ID: 1141542423

View in Genome Browser
Species Human (GRCh38)
Location 16:84736086-84736108
Sequence GTGTGTGAGTGGCGAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1749
Summary {0: 1, 1: 0, 2: 10, 3: 177, 4: 1561}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141542411_1141542423 22 Left 1141542411 16:84736041-84736063 CCTGTGGGTGTGTGAGTGGCGAG 0: 4
1: 2
2: 0
3: 30
4: 226
Right 1141542423 16:84736086-84736108 GTGTGTGAGTGGCGAGGGGAGGG 0: 1
1: 0
2: 10
3: 177
4: 1561

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141542423 Original CRISPR GTGTGTGAGTGGCGAGGGGA GGG Intronic
900015083 1:142779-142801 GTATGAGAGTGGGGAGGGAAGGG - Intergenic
900016686 1:155601-155623 GTATGAGAGTGGGGAGGGAAGGG - Intergenic
900045350 1:501388-501410 GTATGAGAGTGGGGAGGGAAGGG - Intergenic
900046947 1:514193-514215 GTATGAGAGTGGGGAGGGAAGGG - Intergenic
900067547 1:743118-743140 GTATGAGAGTGGGGAGGGAAGGG - Intergenic
900069150 1:755911-755933 GTATGAGAGTGGGGAGGGAAGGG - Intergenic
900315712 1:2055291-2055313 GTGTGGGAGGGGGGAGGGGGTGG + Intronic
900327866 1:2118747-2118769 GTGTGTGTGAGATGAGGGGAGGG + Intronic
900515629 1:3080930-3080952 GTGTGTGTGTGTAGAGGGGGTGG + Intronic
900680851 1:3915397-3915419 CTGTGGGGGTGGCTAGGGGAGGG - Intergenic
900735818 1:4298762-4298784 GAGTGGGACTGGGGAGGGGATGG + Intergenic
900736705 1:4303705-4303727 GTGTGTGAAAGGGAAGGGGAAGG - Intergenic
900916456 1:5642651-5642673 GAGTGTGGGGGGCTAGGGGAGGG + Intergenic
901179980 1:7335130-7335152 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
901184830 1:7366240-7366262 GGGTGTGATTGGCAAAGGGACGG - Intronic
901533528 1:9868070-9868092 GACTGGGAGTGGAGAGGGGAGGG - Intronic
901616532 1:10544456-10544478 GGGTGTGTGTGGCAAAGGGATGG + Intronic
901745962 1:11373634-11373656 GTGTGTGTGTGGTGTGTGGATGG + Intergenic
901807814 1:11749132-11749154 CTGGGTGAGTGGGGAGGGGCCGG - Intronic
901831800 1:11897302-11897324 GTGTGTGTGTGTCGGGGGGAGGG - Intergenic
901908733 1:12437056-12437078 GTGTGTGTGTGGCGGCGGGAGGG + Intronic
902489583 1:16771473-16771495 GTGTGTGTGTGTGCAGGGGAAGG - Intronic
903188496 1:21642865-21642887 GTGTGTGTGTGTAGTGGGGAAGG - Intronic
903622458 1:24707811-24707833 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
903845312 1:26276447-26276469 GTGTGTGGGTGTGGAAGGGATGG - Intronic
903858978 1:26354009-26354031 GTCTGTGTGTGGAGATGGGAGGG - Intronic
903969012 1:27107090-27107112 GTGTGTGTGTGTGGAGGGGCTGG - Intronic
904199925 1:28812802-28812824 GTGTGTGTGTGGTGCGGGGGGGG + Intronic
904392378 1:30194626-30194648 GTGTGTGTCTGGGGTGGGGAGGG + Intergenic
904567046 1:31434399-31434421 GTGTGGGTGTGGCGGGGGGATGG - Exonic
905777611 1:40679291-40679313 TTGTGTGCCTGGGGAGGGGATGG - Intergenic
905866836 1:41381372-41381394 GTGTGGGAGTGGGGAGGGATGGG + Intronic
905944770 1:41892253-41892275 GTGGGTGGGTGGAGATGGGATGG - Intronic
905948031 1:41920100-41920122 GTGTGTGTGTGTCGCTGGGAGGG - Intronic
905966868 1:42105472-42105494 GGGGGTGGGTGGCTAGGGGAGGG + Intergenic
906103028 1:43275200-43275222 GTGTGTGCATGGCAGGGGGAAGG - Intergenic
906106977 1:43300617-43300639 GTGTGTTTGTGCCGGGGGGAGGG + Intergenic
906688807 1:47779340-47779362 GTGTGTGTGGGGAGAGGGGCTGG + Intronic
906724905 1:48037108-48037130 GTGTGTATGTGGAAAGGGGAGGG - Intergenic
906783242 1:48591087-48591109 GTGTGTGTGTGGGGGGGGGTGGG - Intronic
907651155 1:56296067-56296089 ATGTGTGAATGGAGAGTGGATGG - Intergenic
907663475 1:56414553-56414575 GTGTGTGTGTGGTGGGGGGCAGG - Intergenic
907787984 1:57632629-57632651 GTGTGAGAGTTGTGAGGAGAAGG + Intronic
907964693 1:59317821-59317843 GTGTGTGAATGACGCTGGGATGG + Intronic
907966388 1:59334112-59334134 GTGGATGATTGGCGAGGGAAAGG - Intronic
908257314 1:62313699-62313721 GAGGGTGAGGGGCAAGGGGAGGG + Intronic
908384355 1:63627054-63627076 GTGTGTGTGTGGGGGGGGGGGGG - Intronic
908401088 1:63773835-63773857 GTGTGGGGGAGGGGAGGGGAGGG + Intergenic
908486294 1:64597075-64597097 GTGTGTGAGTGGGGGGGTGCTGG + Intronic
908610928 1:65860189-65860211 GAGGGTGAGCGGTGAGGGGAGGG - Intronic
908767748 1:67569699-67569721 GAGAGGGAGTGGGGAGGGGAAGG + Intergenic
909098796 1:71323748-71323770 GTGGGTGGGGGGCAAGGGGAGGG + Intergenic
909263358 1:73524235-73524257 GGGTGCTAGTGGTGAGGGGATGG - Intergenic
909303869 1:74047442-74047464 GGGTGTGATGGGCTAGGGGACGG + Intronic
909449667 1:75784518-75784540 CTGTGTGTGTGGCGAGGAGAGGG + Intronic
910009180 1:82439396-82439418 GTATGTGGGGGGCTAGGGGAGGG + Intergenic
910084044 1:83377251-83377273 GTGGGTGGGAGGCTAGGGGAGGG - Intergenic
910201240 1:84701859-84701881 GTGTGTGTGTGGGGGGGGGTGGG + Intergenic
910415895 1:86997746-86997768 CTGTGTGGGTGGGGAGGGAAGGG + Intronic
910631969 1:89364647-89364669 ATGTGTGTGTGGGGAGGGGGTGG + Intronic
911029980 1:93476689-93476711 GTGTGTGAGTGGGCAGAGGGGGG + Intronic
911261695 1:95693989-95694011 GTGTGTGTGTGGCGGGGTGAGGG + Intergenic
912245699 1:107959839-107959861 GTGTATGTGGGGAGAGGGGAAGG - Intronic
912270467 1:108203565-108203587 GGGAGGGAGTGGGGAGGGGAGGG - Intergenic
912395314 1:109338101-109338123 GTGTGTGTGTGAGGAGGCGAGGG + Intronic
912449228 1:109759173-109759195 GTGTGTGTGTGGTGGGGTGATGG + Intronic
912499278 1:110111311-110111333 GAATGTGAGTGCTGAGGGGATGG - Intergenic
912581208 1:110722603-110722625 GTGTGTCTGAGGTGAGGGGAAGG + Intergenic
913105936 1:115613958-115613980 GTGAGTGAGTGGGGAGTGGTAGG - Intergenic
914446670 1:147756686-147756708 GTGTGTGGGTGCTGATGGGATGG - Exonic
914474536 1:148012486-148012508 GTGGGGGAGTGGGGCGGGGAGGG - Intergenic
915130033 1:153689526-153689548 GGGTGGGAGTGGGGATGGGAAGG + Intronic
915576019 1:156777844-156777866 GGGTGGGAGTGACAAGGGGAAGG + Intronic
915584491 1:156836981-156837003 GAGTGGGTGTGGCGAGGGGTGGG - Intronic
915852697 1:159343041-159343063 GTGTGTGTGTGGGGGGGGGGCGG + Intergenic
915920439 1:159972209-159972231 GTGGGTGAGGGGCGAGGCGGGGG - Intergenic
916027763 1:160849442-160849464 GTGGGTGAGGGGCAAGGGGAGGG - Intronic
916116922 1:161492897-161492919 GAGTGTGTGTGGTGGGGGGATGG + Intergenic
916123749 1:161551064-161551086 CTCTGTGTGTGGCGGGGGGAGGG - Intergenic
916990826 1:170242924-170242946 GTGTGTGTGTGGGGAGGGGGGGG + Intergenic
917059626 1:171022598-171022620 GGGGGTGGGTGGCAAGGGGAGGG + Intronic
917137688 1:171803304-171803326 GTGTGTGTGTGGGGTGGGGTGGG + Intronic
917242278 1:172961373-172961395 GAGGGTGAGAGGCAAGGGGAGGG - Intergenic
917250814 1:173058668-173058690 GTGTGTGTGTGTGGTGGGGAGGG - Intergenic
917414143 1:174790775-174790797 GTGTGTGTGTGGGCAGGGGGCGG + Intronic
917693156 1:177489883-177489905 GTGTGTGTGTGGGGGGGGCAGGG - Intergenic
918433218 1:184483901-184483923 GTGTGTGTGTGGGGCGGGGGTGG + Intronic
918766010 1:188484472-188484494 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
918814223 1:189162417-189162439 GGGTGTGGGGGGCTAGGGGAGGG - Intergenic
918881621 1:190131168-190131190 ATGTGTGTGTGGCGGGGGGTGGG + Intronic
919032053 1:192254426-192254448 GTGTGTGGGAGGCTAGGGGAGGG - Intergenic
919061242 1:192635551-192635573 GTGTGTGTGTGGGGAGGGGTGGG - Intergenic
919139389 1:193551454-193551476 GTGTGTTGGTGGGGAGGGCAGGG - Intergenic
919165114 1:193882116-193882138 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
919290434 1:195623517-195623539 GTCTGTGACTTGCGATGGGAGGG - Intergenic
919749001 1:201024940-201024962 GGGTGTGAGTGGAGGAGGGAAGG - Intergenic
919935559 1:202248476-202248498 GTGTCAGGGTGGTGAGGGGAGGG - Intronic
920269878 1:204754899-204754921 GTGTGTGCGTTGTGGGGGGAAGG + Intergenic
920802644 1:209203753-209203775 GTGTGTGTGTGGCGTGGTGGCGG + Intergenic
920829834 1:209454100-209454122 GTGTGTGTGTGGTGTGGGGGAGG - Intergenic
920859901 1:209697290-209697312 GAGTGTGTGGGGAGAGGGGAGGG - Intronic
921023862 1:211259791-211259813 GCGGGAGAGCGGCGAGGGGAGGG - Intronic
921249226 1:213281019-213281041 GTGTGTGGGTGGGGAGGGGAGGG - Intergenic
921348767 1:214214160-214214182 GTGTGTGTGTGGTGGGGGGGGGG - Intergenic
921918948 1:220644450-220644472 GTGTGTGTGTGGGGGGGGGGGGG - Intronic
921973178 1:221173338-221173360 GTGTGTGTGTGGGGGGGGGGAGG + Intergenic
921988008 1:221333724-221333746 GTGTGGGAGTGGAAAAGGGAAGG + Intergenic
922102150 1:222485891-222485913 GTATGAGAGTGGGGAGGGAAGGG - Intergenic
922104511 1:222501303-222501325 GTATGAGAGTGGGGAGGGAAGGG - Intergenic
922263233 1:223961002-223961024 GTATGAGAGTGGGGAGGGAAGGG - Intergenic
922264829 1:223973816-223973838 GTATGAGAGTGGGGAGGGAAGGG - Intergenic
922434805 1:225593391-225593413 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
922638594 1:227203106-227203128 GTGTGTGTGGTGCTAGGGGATGG - Intronic
922878787 1:228963365-228963387 GGGGGTGAGGGGCTAGGGGAGGG - Intergenic
923002144 1:230015718-230015740 GTGAGTGAGTGGTGAGTGAATGG - Intergenic
923016243 1:230128608-230128630 GTGTGTGTGTGGCGGGGGCGGGG + Intronic
923041791 1:230324927-230324949 GTGTGTTAGGGGTGTGGGGAAGG + Intronic
923409261 1:233691076-233691098 TTGGGGGAGTGGCCAGGGGAGGG - Intergenic
923429337 1:233905357-233905379 GTGGGTGAGTGGCGGCGGGAAGG + Intronic
923530854 1:234811052-234811074 GTGTGTGTGTGTGCAGGGGAAGG + Intergenic
923665265 1:235993397-235993419 GTGTGTGTGTTGGGTGGGGAAGG + Intronic
923740003 1:236646391-236646413 GTGTGTGAGTGTGAAGGAGAAGG + Intergenic
923750169 1:236740093-236740115 GTGAGTGAGTGGGGAGGGAGCGG - Intronic
923865240 1:237932549-237932571 GTATCTGAATGGGGAGGGGAAGG - Intergenic
923899925 1:238314585-238314607 GTGTGTGTGTGTCGGGGGGGGGG + Intergenic
924017232 1:239740610-239740632 GGGGGTGAGGGGCAAGGGGAGGG - Intronic
924029644 1:239873483-239873505 GGGGGTGGGTGGCTAGGGGAGGG - Intronic
924345073 1:243066011-243066033 GTATGAGAGTGGGGAGGGAAGGG - Intergenic
924346686 1:243078822-243078844 GTATGAGAGTGGGGAGGGAAGGG - Intergenic
924608072 1:245552161-245552183 GTGTGTGTGTGGAGTGGGGGTGG + Intronic
924617562 1:245625789-245625811 GTGTGTGTGTGGGAAGGGGCGGG - Intronic
924828473 1:247567318-247567340 GGGTGTGGGGGGCAAGGGGAGGG - Intronic
1062829687 10:597337-597359 GTGTGTGTGTGTCCAGGGGGAGG - Intronic
1062889938 10:1050687-1050709 GTGTGTGAGTGGCCCTGTGATGG - Intronic
1062922712 10:1292132-1292154 GTCTGGGAGTGGGTAGGGGAGGG + Intronic
1062955497 10:1537812-1537834 GGGGGTGAGGGGTGAGGGGAGGG + Intronic
1063039240 10:2319980-2320002 GTGTGTGTGTGGTGGGGGGAGGG - Intergenic
1063076476 10:2721927-2721949 GGGGGTGAGGGGCGAGGTGAGGG - Intergenic
1063352280 10:5366625-5366647 GTGTGTGAGTGGCTGGGGGCTGG - Intronic
1063462338 10:6222653-6222675 GTGTGGGAGCGGAGTGGGGAGGG + Intronic
1063752361 10:8965007-8965029 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1063836098 10:10014709-10014731 GTGAGTGAGTGGTGAGTGAATGG - Intergenic
1064179269 10:13100421-13100443 GGGTGAGGGTGGCGAGGGGTGGG + Intronic
