - Intronic
1095630540 12:44371698-44371720 CAGGGTCAAGGAAAATAATTTGG - Intronic
1099218836 12:79888019-79888041 CAGTGTTCAGCAAAACAAGTGGG + Intronic
1099422322 12:82476727-82476749 CAGAGTTAAGCATATTAAATTGG + Intronic
1100956300 12:99912651-99912673 CAGTGTTAAAAAAATTAACTGGG - Intronic
1101264557 12:103070062-103070084 CAGTGGCAAGGAAATAAAATTGG - Intergenic
1103323727 12:120106516-120106538 CAGTGTCAAGGAAACAAAGGGGG + Intronic
1103639918 12:122342082-122342104 CAGTGTTAAAGAAAATAATCAGG - Intronic
1106200655 13:27534117-27534139 CAGTGTTAACTAAATTAATTTGG + Intergenic
1107653533 13:42568999-42569021 CAGGGTTAAGCAAACTAAGAAGG + Intronic
1108176562 13:47798529-47798551 CAGTGTTAAGGATGTGAACTCGG + Intergenic
1108791971 13:53980669-53980691 CAATATTAAAGAAATTAAGAAGG - Intergenic
1108961190 13:56232609-56232631 TAGTGCTAAAGAAATTAAATCGG + Intergenic
1109978609 13:69874735-69874757 CAGGGTTATCCAAATTAAGTTGG - Intronic
1110851995 13:80256938-80256960 CAGTGTTTGGGAAATTTTGTAGG - Intergenic
1110897659 13:80775602-80775624 CCGTGATACTGAAATTAAGTAGG + Intergenic
1111702492 13:91708380-91708402 CCGTGTTAAAGTAATTAATTAGG - Intronic
1111743082 13:92229160-92229182 AAGTGTTAAAGATGTTAAGTGGG + Intronic
1112206402 13:97327830-97327852 CAGTGATAAGGAAATGGAGCAGG + Intronic
1112334265 13:98501165-98501187 CAGTTTTCAGGAACTGAAGTCGG + Intronic
1112949478 13:104974936-104974958 CAATATTAAGGAAAAGAAGTAGG - Intergenic
1112950871 13:104995092-104995114 CAGTCTTAAGTATCTTAAGTAGG + Intergenic
1114680204 14:24478007-24478029 AGGTGTAAAGGAAATTAAATTGG - Intergenic
1115823659 14:37239343-37239365 AAGTATTAAGTAAATTAAGCAGG - Intronic
1117905893 14:60585709-60585731 TAGTGTTAAAGAAATTGAATCGG - Intergenic
1118142487 14:63099690-63099712 CAGTGTTCTGCAAATTAAATAGG - Intronic
1202938928 14_KI270725v1_random:123986-124008 CAGTTTCAAGGAAAATATGTTGG - Intergenic
1126958786 15:53966089-53966111 ATTTGTTAAAGAAATTAAGTGGG + Intergenic
1127397669 15:58555697-58555719 CAGTGTTAAGGAAACCAACAAGG + Intronic
1127560163 15:60128281-60128303 CAGTGTTAAGAACATGAACTTGG + Intergenic
1128446936 15:67771088-67771110 CCATGTAAAGGAAATTAAGAGGG - Intronic
1128822015 15:70665442-70665464 CAGAGTTAAGAAAATCAGGTTGG + Intronic
1130112648 15:80978469-80978491 CAGTTTTAAAGGATTTAAGTAGG - Exonic
1130826693 15:87555364-87555386 CTATGTTATTGAAATTAAGTTGG - Intergenic
1135654627 16:24236966-24236988 CACTGTTCTGGAAATTAACTGGG - Intergenic
1136700230 16:32130180-32130202 CAGTTTCAAGGAAAATATGTTGG + Intergenic
1136767420 16:32797283-32797305 CAGTTTCAAGGAAAATATGTTGG - Intergenic
1136800728 16:33073418-33073440 CAGTTTCAAGGAAAATATGTTGG + Intergenic
1136868859 16:33783341-33783363 CAGTGTCAAGGAAAATGTGTTGG + Intergenic