1064274121 10:13891400-13891422 GTGTGTGTGTGCCGAGGGGAGGG + Intronic
1064274882 10:13896519-13896541 GGGTCTGAGGGGCAAGGGGAGGG + Intronic
1064451342 10:15444846-15444868 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1064795544 10:19007579-19007601 GAGGGAGAGTGGGGAGGGGAGGG - Intergenic
1064920494 10:20512058-20512080 GTGAGTGAGTGGTGAGTGAATGG - Intergenic
1064934236 10:20662335-20662357 ATGTGTGTGTGGCATGGGGAAGG - Intergenic
1065135736 10:22667907-22667929 GTGTGTGTGTAGAGAGGGGGAGG + Intronic
1065262089 10:23934380-23934402 GGGGGTGAGGGGTGAGGGGAGGG + Intronic
1065661695 10:28010153-28010175 GTGTGTGGGTAGAGTGGGGAAGG + Intergenic
1065773939 10:29102179-29102201 GTGTGTGTGTGGGGCGGCGAGGG - Intergenic
1066005752 10:31144729-31144751 GGGGGTGGGGGGCGAGGGGAGGG - Intergenic
1066157429 10:32692838-32692860 CTGTGTGAGTGGGCATGGGATGG + Intronic
1066360724 10:34727803-34727825 GTGTGTGTGTGGTGGAGGGAGGG - Intronic
1066360733 10:34727867-34727889 GTGTGTGTGTGGCGGAGGGAGGG - Intronic
1066729663 10:38426027-38426049 GTATGAGAGTGGGGAGGGAAGGG + Intergenic
1067206933 10:44226099-44226121 GGGTGTGGGGGGTGAGGGGAGGG - Intergenic
1067270615 10:44788439-44788461 GTGTGTGTGTGGCGTGAGGTAGG - Intergenic
1067477763 10:46578004-46578026 GTGTGTGTGTGGGGGGGGGGAGG - Intergenic
1067616976 10:47763781-47763803 GTGTGTGTGTGGGGGGGGGAGGG + Intergenic
1067711569 10:48655247-48655269 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
1067878061 10:50021511-50021533 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1067974705 10:51011203-51011225 GTGTGTGGGTGGGGAGGGGGCGG + Intronic
1068019035 10:51557343-51557365 GTGTGTGGGTGGTGGGGGGGTGG - Intronic
1068173010 10:53421046-53421068 GTGGGTGAGGGGCAAGGGGAGGG - Intergenic
1068942723 10:62695661-62695683 GTGTGTGTGTGGCGGGGGAGGGG - Intergenic
1069041422 10:63699476-63699498 GTGTGGAAGTGGAGAGGAGAGGG + Intergenic
1069098366 10:64287803-64287825 GTGTGTGGGAGGTGAGGGAATGG - Intergenic
1069104190 10:64362999-64363021 GTGCAGGAGTGGAGAGGGGAGGG - Intergenic
1069224748 10:65929017-65929039 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1069755378 10:70771533-70771555 ATGTGTGAGTGCTGAGGGGAAGG + Intronic
1069794949 10:71046110-71046132 GTCTGTGAGTGGCAGGGAGACGG + Intergenic
1069854616 10:71433131-71433153 TTGTGTGAGTGGTGAGGTTATGG - Intronic
1069868442 10:71518676-71518698 GTGTGTGTGTGGGCAGGGGAAGG - Intronic
1070381473 10:75884279-75884301 GTGTGTGTGTGTGTAGGGGAGGG + Intronic
1070494443 10:77008989-77009011 GTGTGTGTGAGGTGAGGGGGTGG - Intronic
1070534122 10:77362354-77362376 GTGTGTGTGTGGGGTGGGGGGGG - Intronic
1070655427 10:78267838-78267860 CTGTGTGAGTGGAGTGGGGAAGG + Intergenic
1070720701 10:78755003-78755025 GTGTGTGTGTGTCCAGGGGTGGG + Intergenic
1070908716 10:80098650-80098672 GTGGGTGGGGGGCTAGGGGAGGG + Intergenic
1070937443 10:80312037-80312059 GTGTGTGTGTGTTGGGGGGAGGG - Intergenic
1071160136 10:82735755-82735777 GGGGGTGGGTGGCTAGGGGAGGG + Intronic
1071306458 10:84303156-84303178 GTGTGTGTGTGGCGGCGGGGGGG + Intergenic
1071498848 10:86189486-86189508 GTGTGTGTGTGTAGAGGGTAGGG - Intronic
1071945991 10:90645560-90645582 GTGGGTGAGGGGCTGGGGGAGGG - Intergenic
1072102546 10:92243084-92243106 GTGTGTGGTGGGGGAGGGGAAGG - Intronic
1072295678 10:94007320-94007342 GTGGGTGGGAGGGGAGGGGATGG + Intronic
1072808811 10:98444255-98444277 GTGTGTGTGTGGCGGGGGGGTGG - Intronic
1072901133 10:99407952-99407974 GTGGGTGGGAGGCAAGGGGAGGG - Intronic
1072946475 10:99815087-99815109 GGGAGTGAGGGGCGAGGGGAGGG - Intronic
1073090008 10:100928034-100928056 GTGTGTGTGTGGGGGGGGGGGGG - Intronic
1073121314 10:101123860-101123882 ATGTGTGAGAGGGGAGGGGGTGG + Intronic
1073302220 10:102477851-102477873 GTGTGTGTGTGGGGTGGGGTGGG - Intergenic
1073794899 10:106976685-106976707 GGGGGTGAGAGGCAAGGGGAAGG - Intronic
1073866682 10:107812674-107812696 ATGTGGGTGTGGTGAGGGGAAGG + Intergenic
1074290409 10:112133843-112133865 GTGGGAGAGTGGAGAGGGTATGG - Intergenic
1074290524 10:112135123-112135145 GTGGGAGAGTGGAGAGGGTATGG + Intergenic
1074447891 10:113535245-113535267 GTGAGTGAGGGACAAGGGGAGGG - Intergenic
1074454620 10:113586466-113586488 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
1074627721 10:115211753-115211775 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1074888618 10:117715808-117715830 GGGGGTGAGGGGCAAGGGGAGGG + Intergenic
1075038039 10:119085671-119085693 GTGTGTGAGTGGCTGAGGTAAGG - Intergenic
1075085151 10:119409832-119409854 GTGCGTGATAGGCGAGGGCAGGG - Intronic
1075157491 10:119990117-119990139 GTGTGTGTGTGAGGAGGGGCAGG + Intergenic
1075163540 10:120045438-120045460 GTGAGTGAGTGGTGAGTGAATGG + Intergenic
1075163789 10:120047770-120047792 GTGGGTGGGGGGCTAGGGGAGGG + Intergenic
1075242681 10:120792899-120792921 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1075530048 10:123221420-123221442 GTTTGTGAGTGGAGGGGGGCAGG + Intergenic
1075673453 10:124280098-124280120 GTGCTTGGGTGGCGAGGGGCAGG - Intergenic
1075741487 10:124698941-124698963 TGGTGTGAGTGAGGAGGGGAGGG - Intronic
1075801073 10:125153593-125153615 GTGTGTGTGTGGCAGCGGGAGGG - Intronic
1075954925 10:126515313-126515335 GTGAGTGAGTGGTGAGTGAATGG - Intronic
1076189312 10:128471431-128471453 GTGTGTGTGTGTGGGGGGGATGG - Intergenic
1076415811 10:130287638-130287660 GTGAGTGTGTGGTCAGGGGAGGG + Intergenic
1076896689 10:133316678-133316700 GTGTGTGTGTGGGGGGGGGGGGG - Intronic
1076973276 11:150670-150692 GTATGAGAGTGGGGAGGGAAGGG - Intergenic
1077213516 11:1384345-1384367 GTGGGTGGGTGGCAGGGGGAGGG - Intergenic
1077365655 11:2160511-2160533 TTGTTTGAGGGGCGAGTGGAGGG + Intronic
1077574407 11:3370578-3370600 GTGTGCGAGAGGCGTGGTGATGG - Intronic
1077642871 11:3897653-3897675 GGGTGGGCGTGGCGGGGGGAGGG - Intronic
1077697661 11:4409157-4409179 GGGGGTGAGGGGCTAGGGGAGGG + Intergenic
1077721391 11:4632954-4632976 GTGGGCGAGGGGCAAGGGGAGGG + Intergenic
1077967471 11:7150492-7150514 GTGGGTGGGGGGCTAGGGGAGGG + Intergenic
1077969600 11:7174731-7174753 GCGGGTGAGTGGCTAGGGGAGGG + Intergenic
1078336972 11:10472293-10472315 GGGGGTGAGGGGCTAGGGGAGGG + Intronic
1078755880 11:14209402-14209424 GGGTGTGGGGGGCTAGGGGAGGG - Intronic
1078955583 11:16190782-16190804 GTGTGTGCGTGGCAGTGGGAGGG + Intronic
1079026230 11:16950072-16950094 GTGTGTGTGGGGCGGGGGGCGGG + Intronic
1079391159 11:20023272-20023294 GTGTGTGAGTGGGGGTGGGAGGG + Intronic
1079482231 11:20893258-20893280 GGGGGTGAGGGGTGAGGGGAGGG + Intronic
1079798206 11:24834236-24834258 GGGGGTGAGGGGCAAGGGGAGGG - Intronic
1079868532 11:25765453-25765475 GTGTGTGTGTGGGGAGAGGGGGG + Intergenic
1080136867 11:28865312-28865334 GTGTGTGTGTGGTCGGGGGAGGG + Intergenic
1080170129 11:29291213-29291235 GTGTGTGAGGGGCGGTGGGGGGG + Intergenic
1080231192 11:30018502-30018524 GTGTGGGAGTGGGGTGGAGATGG - Intergenic
1080336862 11:31207688-31207710 GGGGCTGAGTGGCCAGGGGAGGG - Intronic
1080396965 11:31899137-31899159 GGGTGTGGGGGGCTAGGGGAGGG - Intronic
1080412340 11:32037630-32037652 GTGTCTGTGTGGCGTGGGGGTGG + Intronic
1080673843 11:34406005-34406027 GTGTGTTTGGGGTGAGGGGAAGG - Intergenic
1080853154 11:36088918-36088940 GTGTGAGACTGGGGAGGAGAGGG - Intronic
1080934499 11:36848119-36848141 GGGGGTGAGGGGCTAGGGGAGGG + Intergenic
1081020224 11:37937222-37937244 GTGGGTGAGGGGCTAGGGGAGGG - Intergenic
1081499547 11:43652731-43652753 GTGTGTGCCTGGGGAGGGCATGG - Intronic
1081602413 11:44504416-44504438 GTGTGTGTGTGGAGAGAGTATGG - Intergenic
1081628945 11:44674404-44674426 GTGTGTGAGTGGGGGTGTGAGGG + Intergenic
1081670896 11:44942004-44942026 GTGTGTGTGTGGCGTGAGTATGG - Intronic
1081864135 11:46350499-46350521 GTATGTGGGTGGGGTGGGGAGGG - Intronic
1081967187 11:47177128-47177150 GCGTGGGAGGGGCGGGGGGAAGG - Intergenic
1082262426 11:50087181-50087203 GTATGAGAGTGGGGAGGGAAGGG - Intergenic
1082785792 11:57315747-57315769 GTGTGTGTGTGGCGGTGGGGGGG - Intronic
1082822274 11:57552202-57552224 GTGTGTGTGTGGTGGAGGGAAGG - Exonic
1083211429 11:61189637-61189659 GCGTGTGAGTGGAGACTGGAAGG - Intergenic
1083316158 11:61816160-61816182 GGGGGTCAGTGGCCAGGGGAGGG - Intronic
1083325309 11:61870057-61870079 GTGTGTGTGTGGGGCGGGGGAGG + Intergenic
1083328191 11:61884309-61884331 GCGGGTGAGGGGCAAGGGGAGGG + Intronic
1084043812 11:66557620-66557642 GGGTGTGGGTGGAGAGGGGTGGG + Intronic
1084451406 11:69241016-69241038 GTGTGTGTGTGGTGGGGGCAGGG + Intergenic
1084600319 11:70141640-70141662 AGGTGTGAGCGGAGAGGGGAGGG + Intronic
1084797453 11:71518276-71518298 GTGTGCGAGAGGCGTGGTGATGG - Intronic
1085089725 11:73700600-73700622 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
1085166149 11:74401367-74401389 GTGAGTGAGTGGTGAGGGAATGG + Intergenic
1085204003 11:74719371-74719393 GTGTGTGTGTGTACAGGGGAGGG - Intronic
1085254826 11:75166544-75166566 GTGGGTGAGTGGGTAGGAGAGGG - Intronic
1085448274 11:76615539-76615561 GTGTGTGTGTGTTGGGGGGATGG - Intergenic
1085529689 11:77184024-77184046 GTGAGTGAGAGGCGAGCGGCAGG - Intronic
1085780459 11:79403631-79403653 GAATGTGAGTGTCGAGGGGTGGG - Intronic
1085871402 11:80354416-80354438 GTGAGTGAGTGGTGAGTGAATGG + Intergenic
1085881429 11:80471665-80471687 GTGTGTGTGTGGAGATGGGGGGG + Intergenic
1085958407 11:81429343-81429365 GAGTGGGAGTGGTGGGGGGAAGG + Intergenic
1086256133 11:84878556-84878578 GTGGGTGGGTGGCTAGGGGAGGG + Intronic
1086552365 11:88067748-88067770 GGGTGTGGGTGGCAAGGGGAGGG + Intergenic
1086789218 11:91014629-91014651 GTGTGTTAGTGGGGTGGCGATGG + Intergenic
1087588959 11:100160062-100160084 GTGGGTGAGGGGCTAGGGGAGGG - Intronic
1088161169 11:106872911-106872933 GGGGGTGGGAGGCGAGGGGAGGG - Intronic
1088628019 11:111746474-111746496 GGGGGTGAGGGGCGAGGGGAGGG + Intronic
1088723187 11:112612413-112612435 GGGTGGGAGGGGGGAGGGGAGGG + Intergenic
1089298698 11:117484937-117484959 GTGTGTAAGTGGGGCTGGGAGGG + Intronic
1089318990 11:117612440-117612462 GTGTGTTAGGGGCGGGGGTAGGG - Intronic
1089493223 11:118896367-118896389 GTGGGTGGGAGGAGAGGGGACGG + Exonic
1089585843 11:119508988-119509010 GTGTGTGTGTGGAGTGTGGAGGG + Intergenic
1089699427 11:120235628-120235650 AACTGTGACTGGCGAGGGGATGG - Intergenic
1090061349 11:123466685-123466707 GTGCGTGTGTGGAGAGTGGAGGG + Intergenic
1090074169 11:123569000-123569022 GTGTGTGTGTGGGGAAGGGGAGG + Intronic
1090246118 11:125216996-125217018 GTGTGTGTGTTTTGAGGGGATGG - Intronic
1090287745 11:125514700-125514722 GTGTGTGTGTGGCGGGGGGTGGG + Intergenic
1090408221 11:126490220-126490242 GTGTGTGTGTGGCGGGGGCGGGG + Intronic
1090534671 11:127627400-127627422 GTGTGAGGGTGGGGTGGGGAGGG + Intergenic
1090627863 11:128621680-128621702 ATGTGTGTGGGGCCAGGGGAGGG - Intergenic
1090658671 11:128865029-128865051 GAGGGTGGGTGGCCAGGGGAGGG - Intronic
1090734869 11:129603138-129603160 GGGGGTGGGGGGCGAGGGGAAGG + Intergenic
1090907868 11:131093222-131093244 GTGTGTGTGTGGTGCGGGGGTGG + Intergenic
1091014236 11:132035629-132035651 GTGTGTGTGTGGCAGTGGGAGGG + Intronic
1091332966 11:134744877-134744899 GTGTGTGTGTGGTGGGGGGGAGG - Intergenic
1091650277 12:2304234-2304256 GTGTGTGTGAGGCGAGGTGGAGG + Intronic
1091778591 12:3200206-3200228 GTGTGTCATTGGGGAGGGGGTGG + Intronic
1091799515 12:3316093-3316115 GTGTGTGTGTGGTGGGGGGTGGG + Intergenic
1091804390 12:3345632-3345654 GTGTGTGTTGGGCGGGGGGAGGG - Intergenic
1091817815 12:3453232-3453254 GTGAGCGAGGGGCGTGGGGAGGG - Intronic
1091875493 12:3930223-3930245 GTGAGTGAGTGTGGAGGGAAGGG - Intergenic
1091981855 12:4871133-4871155 GTGTGTGTGTAGAGAGGGGTGGG - Intergenic
1092046469 12:5434493-5434515 GTGTGTGTGTGTGTAGGGGAAGG + Intronic
1092253959 12:6916265-6916287 GTGTGTGTGTGGGGTGGGGGTGG + Intronic
1092282584 12:7108979-7109001 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
1093083938 12:14845635-14845657 GCGAGAGAGTGGGGAGGGGAGGG + Intronic
1093504162 12:19845458-19845480 GTGGGTGGGGGGCAAGGGGAGGG - Intergenic
1093595771 12:20957086-20957108 GGGGGTGAGGGGCTAGGGGAGGG + Intergenic
1093670028 12:21862682-21862704 GTATGTGTGTGGGGTGGGGAGGG - Intronic
1093914272 12:24783435-24783457 GGGTGGGGGTGGTGAGGGGAGGG + Intergenic
1094078822 12:26509994-26510016 GTGTGTGTGTGGTGGGGGGTGGG + Intronic
1094092023 12:26661266-26661288 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
1094279256 12:28717042-28717064 GGGGGTGTGTGGCTAGGGGAGGG + Intergenic
1094730604 12:33170071-33170093 GGGGGTGAGGGGCTAGGGGAGGG + Intergenic
1095229806 12:39726303-39726325 GGGTGTGGGGGGCTAGGGGAGGG - Intronic
1095391339 12:41710211-41710233 GGGTGAGAGTGGTGAGAGGAGGG - Intergenic
1095498600 12:42811938-42811960 CTGTGGGAGTGGAGAAGGGAGGG + Intergenic
1095779490 12:46043772-46043794 GTGTGTGTGTTGCGAGGGTGGGG + Intergenic
1095796823 12:46228467-46228489 GAGTGTCAGTGGTGAGGTGAGGG - Intronic
1095965613 12:47865028-47865050 GAGTGTGAGTGTCCAGGGGCTGG - Exonic
1096079090 12:48822112-48822134 GTGTGTGTGTGTATAGGGGAAGG - Intronic
1096205055 12:49714366-49714388 GTGGGTGGGGGGCTAGGGGAGGG + Intronic
1096265223 12:50117357-50117379 GTGTGTGCGTGGCCATGGTAAGG + Intronic
1096368022 12:51045114-51045136 GTGTGTGTGTAGCGGGGGAAAGG + Intergenic
1096576392 12:52555516-52555538 GGGGGTGAGGGGTGAGGGGAGGG + Intergenic
1096597975 12:52709255-52709277 GTGTGTCAGGGGCGTGGGGCTGG + Intergenic
1096626018 12:52896499-52896521 GTGACTGAGTGGAGTGGGGAAGG + Intergenic
1096765466 12:53885121-53885143 GGGTGGGAGTGGTGAGGAGAGGG + Intergenic
1097238544 12:57556688-57556710 GTGTTTGTGGGGGGAGGGGAGGG + Intronic
1097388642 12:58981640-58981662 GGGGGTGAGGGGCGAGGGGAGGG + Intergenic
1097424495 12:59426236-59426258 GTGTGTGTGTGGCGGGGGGGGGG - Intergenic
1097539943 12:60928442-60928464 GTGTGTGTGTGGCCGGGGGTGGG + Intergenic
1098350677 12:69555996-69556018 GTGTGTGTGTGGCGGGGGGGGGG + Intronic
1098709278 12:73734594-73734616 GTGGGTGGGAGGCTAGGGGAGGG + Intergenic
1098927298 12:76364500-76364522 GTGGGTGGGAGGCTAGGGGAGGG + Intronic
1098964764 12:76775278-76775300 GTGTGTCAGTGGCTTGGAGAAGG + Intronic
1099229568 12:80006412-80006434 GTGTATGAGTGAAGAGGGTATGG - Intergenic
1099268969 12:80483725-80483747 GTGGGTGGGGGGCTAGGGGAGGG - Intronic
1100102091 12:91121336-91121358 GAGGTTGAGGGGCGAGGGGAGGG - Intergenic
1100418625 12:94406481-94406503 GTGTGTGTGTGGTGGGGGCAGGG + Intronic
1100554397 12:95678187-95678209 GGGTGTGGGGGGCGAGGGGAGGG + Intronic
1100728351 12:97434821-97434843 GTGTGTGTGTGTGCAGGGGAAGG - Intergenic
1100829223 12:98502828-98502850 GTGTGTGTGTGGGGGGGGGGAGG - Intronic
1101332580 12:103769107-103769129 GTGTGTGTGTGTTGGGGGGAAGG - Intergenic
1101487392 12:105179127-105179149 GTGGGTGGGTGTCAAGGGGAGGG - Intronic
1101516365 12:105439317-105439339 GGGGGTGAGAGGCAAGGGGAGGG - Intergenic
1101660688 12:106762847-106762869 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
1101673079 12:106894957-106894979 GTGAGTGAGTGGCAAGTGAATGG - Intergenic
1101816443 12:108149666-108149688 GTGTGTGTGTGGCGGGGTGGGGG - Intronic
1102004389 12:109579947-109579969 GTGTGTGCGTGGTCTGGGGAAGG + Intronic
1102009197 12:109607603-109607625 GTGTGTGTGTGGCGGGGGTGGGG - Intergenic
1102224950 12:111221806-111221828 GTGTGTGCGTGCCGGTGGGAGGG + Intronic
1102863901 12:116359323-116359345 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1102867924 12:116388952-116388974 GTGTGTGTGTGGCGGGAGGGTGG - Intergenic
1102871209 12:116415804-116415826 GTGTGTCACGGGTGAGGGGATGG + Intergenic
1102965275 12:117120802-117120824 GTGGGTGGGTGGTGAGGGGGAGG - Intergenic
1103020162 12:117527270-117527292 GTGTGTGTGTGTCGAGGTTATGG - Intronic
1103542119 12:121673277-121673299 AGGTGTGAGTGGAAAGGGGAGGG - Intergenic
1103875642 12:124125096-124125118 GTGGGTGAGTGGGGAGAGGCAGG + Intronic
1104097959 12:125576882-125576904 GTGTGTGTGTGGCAGGGGGGTGG + Intronic
1104098866 12:125587396-125587418 GTGTGTGGGGGGTGCGGGGAGGG + Intronic
1104255834 12:127137409-127137431 GGGAGTGAGGGGTGAGGGGAGGG - Intergenic
1104345069 12:127988981-127989003 GTGTGTGTGTGTCCAGAGGATGG + Intergenic
1104644370 12:130486465-130486487 GGGTATGAGTGGCGGGGGGGCGG - Intronic
1104856455 12:131904569-131904591 CTGGGTGAGTGGCTGGGGGATGG + Intronic
1104921512 12:132293039-132293061 GTGTGGGAGTGGCGGGGCCAGGG + Intronic
1105498627 13:20952431-20952453 GTGTGGGAGAGGGCAGGGGATGG + Intergenic
1105700673 13:22933505-22933527 GTGTGTGTGGGGAGCGGGGATGG - Intergenic
1105770929 13:23611095-23611117 GTGTGTGTCTGGTGAGGGGAGGG - Intronic
1105853468 13:24355660-24355682 GTGTGTGTGGGGAGCGGGGATGG - Intergenic
1106002600 13:25738337-25738359 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
1106649833 13:31678274-31678296 GGGTGTGGGGGGCTAGGGGAGGG + Intergenic
1106886128 13:34186423-34186445 GTGTGTGTGTGTTGAGGGGGCGG + Intergenic
1106993958 13:35459006-35459028 GTGTGTGTGTGGGGGGGGGGGGG - Intronic
1107013680 13:35692197-35692219 CTGTGTGAGAGGGGAGGAGAAGG + Intergenic
1107172988 13:37365374-37365396 GTGTGTGTGTGGGCAGGGCAGGG + Intergenic
1107437534 13:40393411-40393433 GGGGGTGAGGGGCAAGGGGAGGG + Intergenic
1107484461 13:40813123-40813145 GTGTGTGGGTGGGGGGGGGGGGG - Intergenic
1107501434 13:40981334-40981356 GTGTGTGTGTGTTGTGGGGAGGG + Intronic
1107552574 13:41491069-41491091 GTGTGTGTGTGGAGTGGGGGAGG + Intergenic
1107755351 13:43615733-43615755 GGGGGTGAGGGGCTAGGGGAGGG - Intronic
1107770941 13:43787002-43787024 GTGGGGGAGTCGCGAGGGGAGGG + Intergenic
1108063359 13:46553704-46553726 GTGAGTGAGGGCCGAGGGGCGGG + Intronic
1108174535 13:47778582-47778604 GGGTGGGGGTGGCTAGGGGAGGG - Intergenic
1108458497 13:50641646-50641668 GTGTGTGTGTGGTGAGGTGAGGG + Intronic
1108624485 13:52213934-52213956 TTGGGTGAGGGGCTAGGGGAGGG - Intergenic
1109080336 13:57891666-57891688 GTGTGTGAGAGATGAGGAGAAGG - Intergenic
1109106179 13:58253437-58253459 GTGTGTGTGTGGGGGGGGGGTGG - Intergenic
1109611517 13:64771467-64771489 GGGTGTGGGGGGCAAGGGGAGGG - Intergenic
1109725701 13:66338630-66338652 GTGTGTGTGTGTAGAGGGGTGGG + Intronic
1110065833 13:71104410-71104432 GGGTGGGAGTGGTGGGGGGAGGG - Intergenic
1110736909 13:78947955-78947977 GTGGGTGGGGGGCAAGGGGAGGG - Intergenic
1111128223 13:83940115-83940137 GGGGGTGAGGGGCAAGGGGAAGG + Intergenic
1111685643 13:91498134-91498156 GTGTGTGTGTGGCGGCGGGTGGG - Intronic
1111753686 13:92365407-92365429 ATGAGTGAGTGGTGAGTGGATGG + Intronic
1111764749 13:92514142-92514164 GTGTGTGTGTGGGGCGGGGGCGG - Intronic
1111830468 13:93322930-93322952 GGGTGTGGGGGGCTAGGGGAGGG - Intronic
1111877047 13:93910451-93910473 ATGTGTGTGTGGCGGGGGGTGGG + Intronic
1111998520 13:95189036-95189058 GTGGGTGGGGGGCAAGGGGAGGG - Intronic
1111999720 13:95198958-95198980 GAGGGTGAGGGGCAAGGGGAAGG + Intronic
1112362119 13:98727797-98727819 GTGAGTGAGGGGGAAGGGGATGG - Intronic
1112447375 13:99476578-99476600 GTGTGTGTGTGGGGGGGGGGTGG - Intergenic
1112726496 13:102310687-102310709 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
1112740586 13:102468582-102468604 GGGGGTGGGTGGCAAGGGGAGGG - Intergenic
1112854792 13:103754509-103754531 GTGGGTGAGGGGCGGGGGGAGGG + Intergenic
1112981848 13:105394354-105394376 GTGTGTGTGTGGTGAGGGGGGGG + Intergenic
1113039186 13:106085701-106085723 GTGTGTGTGGGGGGTGGGGAGGG + Intergenic
1113120722 13:106921334-106921356 GTGTGTGTGTGTGGCGGGGAGGG + Intergenic
1113359407 13:109615732-109615754 GGGTGTGGGAGGCAAGGGGAGGG - Intergenic
1113454545 13:110438799-110438821 GTGTGTGTGTGGGGGGGGGTGGG - Intronic
1113473679 13:110564486-110564508 GTGTGTGTGTGGCGGGGGGCAGG - Intergenic
1113795501 13:113055371-113055393 GTGTGTGTGTGGCGGGGGGGGGG - Intronic
1113901353 13:113800086-113800108 GTGTGTGTGTGGGGGGGGGTAGG + Intronic
1113901376 13:113800185-113800207 GTGTGTGTGTGGGGGGGGGTAGG + Intronic
1114377094 14:22158671-22158693 GTGTGTGTGTGGGGCGGGGAGGG + Intergenic
1114473307 14:22978292-22978314 GTGTGTATGTGGGCAGGGGAGGG + Intronic
1114762934 14:25337485-25337507 GGGTGTGGGGGGCTAGGGGAGGG - Intergenic
1114900755 14:27054573-27054595 GTGGGTGGGAGGCTAGGGGAGGG + Intergenic
1114966359 14:27966164-27966186 GTGGGTGGGGGGCTAGGGGAGGG - Intergenic
1115344869 14:32331695-32331717 GTGTGTGTGTGTATAGGGGAAGG + Intronic
1115387813 14:32818324-32818346 GTGTGTGTGTGTGGTGGGGAAGG - Intronic
1115389648 14:32840742-32840764 GTGTGTGTGTGGGGGGGGGTGGG - Intergenic
1115400014 14:32946323-32946345 GTGTGTGTGTGTTGGGGGGATGG - Intronic
1115671536 14:35617623-35617645 GTGTGTGTGTGGGGTGGGGGGGG + Intronic
1115835090 14:37393416-37393438 GTGTGTGTGTGGCGGGGGTGGGG + Intronic
1115888728 14:38003717-38003739 GTGTGTGTGTGGTGGGGGGCGGG + Intronic
1115888813 14:38004296-38004318 GTGTGTGAGTGGGGTGGGGTGGG + Intronic
1116075545 14:40105744-40105766 GGGGGTGGGGGGCGAGGGGAGGG + Intergenic
1116673892 14:47879992-47880014 GTGTGTGTGTGGTGGGGGAATGG + Intergenic
1116676518 14:47912693-47912715 GTGTGTGTGTGGCGGGGGGTGGG + Intergenic
1116747294 14:48836897-48836919 GAGTGTGTGGGGGGAGGGGAGGG - Intergenic
1116791961 14:49348723-49348745 GGGTGTGAGGTGCAAGGGGAGGG - Intergenic
1117417477 14:55510495-55510517 GTGTGTGTGTGTGTAGGGGATGG - Intergenic
1117548496 14:56811801-56811823 GTGGGTGGGTGGCGGGGGGTGGG - Intergenic
1117730575 14:58718045-58718067 GTGTGTGTGTGGTGAGGGGAAGG + Intergenic
1117963986 14:61188577-61188599 GTGTGTGTGTGTCGGGGGGGTGG + Intronic
1118011170 14:61612040-61612062 GTGTGTGTGTGTGGAGGGGGTGG - Intronic