1137801635 16:51266955-51266977 CAGAGATAATGAAGTTAAGTGGG + Intergenic
1140129395 16:72146853-72146875 CACTGTTAAGGAAATAAAAGAGG + Intronic
1141541863 16:84729784-84729806 CAGTGTTAAGGAAATTAAGTTGG + Intronic
1203069814 16_KI270728v1_random:1059305-1059327 CAGTTTCAAGGAAAATATGTTGG - Intergenic
1203103315 16_KI270728v1_random:1332727-1332749 CAGTGTCAAGGAAAATGTGTTGG - Intergenic
1144479485 17:15617090-15617112 AAATATTAAGGATATTAAGTCGG + Intronic
1144918814 17:18746649-18746671 AAATATTAAGGATATTAAGTCGG - Intronic
1146509109 17:33430396-33430418 CAGAATGAAGGAAATAAAGTTGG + Intronic
1146512226 17:33459891-33459913 GAGTGTTAAGGATATTAATTAGG + Intronic
1148232598 17:45945853-45945875 TATTGTTAAGGGAATAAAGTAGG + Intronic
1153122541 18:1746845-1746867 TAGTATGAAGGAAATTAAATTGG - Intergenic
1154476323 18:14762939-14762961 CATTTTTAAGGAAATTCTGTTGG - Intronic
1156820866 18:41371370-41371392 CAGCGTTAAAGAAATTAACATGG + Intergenic
1157627986 18:49067490-49067512 GAGTGTTACGGAAGTTTAGTAGG + Intronic
1159141588 18:64402153-64402175 ATGTGTTAAGGACATTAAGAAGG - Intergenic
1159211006 18:65321852-65321874 CAGTGTTATAAAAATAAAGTAGG + Intergenic
1160058066 18:75504777-75504799 CAGTGTTGGGGAACTTAAGAAGG - Intergenic
1168389869 19:55998111-55998133 CTCTTTTAATGAAATTAAGTAGG + Intergenic
1202668520 1_KI270709v1_random:24167-24189 CAGTTTCAAGGAAATTGTGTTGG + Intergenic
929653151 2:43702220-43702242 CAGTTTTAAGCAAATTAGGGTGG + Intronic
929729799 2:44475903-44475925 CAGTTTTAAGGGACATAAGTAGG - Intronic
930368065 2:50468045-50468067 CAGTGTTAAGCAAATAAACAGGG + Intronic
931372344 2:61675496-61675518 CAGAGGTAAGGAAAATAAGTTGG - Intergenic
935252525 2:101276491-101276513 CCTTGTTAAGGAAAATGAGTAGG - Exonic
936679039 2:114749885-114749907 CTGTGTTAAGGAAATAATTTAGG + Intronic
937918161 2:127109864-127109886 GAATATTAAGGAAATTAAGGGGG - Intergenic
940724595 2:157321959-157321981 CAGTGTTTTTGAAATTAATTTGG - Intronic
940955987 2:159727784-159727806 TAGTGTTGAGCAAATGAAGTTGG + Intronic
945421232 2:209639532-209639554 CAGTGGTATGGAAAGTAAATTGG - Intronic
946912197 2:224475315-224475337 CAGGGTTAAGAACATTAAATAGG - Intronic
947005410 2:225505862-225505884 CATTGTGAATGAAAATAAGTGGG - Intronic
947405339 2:229770266-229770288 CAGAGTAATGGAAATTAAATAGG - Intronic
1170941309 20:20850184-20850206 GAGTGTTAAGCAAAGTCAGTCGG - Intergenic
1174692317 20:52518548-52518570 CATTATTAAGCAAATTAACTTGG - Intergenic
1176584327 21:8563543-8563565 CAGTTTCAAGGAAAATATGTTGG + Intergenic
1177186860 21:17806917-17806939 AAGTGTGAAAGAAATTAAGCTGG + Intronic
1177906522 21:26977986-26978008 CAGTATTAAGGAACTTGAATAGG + Intergenic
1177965359 21:27720034-27720056 CAGAGTTAAGGAAATAATTTTGG + Intergenic
1178179307 21:30141498-30141520 AAGTCTTAAAGAAATTAAATTGG + Intergenic
1180267139 22:10540447-10540469 CAGTTTCAAGGAAAATATGTTGG + Intergenic
1182140136 22:27947764-27947786 CCGTTTTAAAAAAATTAAGTCGG + Intergenic
949161599 3:890619-890641 CAGTGAAAAGGATATTATGTGGG + Intergenic
952728427 3:36614012-36614034 CAGAATTAGGGAAAATAAGTTGG - Intergenic
954247542 3:49343441-49343463 CAGTCTTAAGGAAGACAAGTAGG + Intergenic
956323216 3:68022360-68022382 CAGTGTTAGGTAAATGAAGTGGG + Intronic
957185049 3:76930459-76930481 CAGTGATAAAAAAAATAAGTAGG - Intronic
960634644 3:119771252-119771274 CAGTGATAATGAAAGTAAATAGG + Intergenic
962184854 3:133247473-133247495 GAGTGTTAAGGAAATAGGGTAGG + Intronic
962390837 3:134971325-134971347 CACTGGTGAGGAAAGTAAGTTGG - Intronic
962508814 3:136077577-136077599 CAGTGAAAGGGAAATGAAGTGGG + Intronic
962812192 3:138969002-138969024 CAGGGTTAAGGAAATTGACTTGG + Intergenic
965148427 3:164937913-164937935 GGGTGTTAAGGAAATTAAGCAGG - Intergenic
965829589 3:172769855-172769877 TACTGTTAAGAAAATGAAGTTGG + Intronic
965836326 3:172856997-172857019 GAGTGTCAAGGAAATGAAGCAGG + Intergenic
967246247 3:187490086-187490108 AAGTGTAAAGGAAATTAAATGGG + Intergenic
971816322 4:31495475-31495497 AATGGTTAAGGAAATTTAGTAGG - Intergenic
971983147 4:33781267-33781289 TTCTGTTAAGGAAATAAAGTAGG + Intergenic
972031043 4:34458565-34458587 CAAGGTTAAAGAAATAAAGTAGG + Intergenic
972165523 4:36279446-36279468 GACTATTAAGGAATTTAAGTGGG - Intergenic
972637779 4:40899590-40899612 CAGTGATAAGGAAATGAAGAAGG + Intronic
972968071 4:44537256-44537278 CAGTGTAAAGGCAATTCAATAGG + Intergenic
973896062 4:55414319-55414341 CAGTTTTATGTAATTTAAGTGGG + Intronic
974331913 4:60491057-60491079 CTGTATCTAGGAAATTAAGTAGG - Intergenic
975339273 4:73219580-73219602 CAGATTTAAGCAAAGTAAGTAGG - Intronic
975416173 4:74106953-74106975 TAGTGTTAAGGAAGTTTAGGAGG - Intergenic
975766292 4:77671211-77671233 CATTGTTATGGAAATCAAATGGG - Intergenic
978139229 4:105298595-105298617 CAGGGAGAAGGAAACTAAGTTGG + Intergenic
981637869 4:146900771-146900793 CAGTGTTAAGTATATTCACTTGG - Intronic
984003967 4:174285906-174285928 CAGTCTAAAGGATATTAAATAGG + Intronic
987776944 5:22379622-22379644 CATTGTTAAGGAAATAAATTAGG - Intronic
987849480 5:23331975-23331997 CAGATTTAAGAAAATTAAATGGG + Intergenic
988201373 5:28074328-28074350 AAGTTTTAAGGAAATTTAGCAGG - Intergenic
988328624 5:29805181-29805203 CAATGTTAAAGAAAATAAATGGG - Intergenic
990026103 5:51191548-51191570 GAGTGCTAGGGAAATTAAGAAGG - Intergenic
991382686 5:66047975-66047997 AAGTGTTAAAGAAATTTAGGAGG + Intronic
991419736 5:66428754-66428776 CAGTGTTAAGTAAAGTAAGAAGG - Intergenic
991638548 5:68731064-68731086 GAGGGTTAAGGAAAATAAATGGG - Intergenic
992495556 5:77289958-77289980 CAGTGATAAGGAAATGAAATAGG - Intronic