1118048002 14:61993263-61993285 GGGTGTGGGGGGCAAGGGGAGGG + Intergenic
1118088966 14:62451161-62451183 GTGTGTTGGTGGGGAGGGGGTGG + Intergenic
1118181041 14:63493494-63493516 GCGTGTGTGTGGTGGGGGGAGGG + Intronic
1118429203 14:65699135-65699157 GTGTGTGTGTGTAGAAGGGAGGG - Intronic
1118467600 14:66045136-66045158 GTGTGTGGGTGGGGTGGGGTGGG + Intergenic
1118939766 14:70322392-70322414 GGGGGTGGGTGGCTAGGGGAAGG - Intergenic
1119141449 14:72271074-72271096 GTGTCTGAGAGGCCAGAGGAAGG + Intronic
1119431725 14:74572732-74572754 GTGTGTGTGTGGCGGGGCGTGGG - Intronic
1119519290 14:75273930-75273952 GTGTGTGTGTGGGGGGGGGGTGG + Intergenic
1119914298 14:78382912-78382934 GTGTGTGTGTGGGGAGGAGGGGG + Intronic
1120462869 14:84819496-84819518 GTGGGTGAGGAGTGAGGGGAGGG + Intergenic
1120705435 14:87740459-87740481 GGGTGTGGGGGACGAGGGGACGG - Intergenic
1120725308 14:87932313-87932335 GGGGGTGGGGGGCGAGGGGAGGG + Intronic
1120755619 14:88241492-88241514 GTGTGTGTGTGGTGTGGGGGTGG - Intronic
1121539918 14:94717829-94717851 GTGTGTGTGTGGTGGGGGGTGGG - Intergenic
1121576737 14:94995168-94995190 ATGTGTGAATGGAGATGGGAAGG - Intergenic
1121600821 14:95201727-95201749 GGGGGTGGGAGGCGAGGGGAGGG - Intronic
1121655376 14:95591566-95591588 GGGGGTGAGGGGCTAGGGGAGGG + Intergenic
1121841944 14:97141860-97141882 GTGTGTGTGTGTCGGGGGGGGGG + Intergenic
1121843393 14:97153017-97153039 GTGTGTGTGTGTTGGGGGGAGGG + Intergenic
1121843681 14:97155246-97155268 GTGTGTGTGTGTTGGGGGGATGG + Intergenic
1121855324 14:97264204-97264226 GTGAGTGAGTGGTGAGTGAATGG - Intergenic
1122210216 14:100168559-100168581 GTGTGTGTGTGTTGAGGGCAGGG - Intergenic
1122210234 14:100168628-100168650 GTGTGTGTGTGTTGAGGGCAGGG - Intergenic
1122214038 14:100192084-100192106 GTGGGTGGGTGGTGGGGGGAGGG - Intergenic
1122231613 14:100308919-100308941 GTGTGTGTGTGGTCGGGGGAGGG + Intergenic
1122329613 14:100903717-100903739 GGGTGTGGGTGGGCAGGGGACGG + Intergenic
1123112482 14:105879867-105879889 GTGTGTAAGTGGTTGGGGGAGGG + Intergenic
1123116996 14:105899342-105899364 GTGTGTAAGTGGACGGGGGAGGG + Intergenic
1123119060 14:105908650-105908672 GTGTGTAAGTGGACGGGGGAGGG + Intergenic
1123501474 15:20887153-20887175 GTGGGTGAGTTGTGAGGGGCAGG + Intergenic
1123558727 15:21460852-21460874 GTGGGTGAGTTGTGAGGGGCAGG + Intergenic
1123594956 15:21898133-21898155 GTGGGTGAGTTGTGAGGGGCAGG + Intergenic
1123703151 15:22930936-22930958 GTGAGTGAGTGGCGAGCGAGTGG - Intronic
1123778456 15:23603020-23603042 GTGTCTGAGTGCCGATGGGAAGG - Intronic
1123800343 15:23812353-23812375 GTTTGTGCGTGGGGAGAGGAGGG + Intergenic
1123938951 15:25207495-25207517 GTGTGTGCTTGGAGAGGGGCAGG + Intergenic
1124857162 15:33400363-33400385 GTGTGTGTGTGGCGGGGGGAAGG - Intronic
1124884230 15:33669834-33669856 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
1124907845 15:33888307-33888329 GTGTGTGTGTGGCAGGGGGAAGG + Intronic
1125057309 15:35376588-35376610 GTGAGTGAGTGGTGAGTGAATGG - Intronic
1125083786 15:35706072-35706094 GTGTGTGGGTGGAGAGGTGAAGG + Intergenic
1125407263 15:39366093-39366115 GTGTGTGGGCGGGGAGGGGGCGG + Intergenic
1125419325 15:39488315-39488337 GTGTGTGTGTGGTGGGGGGTGGG - Intergenic
1125471473 15:40008604-40008626 GTGTGTGTGTGGGGTGGGGAGGG - Intronic
1127283012 15:57508186-57508208 GTGTGTGTGGGGCGGGGGGAGGG - Intronic
1127381640 15:58435474-58435496 GGGTGGGAGTGGGGTGGGGAGGG + Intronic
1128039886 15:64562899-64562921 GTGTGTGTGTGTCTAGGAGAGGG + Intronic
1128129737 15:65218446-65218468 GAGTGTGAATAGCCAGGGGAGGG - Intergenic
1128156255 15:65393807-65393829 GTGTGTGTGTTGGCAGGGGATGG - Intronic
1128342530 15:66832357-66832379 GTGTGTGTGTGGTGAGAGGCAGG + Intergenic
1128361027 15:66961961-66961983 ATCTGTGAGGGGGGAGGGGATGG - Intergenic
1128595029 15:68937606-68937628 GTGGGTGGGGGGTGAGGGGAGGG - Intronic
1128732107 15:70028311-70028333 GTGGGTGGGTGGGGTGGGGATGG + Intergenic
1129053079 15:72798363-72798385 GTGTGTGTTTGGCGGGGGGTGGG + Intergenic
1129150654 15:73685485-73685507 GTGTGTGTGTGGCGGGTGGGGGG + Intronic
1129235502 15:74221590-74221612 CTGTGTGGGTGGGGAGGTGATGG + Intergenic
1129894092 15:79090923-79090945 GTGTGTGTCTGGGGAGGGGGAGG - Intergenic
1129946835 15:79545768-79545790 GTGTGTGAGAGCCCAGAGGAAGG - Intergenic
1130059558 15:80559753-80559775 GTGCCTGAGTGGAGAGGAGACGG - Intronic
1130060987 15:80569805-80569827 GTGTGTGAGTGGAGAGGGCCAGG + Intronic
1130948473 15:88567274-88567296 AGGTGTGAGTGGCCAGGGCAGGG + Intergenic
1131071743 15:89470545-89470567 GTGTGTGAATTGCAAGGGGGCGG + Intergenic
1131366634 15:91847033-91847055 GTGTGTGAACGGCTGGGGGAGGG + Intergenic
1131765107 15:95667629-95667651 GTGTGTGTGTGGCGGTGGGGGGG - Intergenic
1131808477 15:96147892-96147914 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1132360072 15:101204898-101204920 TTGTGTGTGTGGCGGGGGGATGG - Intronic
1202955061 15_KI270727v1_random:71187-71209 GTGGGGGAGTGGGGGGGGGAAGG - Intergenic
1202967075 15_KI270727v1_random:188011-188033 GTGGGTGAGTTGTGAGGGGCAGG + Intergenic
1132558691 16:583842-583864 GAGTGTGAGTGGCCTGGGGAGGG + Exonic
1132726206 16:1339361-1339383 GTGGGTGAGTGAGGAGCGGAGGG + Intronic
1133090253 16:3398674-3398696 GTGTGTGAGGGAAGAAGGGAAGG - Intronic
1133667184 16:7979979-7980001 GTGCCAGAGTGGGGAGGGGAAGG - Intergenic
1133671437 16:8025089-8025111 GTGTCTGAGTGATAAGGGGAGGG - Intergenic
1133715117 16:8440427-8440449 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1133771600 16:8869714-8869736 GTATTTGAGGGGCGCGGGGAAGG + Intergenic
1133798770 16:9067896-9067918 GTGTGTGAGTGTCGTGGGGGTGG + Intergenic
1133950516 16:10387831-10387853 GTGTCCGGGTGGCGGGGGGAGGG - Intronic
1134224813 16:12381684-12381706 GTGGGTGGGTGGTGGGGGGATGG - Intronic
1134522160 16:14923793-14923815 GGGCGGGAGTGGGGAGGGGAGGG + Intronic
1134567442 16:15263617-15263639 TTGTGTGAGAGGTGAGGGGGAGG - Intergenic
1134643954 16:15851602-15851624 GGATGTGAATGGTGAGGGGAGGG - Intronic
1134709830 16:16322444-16322466 GGGCGGGAGTGGGGAGGGGAGGG + Intergenic
1134735051 16:16493083-16493105 TTGTGTGAGAGGTGAGGGGGAGG + Intergenic
1134932471 16:18219134-18219156 TTGTGTGAGAGGTGAGGGGGAGG - Intergenic
1134949773 16:18346201-18346223 GGGCGGGAGTGGGGAGGGGAGGG - Intergenic
1135203885 16:20465549-20465571 GTGGGTGAATGGGAAGGGGAAGG + Exonic
1135215119 16:20559393-20559415 GTGGGTGAATGGGAAGGGGAAGG - Exonic
1135274853 16:21103345-21103367 GTGTGTGTGTGGGGGGGGGCAGG + Intronic
1135540269 16:23324689-23324711 GTGTGTGTGTGGGGTGGGGTAGG - Intronic
1135639196 16:24105523-24105545 GGGGGTGAGGGGCAAGGGGAGGG - Intronic
1135728732 16:24876938-24876960 GAGTTTGAGTGGGGAGGAGAAGG + Intronic
1136288513 16:29258150-29258172 GTGTGTGTTGGGGGAGGGGAGGG - Intergenic
1136536492 16:30902677-30902699 GTGGGGGAGAGGGGAGGGGACGG + Exonic
1136576465 16:31128140-31128162 GTGAGTGGGTGGCCAGGGGTTGG + Intronic
1137867074 16:51909748-51909770 GTGTGTTGGTGGCGGGGGGGGGG + Intergenic
1138161612 16:54759986-54760008 GTGTGTGTATAGAGAGGGGAAGG + Intergenic
1138614663 16:58155793-58155815 GTGTGTGTGTGGCTGGGGGCTGG + Intergenic
1138926237 16:61594525-61594547 GTGAGTGAATGGCTAGGGAATGG - Intergenic
1139130363 16:64135477-64135499 GGGGGTGAGGGGCAAGGGGAGGG - Intergenic
1139662428 16:68430180-68430202 GTATGTTAGTGGCTGGGGGAGGG - Intronic
1139842420 16:69892332-69892354 GTGGGTGGGGGGCTAGGGGAGGG - Intronic
1140022048 16:71247957-71247979 CTGTGTGCGTGGCAGGGGGAGGG + Intergenic
1140321901 16:73960592-73960614 GGGTTTGAGGGGCTAGGGGAGGG + Intergenic
1140608553 16:76570536-76570558 GTGTGTGTGTGGAGGGGGGTGGG - Intronic
1140718290 16:77746983-77747005 GTGGCTGAGTGGGGATGGGAGGG - Intergenic
1140949879 16:79806815-79806837 GTGTGTGTGTGGCGGGGGCGGGG + Intergenic
1141234040 16:82198998-82199020 CTGTGTGTGTGGGGAGAGGAGGG - Intergenic
1141265753 16:82495458-82495480 GTGTGAGAGTGCCAGGGGGAGGG + Intergenic
1141266160 16:82499172-82499194 GTGTGTGTGTGTCGGGGGGGTGG - Intergenic
1141280068 16:82623410-82623432 GTGTGTGTGTGCTGGGGGGAGGG - Intergenic
1141542423 16:84736086-84736108 GTGTGTGAGTGGCGAGGGGAGGG + Intronic
1141622789 16:85245982-85246004 GTGTGTTAGTGGGGAGGCAAGGG + Intergenic
1141762710 16:86039091-86039113 GTGGGTGAGTGGGGAAGGAAGGG + Intergenic
1141830488 16:86507559-86507581 GTGGGGGAGGGGCGAGGGGAAGG + Intergenic
1142172605 16:88630753-88630775 GTGTGTGTGTGGGGGGGGGTGGG - Intronic
1142230450 16:88897762-88897784 GACTGCGAGTGCCGAGGGGAGGG - Intronic
1142372248 16:89689321-89689343 GTGTGTGAGTGGCCAAGGCTAGG + Exonic
1142446975 16:90146856-90146878 GTATGAGAGTGGGGAGGGAAGGG + Intergenic
1142448571 16:90159643-90159665 GTATGAGAGTGGGGAGGGAAGGG + Intergenic
1203095541 16_KI270728v1_random:1252700-1252722 GTGTGTGTGTGGGGGGGGGGTGG + Intergenic
1142458914 17:75646-75668 GTATGAGAGTGGGGAGGGAAGGG - Intergenic
1142460517 17:88475-88497 GTATGAGAGTGGGGAGGGAAGGG - Intergenic
1142893523 17:2960230-2960252 GGGAGGGAGTGGCGTGGGGAGGG + Intronic
1143278853 17:5735021-5735043 GTGGGTGGGGGGCAAGGGGAGGG + Intergenic
1143304387 17:5934288-5934310 GTGGGTGGGGGGCAAGGGGAGGG - Intronic
1143314007 17:6017600-6017622 GTGTGTGTGTGTTGAGGGGCGGG + Intronic
1143353795 17:6309379-6309401 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1143469231 17:7161393-7161415 GTGTGTGTGTGGGGTGGGGGGGG - Intergenic
1143981330 17:10872887-10872909 GGGGGTGAGGGGCAAGGGGAGGG - Intergenic
1143997456 17:11019605-11019627 GTGTGTGTGTGGTGGGGGGTGGG + Intergenic
1144170985 17:12659764-12659786 GTGTGTGTGTGTCGGGGGGTGGG - Intergenic
1144206662 17:12984404-12984426 GTGGGTGGGTGGCGAGGGGCAGG + Intronic
1144328550 17:14204684-14204706 GTGTGTAGGGGGTGAGGGGAGGG - Intronic
1144447846 17:15347501-15347523 GGGTGTGAGTGAGGAGTGGAAGG + Intergenic
1144447858 17:15347544-15347566 GGGTGTGAGTGAGGAGTGGAAGG + Intergenic
1144447870 17:15347587-15347609 GGGTGTGAGTGAGGAGTGGAAGG + Intergenic
1145138872 17:20435560-20435582 GAGTGTGTGTGGCGAGTGTATGG + Intergenic
1145243369 17:21252574-21252596 GGGAGTGAGGGGCGGGGGGATGG - Intronic
1145264748 17:21374362-21374384 GTGTGTGTGTGGGAAGGGGGGGG + Intergenic
1145279820 17:21458745-21458767 GTGTGTGTGTGGCGGGGAGCAGG + Intergenic
1145293649 17:21571271-21571293 GGGGGTGAGGGGTGAGGGGAGGG + Intronic
1145386331 17:22414668-22414690 GGGGGTGAGGGGTGAGGGGAGGG - Intergenic
1145413559 17:22694592-22694614 CTGTGTGACTGGTGCGGGGAGGG - Intergenic
1146364072 17:32205158-32205180 GGGGGTGAGGGGCAAGGGGAGGG - Intronic
1146374304 17:32284154-32284176 GTGTGGGAGGGGCCATGGGAGGG + Intronic
1146407446 17:32551545-32551567 GTGTGTGTGTGGCAGTGGGATGG - Intronic
1146651090 17:34606856-34606878 GCGAGTGAGTGGGGAGAGGAGGG - Intronic
1146662988 17:34677430-34677452 GGGGGTGAGGGGCTAGGGGAGGG - Intergenic
1146925498 17:36742287-36742309 GTGTGTGTGTGGCCAGGGAGGGG + Intergenic
1147063455 17:37902213-37902235 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1147192500 17:38746316-38746338 GTGTGTGTGTGGCGCAGGGTGGG - Intronic
1147387103 17:40089169-40089191 GGGCGTGAGGGGCGAGGGGCTGG - Intronic
1147484794 17:40802251-40802273 GTGTGTGAGTGTGGAGGGCTGGG + Intergenic
1147660554 17:42114770-42114792 GTGTGTGAGTGAGGAGGGGCAGG - Intronic
1147684289 17:42277338-42277360 GTGTCTGAGTGGGGGCGGGAGGG - Intergenic
1147791209 17:43015320-43015342 GTGTGTGTGTGGCGGCGGGGAGG - Exonic
1147887031 17:43691086-43691108 GTGTGTGAGGGGTGGGGGCAGGG + Intergenic
1148011105 17:44482219-44482241 GTGGGTGGGGGGCAAGGGGAGGG + Intronic
1148171619 17:45525837-45525859 CTGTTTGGGTGGGGAGGGGAGGG - Intergenic
1148177602 17:45581172-45581194 GGGGGTGGGGGGCGAGGGGAGGG + Intergenic
1148277751 17:46320572-46320594 CTGTTTGGGTGGGGAGGGGAGGG + Intronic
1148299958 17:46538427-46538449 CTGTTTGGGTGGGGAGGGGAGGG + Intronic
1148340982 17:46873292-46873314 GTGGGTGGGTGGAGTGGGGAGGG - Intronic
1148364403 17:47042712-47042734 CTGTTTGGGTGGGGAGGGGAGGG + Intronic
1148485573 17:47988668-47988690 GTGTGTGTGGGGGGAGGGGAAGG - Intergenic
1148565810 17:48632291-48632313 GTGTGTGTGTTAGGAGGGGAAGG - Intronic
1148695962 17:49558435-49558457 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1149049779 17:52290776-52290798 GGGTGTGGGGGGCTAGGGGAGGG + Intergenic
1149191402 17:54067611-54067633 ATGGGTGAGGGGCTAGGGGAAGG - Intergenic
1150004210 17:61459844-61459866 GTCTGTGAGGGGTGAGGGGTTGG - Intronic
1150250538 17:63702008-63702030 GTGTGTGTGTGGGGGGGGGAGGG + Intergenic
1150358245 17:64506438-64506460 CTGAGAGAGTGGCGCGGGGAGGG - Exonic
1150402545 17:64870872-64870894 CTGTTTGGGTGGGGAGGGGAGGG - Intronic
1150643614 17:66965149-66965171 GTGTGTGTGTGGGGCGGCGAGGG - Intronic
1150698502 17:67426608-67426630 GAGGGTGGGGGGCGAGGGGAGGG + Intronic
1151081684 17:71336516-71336538 GGGTGTGAGGGGAAAGGGGATGG + Intergenic
1151156476 17:72127164-72127186 GTGTGGGAGTGGGGATGGGGAGG - Intergenic
1151313902 17:73310732-73310754 GTGTGTGTGTGACTGGGGGAGGG - Intronic
1151381592 17:73729514-73729536 GTGTGTGATTTGGGTGGGGAAGG + Intergenic
1151446025 17:74164633-74164655 GTGTGTGTGTTGTGGGGGGATGG - Intergenic
1151784072 17:76266405-76266427 GTGTGTGTGTGTGGAGGGGGAGG - Intronic
1151820466 17:76494112-76494134 GTGTGTGTGTTGCGGGGGGCTGG + Intronic
1151850693 17:76688010-76688032 GGGTTCGAGTGCCGAGGGGAGGG - Intronic
1151917197 17:77127124-77127146 GGGGGTGAGGGGTGAGGGGAGGG - Intronic
1152022166 17:77785778-77785800 GTGTGGGGGTGTCAAGGGGAGGG + Intergenic
1152053387 17:78000619-78000641 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1152077731 17:78169262-78169284 GTGTGTGTGTGTGGCGGGGAGGG + Intronic
1152077733 17:78169264-78169286 GTGTGTGTGTGGCGGGGAGGGGG + Intronic
1152144071 17:78557160-78557182 GTGTGTGAGGGGCTAGGAGGTGG - Intronic
1152196800 17:78923377-78923399 GTGTGTGTGTGGGGCGGGGTGGG + Intronic
1152339216 17:79715179-79715201 GTGTGTGTGTGTGGCGGGGAGGG - Intergenic
1152721485 17:81926018-81926040 GTGTGTGTGTGGCGGGGGGCGGG + Intronic
1152851601 17:82639777-82639799 GTGTGTGTGTGGGGTCGGGAGGG + Intronic
1153198648 18:2627620-2627642 GTGAGTGAGTGGTGAGTGAAAGG - Intergenic
1153281880 18:3422584-3422606 GTGAGTGAGTGGTGAGTGAATGG - Intronic
1153360369 18:4188456-4188478 GGGTGTGAGGGGCAAGGGGAGGG - Intronic
1153538543 18:6130249-6130271 GTGTGTGTGTGGCGGGTGGGGGG - Intronic
1153541740 18:6163250-6163272 GTGTGTGTGTGGGGGGGGGGTGG + Intronic
1153711200 18:7801015-7801037 GTGAGTGAGTGGTGAGTGAATGG + Intronic
1153779269 18:8479652-8479674 GTGTGTGTGTGTGGAGGGGAGGG + Intergenic
1153844767 18:9039304-9039326 GTGTGTGTGTGGCGGGGCGGGGG - Intergenic
1153955713 18:10094311-10094333 GTGAGTGAGTGGTGAGTGAATGG - Intergenic
1153996482 18:10446489-10446511 GTGTGGGAGGGGGTAGGGGAGGG + Intergenic
1154139616 18:11811341-11811363 GTCTGTGAGGGGCAAGGGGCAGG - Intronic
1154354220 18:13612549-13612571 GTGTGTGAGCGTGGAGGGGGGGG - Intronic
1154961150 18:21309899-21309921 CAGTGTGTGTGGGGAGGGGATGG - Intronic
1155057124 18:22194710-22194732 GTGTGTGTGTTGGGAGGGGGGGG - Intronic
1155097917 18:22577726-22577748 GGGGGTGAGGGGCTAGGGGAGGG - Intergenic
1156281003 18:35638455-35638477 GTGTGTGTGTGGGGTGGGGAAGG - Intronic
1156450185 18:37262385-37262407 GTGTGTGTGTGGGGTGGGGGAGG + Intronic
1156501264 18:37560123-37560145 GTGTGTGCTTGGGGATGGGAGGG + Intronic
1156635329 18:39021051-39021073 GTGGGTGAGGAGCTAGGGGAGGG - Intergenic
1156669235 18:39447518-39447540 GGGGGTGAGGGGCTAGGGGAGGG + Intergenic
1156778887 18:40826165-40826187 GTGAGTGGGGGGTGAGGGGAGGG + Intergenic
1156925513 18:42573170-42573192 GGGTGTGAGGGGCTGGGGGAGGG + Intergenic
1157113754 18:44844316-44844338 GTGTGTGTGTGGGGTGGGGCAGG - Intronic
1157142457 18:45123393-45123415 GTGTGTGTGTGGCGGGGGCAGGG + Intergenic
1157392214 18:47312333-47312355 GTCGGTGAGTGGAGATGGGAAGG + Intergenic
1157464062 18:47930102-47930124 GTGTGAGAGCAGCGAGGGGAAGG + Intronic
1157469356 18:47976699-47976721 GTGTGTGTGTGTGGAGGGGCGGG + Intergenic
1157679990 18:49597581-49597603 GTGTGTGTGTGCAGAGGGAAAGG + Exonic
1157918468 18:51692739-51692761 GTGTGTGTGTGTGGAGGGGAGGG + Intergenic
1158241555 18:55384361-55384383 TGGTGTGAGTGGCGCAGGGAAGG - Intronic
1158335499 18:56411903-56411925 GTGTGTGTGAGGGGAGGGGTTGG - Intergenic
1158397113 18:57088169-57088191 GTGTGTTAGTGGTGAGGGTGGGG + Intergenic
1158435880 18:57435496-57435518 GTGCGGGAGAGGGGAGGGGACGG - Intergenic
1158514288 18:58118630-58118652 GTGTGTGTGTGGCGGGGTGGTGG + Intronic
1158608911 18:58920784-58920806 GTGTGTGTTTGGGGAGGGGAGGG + Intronic
1158839291 18:61366720-61366742 GTGTGTGAGGGAAGAGGGAAGGG - Intronic
1158848347 18:61468434-61468456 GTGTGTGTTTGGGGAGGGGAAGG + Intronic
1159387982 18:67751619-67751641 GTGTGTGTGTGGCGGGGGTGTGG + Intergenic
1159778366 18:72630538-72630560 GTGTGTGTGTGTGGGGGGGAGGG - Intronic
1159793087 18:72808458-72808480 GTGTGTGTGTGGTGAGGAGATGG + Intronic
1159948916 18:74464969-74464991 GTGTGTGTGTGGCAAGTGGGGGG + Intergenic
1159952540 18:74496063-74496085 ATGTGGGCGTGGCGAGGGGGCGG - Intronic
1160648633 19:208159-208181 GTATGAGAGTGGGGAGGGAAGGG - Intergenic
1160650232 19:220975-220997 GTATGAGAGTGGGGAGGGAAGGG - Intergenic
1160799211 19:960069-960091 CTGTGAGGGTGGAGAGGGGATGG - Intronic
1160816722 19:1039444-1039466 GAGAGTGAGAGGCGTGGGGACGG - Intergenic
1160842931 19:1154543-1154565 GGGGGTGAGTGGGGAGGGGAAGG - Intronic
1160931089 19:1569756-1569778 GGGTGTGTGAGGCGGGGGGAGGG - Intergenic
1160960514 19:1718749-1718771 GTGGGGGAGGGGCGGGGGGATGG - Intergenic
1160966047 19:1747406-1747428 GTGTGTGTGTGGCGGGCGGTGGG - Intergenic
1161088726 19:2347343-2347365 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088756 19:2347750-2347772 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088762 19:2347834-2347856 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088787 19:2348196-2348218 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088903 19:2350225-2350247 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088907 19:2350315-2350337 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088911 19:2350407-2350429 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161321469 19:3643616-3643638 GAGGGAGAGTGGAGAGGGGACGG - Intronic
1161704923 19:5815156-5815178 GTGTGTGTGTGGCCAGGAGGAGG + Intergenic
1161706017 19:5822128-5822150 GGGGGTGAGTGGGGTGGGGAAGG + Intergenic
1161816911 19:6504823-6504845 GTGTGTGTGTGTCGGGGGGGCGG + Intergenic
1161939436 19:7393713-7393735 GTGTGGAAGTGGATAGGGGAGGG + Intronic
1162116886 19:8435854-8435876 GTGTGTGTGTGTGGCGGGGAGGG + Intronic
1162320563 19:9968780-9968802 CTGTGTGGGTGGTTAGGGGATGG + Intronic
1162528902 19:11224051-11224073 GTGTGTGTGGGGCGGGGGCAGGG + Intronic
1163091331 19:15022135-15022157 GTGTGTGAGGGGGGAGGACAGGG - Intronic
1163190671 19:15674560-15674582 ATGAGTGAGTGATGAGGGGAAGG - Intronic
1163202406 19:15778418-15778440 GGGAGTGAGTGAGGAGGGGAGGG + Intergenic
1163202412 19:15778438-15778460 GGGAGTGAGTGAGGAGGGGAGGG + Intergenic
1163202418 19:15778458-15778480 GGGAGTGAGTGAGGAGGGGAGGG + Intergenic
1163202424 19:15778478-15778500 GGGAGTGAGTGAGGAGGGGAGGG + Intergenic
1163202442 19:15778554-15778576 GTGAGTGAGTGAGGAGGGGAGGG + Intergenic
1163312915 19:16524971-16524993 GGGTGGGCGTGGCGAGGGCAGGG - Intronic
1163664596 19:18597398-18597420 AGGTGTGAGTGGGGAGGGGGTGG - Intronic
1164134010 19:22394686-22394708 GGGTGTGAGGGGCTGGGGGAAGG + Intronic
1164440862 19:28278906-28278928 GGGGGTGAGGGGCAAGGGGAGGG - Intergenic
1164678239 19:30117402-30117424 GTGTGTGTGTGGCGGGGGGAAGG + Intergenic
1164680499 19:30131050-30131072 GGGAGTGAGGGGGGAGGGGAAGG - Intergenic
1164680525 19:30131123-30131145 GGGAGTGAGGGGGGAGGGGAAGG - Intergenic
1164800434 19:31071649-31071671 GTGTGTGTGTGTCGGGGGGTGGG + Intergenic
1164952709 19:32351513-32351535 GTGTGTGTGTGGCGTGGGGGCGG + Intronic
1165149786 19:33753774-33753796 GTGTGTGGGTGGTGTGGGGATGG - Intronic
1165507597 19:36244135-36244157 GTGTCTGAGTGGCTGGGGGCAGG + Intronic
1165699089 19:37923573-37923595 GTGAGTGAGTGGTGAGTGGATGG + Intronic
1166092024 19:40515482-40515504 CTGTGTGAGTGTGGAAGGGAAGG - Intronic
1166388819 19:42397494-42397516 GTGAGTGAGTGGCTAGACGAGGG - Intergenic
1166520671 19:43478178-43478200 GTCTGTGTGTGTCGAGGTGAGGG + Intronic
1166917655 19:46206476-46206498 GTGTGTGTGGGGCGGGGTGAGGG + Intergenic
1166997073 19:46724737-46724759 GTGTGTGTGCGTGGAGGGGACGG + Intronic
1167134610 19:47609317-47609339 GTGTGAGAGTGTCGCGGGGGTGG - Intronic
1167149260 19:47699415-47699437 GGGAGTGAGAGGGGAGGGGAGGG + Intronic
1167216847 19:48170711-48170733 GTAGGTGAGTGGGGAGGGGCGGG + Exonic
1167250264 19:48395497-48395519 GTGTGTGTGTTGGGAGGTGAGGG + Intronic
1167342098 19:48922155-48922177 GGGTGTGAGTGAGGAGGGGCTGG + Intronic
1167357149 19:49011049-49011071 GTGGCTGAGTGGCGCGAGGAGGG + Exonic
1167690638 19:50982482-50982504 GGGTCTGAGTGGGGAGGGGCTGG - Intronic
1167997068 19:53414426-53414448 GTGTGTGTGTGTGGTGGGGAGGG - Intronic
1168006850 19:53497107-53497129 GTGTGTGTGTGTGGTGGGGAGGG - Intergenic
1168012217 19:53542189-53542211 GTGTGTGTGTTGGGAGGGGAAGG + Intronic
1168114056 19:54211123-54211145 GTGTGTGTGTGGCAGGGGGTGGG + Intronic
1168249122 19:55131462-55131484 GTTTTTGAGGGGCTAGGGGACGG - Intergenic
1168381738 19:55929624-55929646 GTGGGTGGGGGGCTAGGGGAGGG + Intronic
925022635 2:583839-583861 GTGGGTGAGTGGGGACGTGATGG - Intergenic
925130874 2:1493196-1493218 GTGTGTGAGTGGGTGGGGGGGGG + Intronic