993730910 5:91421598-91421620 CATTGTTAATTAGATTAAGTGGG + Intergenic
995229702 5:109745369-109745391 TAATGTTAAGTAAATTAACTTGG + Intronic
995546868 5:113241375-113241397 CAGAGTTGAGGAAGTTAAATTGG - Intronic
997312146 5:132895862-132895884 CTTTGTTAAGGAAAATAAGCTGG + Intronic
998524885 5:142833554-142833576 CTGTTTGAAGGAAATTAAATGGG - Intronic
999185893 5:149708500-149708522 TATTGTTAAGGAAAATAATTGGG + Intergenic
999582562 5:153055598-153055620 CAGTGCTAATAAAATTAAGCTGG - Intergenic
1000765980 5:165289482-165289504 GAATGTTAAGAAAATTAAGCAGG - Intergenic
1001217909 5:169873185-169873207 GAGTGTAAAGGAAAAGAAGTAGG - Intronic
1002823062 6:746706-746728 CAGCAATAAAGAAATTAAGTAGG - Intergenic
1002875916 6:1208828-1208850 GAGTGCTAAGGAAACGAAGTAGG - Intergenic
1004832523 6:19492659-19492681 CAGTGTTAAAAAAATTAAAATGG + Intergenic
1005502556 6:26442899-26442921 TAGTGTTAAGGACATAAAGAAGG - Intronic
1007064785 6:38978869-38978891 CTGTATTAATCAAATTAAGTAGG + Intronic
1007132495 6:39488871-39488893 CAGAGTTAATGAAATTAATGAGG - Intronic
1009560076 6:65228885-65228907 CAGTGTAAAGGCGATTCAGTGGG + Intronic
1009744085 6:67790387-67790409 CATTGTCAAGGAAATTTAGAGGG + Intergenic
1011265712 6:85516415-85516437 AATTGTTAAAGAAATTAAATTGG + Intronic
1012109364 6:95208418-95208440 GAGTATTAAGGGAATTGAGTTGG - Intergenic
1012363253 6:98409023-98409045 GGGTGTTAAGAACATTAAGTTGG - Intergenic
1013814174 6:114077928-114077950 TAGTGTTATGGAAATTAAAAAGG - Intronic
1014759417 6:125339980-125340002 CAGGGTTGAGGAAAATAATTTGG + Intergenic
1016323104 6:142869794-142869816 CTGTGTTAATAAAATGAAGTTGG - Intronic
1017402293 6:154078274-154078296 AACTGGTAAGGAAATTAAATAGG - Intronic
1019829739 7:3315614-3315636 CAGAGATAAGCACATTAAGTAGG - Intronic
1020142469 7:5620274-5620296 CAGTTTTAAGGCAAGTAAGAGGG + Intronic
1020974679 7:14990091-14990113 CAAATTTAAGGAAAATAAGTGGG + Intergenic
1023673002 7:42599366-42599388 CGGTGTTAAAGAAATAAAATAGG + Intergenic
1025104008 7:56156096-56156118 CAGGCATGAGGAAATTAAGTAGG - Intergenic
1025184540 7:56847070-56847092 CAGTGTTCTGGATATTAACTGGG - Intergenic
1025482828 7:61005524-61005546 CAGTTTCAAGGAAAATATGTTGG + Intergenic
1025562953 7:62393359-62393381 CAGTTTCAAGGAAAATATGTTGG + Intergenic
1026503926 7:70966173-70966195 CTGAGTTAAGGATATAAAGTTGG + Intergenic
1027667721 7:81059280-81059302 CAGTGGTAAGAAAATTAAAATGG + Intergenic
1027812215 7:82917939-82917961 AATTATTAAGGAAATTAATTTGG - Intronic
1028445144 7:90913610-90913632 GATTTTTAAGGAAATTCAGTGGG + Intronic
1030478743 7:110074794-110074816 CAATGGGAAGGAAATAAAGTAGG - Intergenic
1030764941 7:113397169-113397191 AAGTGTTAAGGAAAATATTTGGG - Intergenic
1031809478 7:126347788-126347810 CTGTGTTCAGGACATTATGTTGG - Intergenic