925200030 2:1959671-1959693 GTGTGTGAGGGGCAGAGGGATGG - Intronic
925347887 2:3183339-3183361 GTGGGTGAGTGGATAGTGGATGG - Intergenic
925363238 2:3294372-3294394 GGGTGTGTGTGGAGAGAGGATGG - Intronic
925363247 2:3294405-3294427 GTGTGTGTGTGTGGAGAGGATGG - Intronic
925363255 2:3294440-3294462 GTGTGTGTTTGGAGAGAGGATGG - Intronic
925363290 2:3294605-3294627 GGGTGTGTGTGGAGAGAGGATGG - Intronic
925363298 2:3294638-3294660 GTGTGTGTTTGGAGAGAGGATGG - Intronic
925363362 2:3294935-3294957 GTGTGTGTGTGTAGAGAGGATGG - Intronic
925363369 2:3294974-3294996 GTGTGTGTGTGTAGAGAGGATGG - Intronic
925363413 2:3295220-3295242 GTGTATGTGTGGAGAGAGGACGG - Intronic
925363421 2:3295255-3295277 GGGTGTGTGTGGAGAGAGGACGG - Intronic
925363429 2:3295288-3295310 GGGTGTGTGTGGAGAGAGGACGG - Intronic
925363437 2:3295321-3295343 GTGTGTGTGTGTAGAGAGGATGG - Intronic
925363456 2:3295420-3295442 GTGTGTGTGTGCAGAGAGGATGG - Intronic
925363484 2:3295554-3295576 GTGTGTGTGTGGAGAGAGGATGG - Intronic
925363602 2:3296128-3296150 GTGTGTGTGTGCAGAGAGGATGG - Intronic
925363642 2:3296303-3296325 GTGTGTGTGTGTAGAGAGGATGG - Intronic
925363670 2:3296447-3296469 GTGTGTGTGTGGAGAGAGGATGG - Intronic
925774311 2:7319123-7319145 CTGTGTGTGTGGTGGGGGGAGGG + Intergenic
926087615 2:10029778-10029800 GTGTGTGTGTGGCGGGGGTGGGG - Intergenic
926152629 2:10433266-10433288 GTGTGGGAATGGTGTGGGGATGG + Intergenic
926204721 2:10828014-10828036 CTGTGTGTGTGGCAGGGGGAGGG - Intronic
926335947 2:11862950-11862972 GTGTGTGTGTGTCGGGGGGTGGG + Intergenic
926637923 2:15203920-15203942 GTGTGTGAGTGGGGAGGAGGAGG + Intronic
926948525 2:18215939-18215961 GTGTGTGTGTGTGGTGGGGAGGG - Intronic
927105310 2:19818859-19818881 GTGTGTGGGTGGGGAGTGAAAGG - Intergenic
927291833 2:21412357-21412379 GTGTGTGTGTGGAGGGGGGGTGG - Intergenic
927337108 2:21937849-21937871 GGGGGTGAGGGGCTAGGGGACGG - Intergenic
927436578 2:23071753-23071775 GTCTGTGAGTGGGGTGGGGATGG - Intergenic
927477978 2:23428599-23428621 GTGTGTGTGTGGCGGGGGGTAGG - Intronic
927500074 2:23576841-23576863 GGGTGTGAGTGGTGGTGGGAAGG - Intronic
928455158 2:31414021-31414043 GTGTGTGGGTGGGGAGTGGGGGG + Intronic
928688383 2:33773684-33773706 GTGTGTGGGTGGCGGGGGGTGGG + Intergenic
928887548 2:36167370-36167392 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
929074545 2:38068909-38068931 GTGTGTGTGGGGTGGGGGGATGG - Exonic
929411086 2:41697895-41697917 GTGTGTGAATGATGAAGGGAAGG + Intergenic
929602242 2:43211629-43211651 GTTTGTGAGGGTCCAGGGGATGG - Intergenic
930327502 2:49938630-49938652 CTCTGTGAGTGGTTAGGGGATGG - Intronic
930383711 2:50664429-50664451 GTGTGTGTGTGGCGTGGCGGGGG + Intronic
930586703 2:53275990-53276012 GTGAGTGAGTGGTAAGGAGATGG - Intergenic
930711237 2:54552876-54552898 TAGTGTGAGTCGTGAGGGGAGGG + Intronic
930819349 2:55629847-55629869 GGGAGTGAGTGGCAAGTGGAGGG - Intergenic
930826319 2:55700282-55700304 GAGGGGGAGTGGGGAGGGGAGGG - Intergenic
930873151 2:56186732-56186754 GTCTGTGTGTGGGTAGGGGAGGG + Intronic
931138913 2:59435605-59435627 GTGTGTGTGTGTCGGAGGGAGGG + Intergenic
931753378 2:65350203-65350225 GTTTGTTAGTGGTGGGGGGATGG + Intronic
931980615 2:67690064-67690086 GTGTGTGTGTGGGGTGGGGGTGG + Intergenic
931993422 2:67814544-67814566 GTGTGTGAATGGGGCAGGGAGGG + Intergenic
932030768 2:68182077-68182099 GTGTGTGTGTGGTGGGGGGAGGG - Intronic
932156547 2:69423199-69423221 GTGTGTGTGTGGGGGGGGGCGGG + Intronic
932202318 2:69841599-69841621 ATGTATGTGTGGAGAGGGGAGGG + Intronic
932469213 2:71942984-71943006 GTGTGTGTGTGGTGGGGAGATGG + Intergenic
932522848 2:72431788-72431810 GGGTGTGGGAGGCTAGGGGAGGG - Intronic
932621303 2:73266145-73266167 GTGTGGGTGTGGGGAGGGGCTGG - Intronic
932705438 2:74020934-74020956 ATGAGTGAGTGGGAAGGGGAGGG - Intronic
932911077 2:75806522-75806544 GTGGGTGGGGGGCTAGGGGAGGG + Intergenic
933278379 2:80305696-80305718 GTGTGTGTGTGGGGAGGTGGGGG - Intronic
933679446 2:85086855-85086877 GGGGGTGAGGGGCAAGGGGAGGG - Intergenic
933722945 2:85409869-85409891 GGGTGGGAGTGGCTTGGGGAGGG - Intronic
933776979 2:85776972-85776994 GTGTGTGCGTGTGGAGGGGGTGG - Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934556891 2:95292006-95292028 GTGTGTGTGTGGGGCGGGGGAGG - Intergenic
934906973 2:98213542-98213564 GTGAGTGAGAGGTGAGGAGAAGG + Intronic
934955234 2:98611978-98612000 GTGTGTGTGTGGCGGTGGGGGGG - Intronic
935354061 2:102181776-102181798 GTGTGTGTGTGGGGGGGGGCGGG + Intergenic
935601501 2:104926954-104926976 GGGGGTGAGGGGCTAGGGGAGGG + Intergenic
935685462 2:105678995-105679017 CTGTGTGAGTGCCGTGGGGTGGG + Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935902882 2:107811313-107811335 GTGTTTGAGAGGCCAAGGGAAGG - Intergenic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935919852 2:108001146-108001168 GTGTGTGGGTGGGGGGAGGAGGG - Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936011765 2:108929563-108929585 GCCTGAGAGTGGCGAGGAGAGGG - Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936321099 2:111467751-111467773 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936537746 2:113324996-113325018 GGGGGAGACTGGCGAGGGGAGGG - Intergenic
936701701 2:115018712-115018734 GGGTGTAAGGGGCTAGGGGAGGG + Intronic
936728611 2:115354691-115354713 TTGGGTGGGGGGCGAGGGGAGGG - Intronic
936736970 2:115456811-115456833 GTGGGTGAGGAGCTAGGGGAGGG + Intronic
936960973 2:118074117-118074139 GTGAGTGTGTGGTGAGGGGGTGG + Intergenic
937246138 2:120495198-120495220 GTGTGTGTGTGGGGGGGGGAGGG - Intergenic
937323109 2:120972723-120972745 GTCAGTGAGTGGCGTGGTGAGGG + Intronic
937681961 2:124653914-124653936 GTGTGTGTGTGGCGGGGGGGGGG - Intronic
937863685 2:126732375-126732397 GTGTGTGCGTGGTGATGGGAGGG + Intergenic
937957071 2:127427493-127427515 GAGTGGGAGTGGAGAGGTGAAGG - Intronic
937977387 2:127589888-127589910 GTGTGTGAGTGGATGGGTGAAGG + Intronic
938052478 2:128187245-128187267 ATGTGTGAGTGGCTAATGGAAGG - Intronic
938081651 2:128373450-128373472 GTGTGTGTGTGGGGTGGGGGTGG - Intergenic
938102126 2:128504439-128504461 GTGTGTGGGGGGGGCGGGGAGGG + Intergenic
938230822 2:129657306-129657328 GTGTGTGTGTGGCGGGGGAGGGG - Intergenic
938536742 2:132254137-132254159 GTGTGTGCGTGTCGTGGGGCGGG - Intronic
938566946 2:132527092-132527114 GTGGGTGGGGAGCGAGGGGAAGG - Intronic
938719935 2:134057970-134057992 GTGTGTGTGTGGTGAGGGGATGG - Intergenic
938950772 2:136252337-136252359 GTGTGTGTGTGGGCTGGGGAGGG + Intergenic
939340057 2:140883676-140883698 GTGTGTGTGTGGCGGGGGCGGGG - Intronic
939358041 2:141129565-141129587 GTGTGTGTGGGGGGAGGGGCGGG + Intronic
939478942 2:142723905-142723927 GTGTGTGTGTGGTGATGGAATGG - Intergenic
939704259 2:145432457-145432479 GTGTGTGTGTGTTGGGGGGAGGG - Intergenic
939869987 2:147516182-147516204 GGGTGTGGGGGGCTAGGGGAGGG - Intergenic
939970684 2:148656015-148656037 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
940077492 2:149759393-149759415 GCGGGTGAGGGGCTAGGGGAGGG - Intergenic
940194085 2:151073834-151073856 GGGTGTGGGGGGCAAGGGGAGGG - Intergenic
940897487 2:159094765-159094787 GTGTGTGTGTGGGGGGGGGGTGG + Intronic
941011501 2:160305239-160305261 GTGAGTGAGTGGTGAGTGAATGG - Intronic
941026859 2:160465833-160465855 GTGTGTGTGTGGTGTGGGGAGGG - Intronic
941277146 2:163503690-163503712 GGGTGTGGGGGGCTAGGGGAGGG + Intergenic
941574401 2:167212902-167212924 GTGTGTGTGTGCAGAGGGGTGGG - Intronic
941584968 2:167346736-167346758 GTGTGTGTGTGGGGGGGGGGTGG + Intergenic
942005935 2:171699624-171699646 GTGTGTGTGTGGCGGCGGGCGGG + Intronic
942382543 2:175406930-175406952 GTGTGTGTGTGTTAAGGGGAAGG - Intergenic
942453337 2:176122058-176122080 GTGTGAGTGTGGCAGGGGGAGGG + Intergenic
942490652 2:176486562-176486584 GTGGGTGAGGGGCTAAGGGAGGG - Intergenic
942499872 2:176578288-176578310 GTGGGTGGGCGGAGAGGGGAGGG - Intergenic
942833225 2:180262019-180262041 GTGTGTGTGTGTGGAGGGGTGGG + Intergenic
943098781 2:183461502-183461524 GCGGGTGAGGGGCTAGGGGAGGG - Intergenic
943147142 2:184060268-184060290 GTGGGTGGGAGGCAAGGGGAGGG - Intergenic
943451132 2:188043735-188043757 GGGGGTGAGGGGTGAGGGGAGGG + Intergenic
943492143 2:188567638-188567660 GGGGGTGGGAGGCGAGGGGAGGG + Intronic
943777765 2:191785643-191785665 GGGAGTGAGGGGCTAGGGGAGGG - Intergenic
944583861 2:201156712-201156734 GTGGGGGGGTGGGGAGGGGAAGG - Intronic
944663452 2:201939946-201939968 GAGGGTGAGTGGTGACGGGAGGG + Intergenic
944835686 2:203577150-203577172 GCGGGTGAGGGGTGAGGGGAGGG - Intergenic
944881997 2:204022709-204022731 GTGAGAGGTTGGCGAGGGGATGG - Intergenic
944905331 2:204256452-204256474 GTAGTGGAGTGGCGAGGGGAGGG + Intergenic
945067191 2:205957249-205957271 GTGTGTGTGTGGGGAGGAGTGGG + Intergenic
945626328 2:212211719-212211741 GGGTATGAGTGGGGAGGGGAGGG - Intronic
945775850 2:214104892-214104914 GTGTCTGAAAGGGGAGGGGAAGG + Intronic
945842052 2:214898964-214898986 GTGTGTGGGTGGGTAGGGGAGGG - Intergenic
945888911 2:215407943-215407965 GTGTGTGTGTGGCGGGGGTGGGG - Intronic
946052759 2:216877843-216877865 GTGGGTGAGAGGAGAGGGGAAGG + Intergenic
946119476 2:217497021-217497043 GGGGGTGAGGGGCAAGGGGAGGG + Intronic
946423217 2:219576747-219576769 GTGTGTGTGTGTTTAGGGGAAGG + Intergenic
946620603 2:221558312-221558334 GTGTGTGTGTGGGCAGGGAATGG + Intronic
946976616 2:225160041-225160063 GTGTGTGTGTGTGGAGGGGTGGG - Intergenic
947079340 2:226378478-226378500 GTGAGAAAGTGGGGAGGGGAGGG - Intergenic
947143029 2:227037226-227037248 GTGGGTGAGAGGCTAGGGGAGGG - Intronic
947333449 2:229054710-229054732 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
947390794 2:229637145-229637167 GTGTGTGTGTGTTGAGGGGATGG - Intronic
947391215 2:229641506-229641528 GTGTGTGTGGGGCGGGGGGAGGG - Intronic
947449111 2:230189684-230189706 GGGTGTGGGTGGTGAGGGGAGGG - Intronic
947797309 2:232902528-232902550 GTGTGTGAGTGCCGAGGCTTGGG - Intronic
948264226 2:236625586-236625608 GTGTGTGTGTGGGGGGGGGCGGG + Intergenic
948440819 2:237987248-237987270 GTGTGTGTGTGGGGAAGGGCAGG + Intronic
949039583 2:241841632-241841654 GTGTGTGAGGGGCGAGGCGAGGG + Intergenic
949042521 2:241855857-241855879 GTGTGTGTGTGGAGGTGGGAAGG + Intronic
1168937737 20:1681420-1681442 GTGTGTGTGTGGTGGGGGGCAGG + Intergenic
1168961250 20:1871492-1871514 GTGTGTGTGTGGAGAGGGGGTGG - Intergenic
1169066715 20:2698050-2698072 GTGGGTGGGTGGCGAGAGGGTGG + Intronic
1169086597 20:2829545-2829567 GGAGGTGGGTGGCGAGGGGAAGG + Intergenic
1169289703 20:4338664-4338686 GGGGGTGAGGGGCAAGGGGAGGG - Intergenic
1169343631 20:4813789-4813811 GTGTGTGTGTGTGGAGGGTATGG + Intronic
1169569919 20:6894983-6895005 GTCTGGGGGTGGGGAGGGGAAGG + Intergenic
1169689799 20:8317520-8317542 GTGTGTGTGTGTCGGGGGGATGG - Intronic
1169808368 20:9582681-9582703 GTGTGTGTGTGGTGGGGGTAGGG + Intronic
1170161659 20:13319731-13319753 GTGTGTGTGTGCAGGGGGGAGGG - Intergenic
1170428492 20:16258094-16258116 GTGTGTGTTTGGCATGGGGAAGG - Intergenic
1170428614 20:16258591-16258613 GTGTGTGTTTGGGGATGGGAAGG - Intergenic
1170549396 20:17463655-17463677 GTGTGTGGGGGGTGGGGGGATGG - Intronic
1170731608 20:18980871-18980893 GAGGGTGAGGGGCAAGGGGAGGG - Intergenic
1170747229 20:19111071-19111093 GTGTGTGTGGGGAGGGGGGAGGG + Intergenic
1171034612 20:21705475-21705497 GTGTGTGTGTGTAGAGGGGTGGG + Intergenic
1171767506 20:29298087-29298109 GTGTGTGCGTGTCGTGGGGTGGG - Intergenic
1172215085 20:33230034-33230056 GTGTGTGTGTGGTGGGGTGAGGG - Intergenic
1172330959 20:34075775-34075797 GTGTGTGGCTGGTGAGGGGCTGG - Intronic
1172588728 20:36102874-36102896 GTGGGTCAGTGCCAAGGGGAGGG + Intronic
1172865070 20:38089671-38089693 GTCTGTGCGTGCCGAGGGCATGG - Intronic
1173137432 20:40451619-40451641 GAGGGTGAGGGGTGAGGGGAGGG - Intergenic
1173348421 20:42222415-42222437 GTGTGTTAGGGCCCAGGGGAAGG + Intronic
1173570848 20:44075110-44075132 GAGTGTGAGGGGCCAGGGGCAGG + Intergenic
1173631988 20:44523320-44523342 GTGTATGTGTGGTGAGGAGAGGG - Intergenic
1173653774 20:44684771-44684793 GTGTGTGTGTGGGGGGGGGAGGG + Intergenic
1173857822 20:46262207-46262229 GTGTGTGTGTGTTGAGGGGGTGG + Intronic
1173861597 20:46287477-46287499 GTGTGGGGGTGGCGAGGGCGAGG + Intronic
1174061981 20:47839353-47839375 GTGTGTGAGTGGCCAGAGAGGGG - Intergenic
1174080550 20:47968383-47968405 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1174214363 20:48904686-48904708 GAGAATGAGAGGCGAGGGGATGG + Intergenic
1174306067 20:49615073-49615095 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1174446929 20:50596762-50596784 GATTGTGAGAGGCGAGGAGAAGG + Intronic
1174843220 20:53919216-53919238 GTGTGTGAGGGCGAAGGGGAGGG - Intergenic
1174924498 20:54742760-54742782 GTGTGTGTGTGGGGAGGGGGTGG + Intergenic
1175494032 20:59400781-59400803 GTGTGTGTGTGTGCAGGGGAGGG - Intergenic
1175720474 20:61283629-61283651 GTGTGTGTGTGGTGAGTGGATGG + Intronic
1176002639 20:62839853-62839875 GTGTGTGCGTGGAGGGGAGAAGG - Intronic
1176032409 20:63019210-63019232 GCGGGTGAGTGGCGAGCGGGTGG - Intergenic
1176550466 21:8218788-8218810 GTGCGTGACGGGCGAGGGGGCGG - Intergenic
1176569396 21:8401827-8401849 GTGCGTGACGGGCGAGGGGGCGG - Intergenic
1176577308 21:8446058-8446080 GTGCGTGACGGGCGAGGGGGCGG - Intergenic
1176703558 21:10090018-10090040 GAGGGTGAGGGGCTAGGGGAGGG + Intergenic
1176963024 21:15181012-15181034 GGGTGTCAGGGGCTAGGGGAGGG - Intergenic
1177158930 21:17527310-17527332 GTGTGCTAGTGGAGTGGGGAAGG + Intronic
1177188975 21:17828491-17828513 GTGTGTGAGTGGCCAAAGTATGG + Intergenic
1177384672 21:20393236-20393258 GGGGGTGAGGGGCCAGGGGAGGG - Intergenic
1177515863 21:22150053-22150075 GTGGGTGTGGGGCTAGGGGAGGG + Intergenic
1177572329 21:22903345-22903367 GTGAGTGAGTGGTGAGTGAATGG - Intergenic
1178021844 21:28417253-28417275 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1178194068 21:30322393-30322415 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1178761682 21:35409131-35409153 GTGGGTGAGGGGCTAGGAGAGGG - Intronic
1178837863 21:36113664-36113686 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1178900704 21:36596278-36596300 GTGTGTGATGGGGGTGGGGAGGG - Intergenic
1179141546 21:38730217-38730239 GTCTGTGGGTGGCCAGGGGCTGG - Intergenic
1179371126 21:40806959-40806981 GGGGGTGAGGGGCTAGGGGAGGG + Intronic
1179428659 21:41303875-41303897 GTGTGTGTGTGGCAGGGGGGGGG + Intergenic
1179727805 21:43350170-43350192 GTGTGTGAGAGCAGAGGGGCGGG - Intergenic
1179787048 21:43735883-43735905 GTGTGGCAGGGGCGAGGGAAGGG - Intronic
1180107074 21:45626162-45626184 GGGGGTGGGGGGCGAGGGGAGGG - Intergenic
1180129228 21:45816115-45816137 GTGAGTGAGTGGTGAGTGGTGGG + Intronic
1180256551 21:46633747-46633769 GTGTGTGTGTGTGGTGGGGAGGG + Intergenic
1180971820 22:19819922-19819944 GTGGCTGAGTGGCCAGGGGCGGG - Intronic
1181001721 22:19990875-19990897 GTCTGTGAGTGGGGCGGGCAGGG - Intronic
1181148014 22:20862474-20862496 GTGTGTTAGAGGACAGGGGATGG + Intronic
1181166889 22:20988763-20988785 GAGTGTGAGGGAAGAGGGGAGGG - Intronic
1181503898 22:23337940-23337962 GTGTGGTAGTGGGGATGGGAAGG + Intergenic
1181586788 22:23857064-23857086 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
1181654735 22:24287475-24287497 GTGTGGTAGTGGGGATGGGAAGG + Intronic
1181708887 22:24668160-24668182 GTGTGGTAGTGGGGATGGGAAGG + Intergenic
1181743973 22:24942929-24942951 GTGTGTGTGTTGCTGGGGGAGGG + Intronic
1181766166 22:25093672-25093694 GTGTGTGTGTGTCGGGGGGCAGG - Intronic
1181839478 22:25644071-25644093 GTGAGTGAGTGGCAAGAGAAAGG + Intronic
1182040528 22:27235632-27235654 GGGGGTGAGGGGCTAGGGGAGGG + Intergenic
1182259131 22:29060368-29060390 AAATGTGACTGGCGAGGGGAGGG - Intronic
1182297442 22:29318130-29318152 GTTTTTGGATGGCGAGGGGAAGG + Intronic
1182582098 22:31320325-31320347 GTGTGTCTCTGGGGAGGGGATGG + Intergenic
1182767760 22:32771049-32771071 GGGGGTGAGGGGCAAGGGGAGGG - Intronic
1183015617 22:34984066-34984088 GGGTGTCAGTGGGAAGGGGAGGG - Intergenic
1183018439 22:35008531-35008553 GGGTGTGGCTGGCTAGGGGAAGG - Intergenic
1183262978 22:36807900-36807922 GCGAGTGAGTGGCAAGGGGTGGG + Intronic
1183351843 22:37338924-37338946 GTGTGTGATTGGGGAGGGCCAGG - Intergenic
1183385470 22:37511648-37511670 GGGTGTGAGGGGAGAGGAGAGGG + Intronic
1183758277 22:39790978-39791000 GTGTGTACGTGGCGAGGGCAGGG + Intronic
1183794916 22:40108922-40108944 GGGGGTGGGTGGCGGGGGGAGGG - Intronic
1184035774 22:41917427-41917449 GTGTGTGTGTGGTGGGGGGTGGG - Intergenic
1184039087 22:41932866-41932888 GTGAGTGAGTGGCGAGTGACGGG - Intergenic
1184128856 22:42505343-42505365 GTGCGTGAGAGGTGTGGGGAGGG - Intergenic
1184137651 22:42558658-42558680 GTGCGTGAGAGGTGTGGGGAGGG - Intronic
1184158790 22:42686013-42686035 GGGTGTGAGTGGCCAGGAGAAGG + Intergenic
1184412857 22:44335640-44335662 GTGTGTGAGGTGTGAGTGGATGG + Intergenic
1184700882 22:46171809-46171831 GTGTGTGAAAGGCCATGGGATGG + Intronic
1184858387 22:47158870-47158892 GTGTGTGTGTGGCCTGGGGAGGG - Intronic
1184951616 22:47847069-47847091 GTGAGTGAATGGAGAGTGGATGG + Intergenic
1185099484 22:48830036-48830058 GTGTCTGAGTGTCGAGGCCATGG + Intronic
1185278339 22:49959451-49959473 GTGTGTGAGTGGTCAGCGCAGGG + Intergenic
1185288680 22:50013599-50013621 GTGTGTGTGTGGGGGGGGGATGG + Intergenic
1185414018 22:50699973-50699995 GTATGGGAGAGGGGAGGGGAAGG + Intergenic
1203255363 22_KI270733v1_random:135127-135149 GTGCGTGACGGGCGAGGGGGCGG - Intergenic
949142767 3:654757-654779 GTAGGTGAGGGGCTAGGGGAGGG + Intergenic
949477643 3:4464023-4464045 GAGTGTGTGTGGCAAGGTGAGGG - Intronic
949541029 3:5032149-5032171 GTGTGTGCGTGGGGAAGGCAGGG + Intergenic
950340643 3:12241065-12241087 GTGTGTGTGTGGTGTAGGGATGG + Intergenic
950490346 3:13300809-13300831 GTTTGGGAGTGGGGAAGGGAGGG + Intergenic
950491506 3:13307924-13307946 GTGTGTGAGTGTTGAGGGGAGGG - Intergenic
950675853 3:14554030-14554052 GTGTGTGCATGGGGAGAGGAAGG + Intergenic
950761813 3:15236882-15236904 GTGAGTGAGTGGTGAGTGAATGG + Intronic
950820829 3:15756690-15756712 CTGTGTGTGTGGTGAGGTGAGGG + Intronic
950903584 3:16517631-16517653 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
950916764 3:16653966-16653988 GTGTGTGTGTGGAGAAGGGAGGG - Intronic
950948590 3:16976226-16976248 ATGTGTGTGTGGAGAGGGGTTGG + Intronic
951358626 3:21699338-21699360 GGGGGTGAGGGGCTAGGGGAGGG + Intronic
951588438 3:24238269-24238291 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
951867652 3:27325625-27325647 GAGTGTGAGTGGGGTGGGGTGGG - Intronic
951966455 3:28391342-28391364 GTGTGTGTGTGGCAGGGAGAGGG - Intronic
952020178 3:29009455-29009477 GTGTGTGTGTGTGGAGGGGGAGG + Intergenic
952182325 3:30930779-30930801 GAGGGTGGGTGGCAAGGGGAGGG + Intergenic
952498405 3:33936163-33936185 GTGTGTGTGTGGAGTGGGGGAGG + Intergenic
952643350 3:35625200-35625222 GTGTGTGTGTGGTGGGGGGGGGG - Intergenic
952707264 3:36392032-36392054 GAGTGTTAGAGGGGAGGGGAGGG - Intronic
952870894 3:37900189-37900211 GAGTGTGAGCGGGGAGGGAATGG + Intronic
953151362 3:40328378-40328400 GTGTGTGTGTGGGGGGGGGGCGG - Intergenic
953223360 3:40994818-40994840 GTGAGTGAGTGGTGAGTGAATGG + Intergenic
953370577 3:42384789-42384811 GTGTGTGTGTGATGAGGGTAAGG + Intergenic
953444663 3:42952824-42952846 GTGTGTGTGTGGGGGGGGGGGGG - Intronic
953566528 3:44037013-44037035 GGGTGTGAGTGGGTAGGTGAGGG - Intergenic
954038083 3:47863928-47863950 GTGTGTGTGTGGGGAGTGGTGGG + Intronic
954402977 3:50328824-50328846 GTGTGTGTGTGTTGAAGGGATGG + Intergenic
954535349 3:51355553-51355575 GTGTGTGAAAGGTGAGGGGAAGG - Intronic
954640916 3:52097236-52097258 GTGTGTGTGTGGCGGGGAGAGGG + Intronic
954748127 3:52798524-52798546 GTGTGTGGGTGCCAAGAGGAGGG - Intronic
954758321 3:52855297-52855319 GTGTTGGAGTGGGGAGGGCATGG - Intronic
955109282 3:55931602-55931624 GGGTGTGGGGGGCTAGGGGAGGG + Intronic
955200733 3:56850043-56850065 GTGTGTTACTGGTGAGGGGGTGG - Intronic
955286094 3:57643408-57643430 GTGTGTGTGTTGTGGGGGGAGGG - Intronic
955788123 3:62561134-62561156 GTGTGTGGGGGGTGAGGGGGTGG + Intronic
956018391 3:64908412-64908434 TTGTGTGAGAGGTGAGGGGTGGG + Intergenic
956167720 3:66408952-66408974 GTGTGTGTGTGGTGGGGGGAGGG + Intronic
956245316 3:67176098-67176120 GTGTGTGAGAGGTGGGGGGAGGG + Intergenic
956312523 3:67897028-67897050 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
956570666 3:70690888-70690910 GTGGGTGAGGGGCAAGGGGAGGG - Intergenic
956638441 3:71390563-71390585 GTGTGTGTGTGTGGTGGGGAGGG + Intronic
956673403 3:71712616-71712638 GTGTGTGTGTTGCGGGGGGTGGG + Intronic
957375546 3:79352633-79352655 GAGTGTGAGTAGAAAGGGGAAGG - Intronic
957466502 3:80599579-80599601 GTGGGTGGGGGGCTAGGGGAGGG + Intergenic
957740741 3:84265032-84265054 GGGAGTGAGTGGGGAGGGCAGGG - Intergenic
957969105 3:87360434-87360456 GTGTGTGTGTGGGGCGGGGTGGG + Intergenic
958099270 3:88988476-88988498 GTGGGTGAATGGGGAAGGGATGG - Intergenic
958677409 3:97283606-97283628 GGGGGTGAGGGGCAAGGGGAGGG + Intronic
958725637 3:97902597-97902619 GGGAGTGAGGGGCGAGGGGAAGG - Intronic
959001426 3:100968830-100968852 GTGGGTGGGGGGCTAGGGGAGGG - Intronic
959051380 3:101527934-101527956 GTGTGTGTGTGGGGGGGGGGCGG - Intergenic
959667072 3:108934177-108934199 GGGGGTGGGTGGCAAGGGGAGGG + Intronic
959832167 3:110876865-110876887 GGGGGTGAGGGGCAAGGGGAGGG - Intergenic
959978112 3:112484504-112484526 GTGTTTGTGTGGTCAGGGGATGG - Intronic
960138240 3:114126998-114127020 GTGAGTGAGCGGTGAGTGGATGG + Intergenic
960292005 3:115897147-115897169 GTATGTGTGTGGCAGGGGGAGGG + Intronic
960530734 3:118761364-118761386 TAGTGTGAGTGAAGAGGGGATGG - Intergenic