1031997420 7:128241659-128241681 CAGTCTGAAGGAGATAAAGTTGG + Intronic
1032292895 7:130605684-130605706 CAGTCTCAAGGAAATGAATTTGG + Intronic
1034854949 7:154535562-154535584 CAGTGTTTAAAAAATTAATTGGG + Intronic
1035865652 8:3078769-3078791 CAGTGTTTAGGTAACTAAGCTGG - Intronic
1036581784 8:10081796-10081818 CAATGTAAAGGAAATTGAGGGGG + Intronic
1037225330 8:16581364-16581386 AAATGTTACTGAAATTAAGTTGG + Intergenic
1038129434 8:24713313-24713335 CAGAAGTAAGGAAATTAAGTGGG - Intergenic
1039406553 8:37318297-37318319 CAATGTTAATGAAACTAAGAAGG - Intergenic
1040709482 8:50170990-50171012 CAGTTTGAAGGAGATTAACTGGG - Intronic
1041860001 8:62502483-62502505 AAGTGTCATAGAAATTAAGTAGG - Intronic
1042220466 8:66468187-66468209 CAAAGTTATGGAAATTAACTTGG - Intronic
1042656858 8:71108713-71108735 GAGTGGTGAGGAAATTAAGGGGG + Intergenic
1043555428 8:81425110-81425132 CAGTGTCAAAGAAAGTAATTAGG + Intergenic
1044734112 8:95260268-95260290 TTGTGTAAAGGAAATTAAATGGG - Intronic
1045775375 8:105796451-105796473 TAGTGTAAATGAAATTAACTTGG + Intronic
1046587060 8:116160387-116160409 AAGTCTGAAAGAAATTAAGTTGG - Intergenic
1047939906 8:129819663-129819685 CAACATTATGGAAATTAAGTTGG + Intergenic
1049295575 8:141833228-141833250 CATTGTTAAGAAAATGAAGAAGG - Intergenic
1050923218 9:11232179-11232201 CATTGTAAAGGAAATTCTGTGGG - Intergenic
1051008202 9:12375581-12375603 TCGTTTTAAGGAAATTGAGTGGG + Intergenic
1051506997 9:17838409-17838431 TAGAGTTAAGGAAAATGAGTGGG + Intergenic
1052590998 9:30494854-30494876 AAGTAATAAGGAAATTAAGAAGG + Intergenic
1053132477 9:35624371-35624393 CAATTTTCAGGAATTTAAGTGGG + Intronic
1055066813 9:72127245-72127267 CAGTTTTAAAAAAATTAAATGGG + Intronic
1056065498 9:82929423-82929445 GAGTGTTTGGGAAATAAAGTAGG + Intergenic
1060280197 9:122210529-122210551 AAGTGCTAAGGAAATAAAGCCGG - Intronic
1061466168 9:130781795-130781817 CACTGTTTAGGAAACTAAATGGG - Intronic
1203614232 Un_KI270749v1:41073-41095 CAGTTTCAAGGAAAATATGTTGG + Intergenic
1188406929 X:29823044-29823066 CAATGTAAAGGAAATAAACTTGG + Intronic
1190603135 X:52112653-52112675 CAGGGATAATGAAATCAAGTTGG + Intergenic
1193019992 X:76781129-76781151 CAGTCTCAATGAAATGAAGTAGG + Intergenic
1193627324 X:83837362-83837384 CAGTGCTAAGGAAAAAATGTGGG - Intergenic
1196499893 X:116367688-116367710 CACTGTTATGGAAATTAAAATGG + Intergenic
1196650351 X:118162248-118162270 AAGTGTGAAGGAAATTATTTAGG - Intergenic
1197875510 X:131100488-131100510 CAGTTGCAAGGAAATTAATTAGG - Intergenic
1198338552 X:135691888-135691910 CAGTGTTAAAAAAATAAATTAGG + Intergenic
1198524968 X:137491893-137491915 TAGTGTTGTGGAAATTAAATAGG - Intergenic
1199834947 X:151580742-151580764 TAATGTTAAGTAAATTAACTTGG + Intronic
1202116482 Y:21473202-21473224 CAGTGTTAAAAAAAATAACTCGG + Intergenic