960745828 3:120887109-120887131 GGGTGTGGGGGGCTAGGGGAGGG + Intergenic
960844983 3:121996842-121996864 CTGTAAGAGTGGAGAGGGGATGG - Intronic
961503235 3:127352117-127352139 TTGTGGGAGTGGCAAGAGGAGGG + Intergenic
961806350 3:129492068-129492090 GTGGGTGATTGGCTAGGGGTGGG - Intronic
961951822 3:130757506-130757528 GTGTGTGTGTGTCGGGGAGAGGG - Intergenic
962136492 3:132739923-132739945 ATGTGTGTGTGGTGAGGGGTTGG + Intergenic
962140122 3:132781388-132781410 GGGGGTGAGGGGCAAGGGGAGGG + Intergenic
962229555 3:133650359-133650381 GTGTGTGGGGGGCGGGGGGAGGG + Intronic
962863640 3:139428034-139428056 GTGTGTGAGAGGAGAGGGGGAGG + Intergenic
962985835 3:140535095-140535117 GTGTGTTGGTGGGGAGGGCATGG - Intronic
963677735 3:148334116-148334138 GTGTTGGGGGGGCGAGGGGAGGG - Intergenic
964143241 3:153427883-153427905 GGGTGTGGGGGGCAAGGGGAAGG - Intergenic
964557355 3:157954165-157954187 GTGTGTGTGTGTGGAGGGGGGGG - Intergenic
964670145 3:159216080-159216102 GTGTGTGTGGGGCGGGGGGTGGG + Intronic
964712663 3:159687741-159687763 GAGAGTGAGGGGCAAGGGGAGGG - Intronic
965211049 3:165790059-165790081 GTGTGTGTGTGAGGGGGGGATGG + Intronic
965285458 3:166813759-166813781 GTGTGTGTGGGGCGGGGGGGGGG - Intergenic
965285460 3:166813761-166813783 GTGTGTGTGTGGGGCGGGGGGGG - Intergenic
965422223 3:168475378-168475400 GTGTGTGGGAGGGGAGGGGGTGG - Intergenic
965465004 3:169018283-169018305 GTGTGTGTGTGGGGTGGGGGTGG - Intergenic
965844732 3:172947778-172947800 GGGAGTGAGGGGCAAGGGGAAGG + Intronic
965890295 3:173505050-173505072 ATGTGTGTGTGGCGGGGGCAAGG - Intronic
966101728 3:176277556-176277578 GGGTGTGAGGGGCAAGGGGAGGG - Intergenic
966206011 3:177407248-177407270 GTTTGTGTGTGGGGTGGGGAGGG + Intergenic
966917985 3:184595127-184595149 GTGTGTGTGTGGTGGGGGAAGGG + Intronic
966962127 3:184950708-184950730 GAGGGTGGGAGGCGAGGGGAGGG - Intronic
967089815 3:186125910-186125932 GTGTGTGTGTGGTGAGGTGGTGG + Intronic
967089845 3:186126130-186126152 GTGTGTGTGTGGTGAGTGGTGGG + Intronic
967089879 3:186126354-186126376 GTGTGTGTGTGGTGAGTGGTGGG + Intronic
967271361 3:187736209-187736231 GTGAGTGAGTGGGGACTGGAGGG + Intronic
967285167 3:187862152-187862174 GGGGGTGAGGGGCTAGGGGAGGG + Intergenic
967390088 3:188947099-188947121 GTGTGGGAGTGGGGTGGGGGTGG + Intergenic
967474221 3:189896796-189896818 GTGTATGAGTAGCCAGGGTAAGG + Exonic
967693153 3:192500438-192500460 GTGTGTGTGTGGCGGGTGGGGGG - Intronic
967802543 3:193679130-193679152 GGGCGTGGGGGGCGAGGGGAGGG + Intronic
967803425 3:193690309-193690331 GTGTGTGTGTGGGGTGGGGTGGG - Intronic
967807625 3:193729624-193729646 ATGTGTTGGTGGGGAGGGGAGGG - Intergenic
967986271 3:195097815-195097837 GTGTGTGCGTGGTGGGGGGGTGG - Intronic
968103927 3:195988178-195988200 GTGTGTGTGTGGTGGGGGGTGGG - Intergenic
968302229 3:197625768-197625790 GTGTGTGTGTGGTGGGGGGTGGG - Intergenic
968367614 3:198199154-198199176 GTATGAGAGTGGGGAGGGAAGGG + Intergenic
968369216 3:198211956-198211978 GTATGAGAGTGGGGAGGGAAGGG + Intergenic
968444349 4:642096-642118 GAATGTGAGTGGTGAGAGGAGGG + Intronic
969115634 4:4869162-4869184 GTGTGTGTGTGGTGGGGGGGAGG + Intergenic
969521048 4:7677939-7677961 GTGGGTGGGTGGTGATGGGATGG + Intronic
969583386 4:8078326-8078348 GTGTGCGTGGGGAGAGGGGATGG - Intronic
970483981 4:16506021-16506043 GTGTGTGTCTGGCGAGGGCTAGG - Intronic
970754893 4:19413881-19413903 GTGTGTGTGTGGCGGGGGGGGGG - Intergenic
970878244 4:20897509-20897531 GAATGTGGGTGGCGGGGGGAGGG - Intronic
970980861 4:22095417-22095439 GTGTGTGGGTGGAGTGGGGTAGG + Intergenic
971185381 4:24370922-24370944 GGGAGTGAGGGGCAAGGGGAGGG - Intergenic
971504887 4:27355707-27355729 GTGTGTGTGTTGCGGGGGGAGGG + Intergenic
971598151 4:28558243-28558265 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
971771920 4:30908099-30908121 GGGGGTGAGGGGCTAGGGGAGGG + Intronic
972380586 4:38516024-38516046 GTGTGTGTGTGGCGGGCGGGGGG - Intergenic
972387057 4:38577389-38577411 GGCTGTGAGTGGAGAGAGGAGGG + Intergenic
972446355 4:39148044-39148066 GTGTGTGTGTGGAGGGGGGGCGG - Intergenic
972660988 4:41116314-41116336 GTGGGTGGGGGGCCAGGGGAGGG + Intronic
972756117 4:42048077-42048099 GGGGGTGGGTGGCTAGGGGAGGG + Intronic
973110351 4:46390199-46390221 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
973570477 4:52233937-52233959 TTGTGTGTGTGGGGGGGGGAGGG + Intergenic
973823581 4:54684167-54684189 GTGTGTGGGTGGGGTGGGGTGGG + Intronic
974717867 4:65694071-65694093 GTGTGTGTATGGGGAGGGGGGGG - Intergenic
974940159 4:68457932-68457954 GTGGGTGGGGGGCTAGGGGAGGG + Intronic
975288806 4:72651961-72651983 GGGGGTGAGGGGCTAGGGGAGGG + Intergenic
975449829 4:74511320-74511342 GGGGGTGAGGGGCTAGGGGAGGG + Intergenic
975625972 4:76347557-76347579 GGGTGTGAGGGGCTAGGGGAGGG + Intronic
975778425 4:77815462-77815484 GGGTGTGAGTGGAGAGTGGTGGG - Intronic
977046569 4:92075671-92075693 GTGTGTGTGTGGTGAGGGAGGGG - Intergenic
977052755 4:92150060-92150082 GGGGGTGAGGGGCTAGGGGAGGG + Intergenic
977116865 4:93039318-93039340 GGGGGTGGGTGGCTAGGGGAGGG + Intronic
977435766 4:96992392-96992414 GTGTGTGGGTGGGTGGGGGAAGG - Intergenic
977572420 4:98643052-98643074 GTGAGTGAGTGGTGAGTGAAAGG - Intronic
978007291 4:103632538-103632560 GTGGGTGGGGGGTGAGGGGAGGG + Intronic
978263580 4:106793986-106794008 GGGGGTGTGTGGAGAGGGGAGGG - Intergenic
978429028 4:108613770-108613792 GTGAGTGAGTGGTGAGTGAATGG - Intergenic
978554893 4:109969453-109969475 GAGGGTGGGTGGCAAGGGGAGGG + Intronic
978606403 4:110484875-110484897 GTGTGTGGGAGGTGAGAGGAAGG - Intronic
978624857 4:110673698-110673720 GTGAGTGAGTGGTGGGGGAATGG - Intergenic
978980396 4:114937879-114937901 GTGTGTGTGTGGCGGGGGGCGGG + Intronic
978989500 4:115061622-115061644 GGGGGTGAGGGGCAAGGGGAGGG + Intronic
979035014 4:115705122-115705144 GGGGGTGGGTGGCAAGGGGAGGG - Intergenic
979256029 4:118608866-118608888 GTATGAGAGTGGGGAGGGAAGGG + Intergenic
979257641 4:118621684-118621706 GTATGAGAGTGGGGAGGGAAGGG + Intergenic
979330706 4:119418878-119418900 GTATGAGAGTGGGGAGGGAAGGG - Intergenic
979332315 4:119431671-119431693 GTATGAGAGTGGGGAGGGAAGGG - Intergenic
979711890 4:123789654-123789676 GTGGGTGGGGGGCAAGGGGAGGG - Intergenic
979780736 4:124648484-124648506 GTGAGTGAGTGGTGAGTGAATGG + Intergenic
979788783 4:124751200-124751222 GGGGGTGAGGGGCAAGGGGAGGG + Intergenic
980102368 4:128554552-128554574 GTGTGTGTGTGTTGAAGGGATGG + Intergenic
980135673 4:128856388-128856410 GAGTGAGAGTCGCGATGGGAAGG - Intronic
980304136 4:131034680-131034702 GTGTGTGTGTGGCCGGGGGTGGG + Intergenic
980375777 4:131946374-131946396 GAGGGTGAGGGGCTAGGGGAGGG + Intergenic
980590144 4:134875900-134875922 GTTTTTGGGTGGGGAGGGGAAGG + Intergenic
980889376 4:138797706-138797728 GTGTGTGAGTGACAGAGGGAGGG + Intergenic
980896998 4:138869158-138869180 GAGGGTGAGGGGAGAGGGGAGGG + Intergenic
980964606 4:139508970-139508992 GTGTGTGTGAGGGGAGGGGTGGG + Exonic
981037067 4:140182825-140182847 GTGAGTGAGTGGTGAGTGAATGG - Intergenic
981924429 4:150122603-150122625 GTGGGTGGGGGGCTAGGGGAGGG + Intronic
982042172 4:151408036-151408058 GTGTTTGAGTCGCGAAGTGATGG - Intergenic
982255024 4:153443211-153443233 TTTTGTGAGTGGGGAGTGGAGGG + Intergenic
982353484 4:154442530-154442552 GTGTGTGTGTGGGGGGGGGGGGG - Intronic
982705116 4:158700545-158700567 GTGTGTGTGTGGTGGGGGGAGGG - Intronic
982739668 4:159044451-159044473 GTGTGATAGTAGGGAGGGGAGGG - Intergenic
982740788 4:159054821-159054843 CTATGTGAGTGGCAAGGGGCAGG - Intergenic
982988412 4:162239495-162239517 GTGGGTGGGGGGCAAGGGGAGGG + Intergenic
983003840 4:162457275-162457297 GTGAGTGAGTGGTGAGTGAATGG + Intergenic
983042515 4:162946715-162946737 GTCTGTGAGTGGTGATGTGAAGG + Intergenic
983059654 4:163143521-163143543 GTATGTGTGTGGAGAGGGGGAGG - Intronic
983462468 4:168045540-168045562 GTGTGTGAGGCACAAGGGGATGG - Intergenic
983524795 4:168749872-168749894 GTCTATGAGAGGAGAGGGGAGGG - Intronic
983938552 4:173519486-173519508 CTGTGTGCGTGGGGAGGGGGCGG - Intergenic
984468835 4:180138764-180138786 GTGTGTGTGTGGGGTGGGGGTGG + Intergenic
984686867 4:182679059-182679081 GGGTGTCAGGGGCTAGGGGAGGG + Intronic
984867309 4:184292720-184292742 GTATGTGTGTGTGGAGGGGAGGG + Intergenic
984867319 4:184292875-184292897 GTGTGTGTGTGTGGAGGGGAGGG + Intergenic
984867327 4:184292993-184293015 GAGTGTGTGTGTGGAGGGGAGGG + Intergenic
985498093 5:221890-221912 GTGTGTGTGTGGTGGGGGGTGGG + Intronic
985516061 5:345248-345270 GTGTGTGTGGGGAGAGGGGTGGG + Intronic
985641345 5:1064814-1064836 GTGAGGGAACGGCGAGGGGACGG + Intronic
985986542 5:3521208-3521230 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
986138029 5:5000898-5000920 GGGGGTGGGTGGCTAGGGGAGGG - Intergenic
986152913 5:5143979-5144001 GGGGGTGAGGGGCAAGGGGAGGG + Intronic
986283092 5:6339366-6339388 GTGTGTGGGTGGGCAGTGGAGGG + Intergenic
986738618 5:10685911-10685933 GTGTGTGTCTGTAGAGGGGAGGG - Intronic
986775947 5:11013888-11013910 GTGAGAGAGGGGAGAGGGGAGGG - Intronic
987095557 5:14546266-14546288 GTGTGTGTGTGGTGGGGGGTGGG + Intergenic
987385438 5:17324810-17324832 GTGTGTGTGTGTGGTGGGGAAGG - Intergenic
987397525 5:17438620-17438642 GCTTGTGGGTGGGGAGGGGATGG + Intergenic
987435786 5:17892595-17892617 GTGTGTGAGGGGAGAGGAAACGG + Intergenic
987553677 5:19416842-19416864 GTGGGTGAGAGGCTAGGGGAGGG + Intergenic
987628502 5:20435126-20435148 GTGTGTGTGTGGTGGGGAGAGGG - Intronic
987683561 5:21167471-21167493 GGGGGTGGGTGGCTAGGGGAGGG + Intergenic
988171307 5:27660172-27660194 GTGGGTGAGGGGCTACGGGAGGG + Intergenic
988443483 5:31258487-31258509 GTGGGTGAGGGGCTAGGGGAGGG + Intronic
988643386 5:33066646-33066668 GTGTGTGTGGGGCGGGGGGGTGG + Intergenic
988659743 5:33252438-33252460 GTGTGTGTGTGGGGTGGGGGGGG - Intergenic
988867931 5:35355579-35355601 GTGTGTGTGTGTAGTGGGGAGGG + Intergenic
989078105 5:37586550-37586572 GTGGGTGGGGGGCTAGGGGAGGG - Intronic
989206637 5:38815749-38815771 GTGTGTGTGTGGTCAGAGGAGGG - Intergenic
989300246 5:39882866-39882888 GTGTGTGTGTGGTGGTGGGAAGG + Intergenic
989630314 5:43475375-43475397 GTGGGTGGGGGGCTAGGGGAGGG + Intronic
989737985 5:44731589-44731611 GGGTGTGGGGGGCAAGGGGAGGG - Intergenic
989809328 5:45653769-45653791 GTGGGTGGGGGGAGAGGGGACGG + Intronic
989818128 5:45761698-45761720 GGGGGTGAGGGGCTAGGGGAGGG - Intergenic
989942123 5:50163947-50163969 TTGGGTGAGTGGAGTGGGGAGGG + Intergenic
990011180 5:51000238-51000260 GTGTGTGATTGGGAATGGGAGGG + Intergenic
990535737 5:56720084-56720106 GAGTGTCAGCTGCGAGGGGAGGG + Intergenic
990630545 5:57664120-57664142 GGGGGTGAGAGGCAAGGGGAGGG - Intergenic
990683135 5:58268554-58268576 GTGAGTGGGTGGGGAGGAGAGGG - Intergenic
991000395 5:61777104-61777126 GTGTGTGTGTGGTTTGGGGAAGG - Intergenic
991038630 5:62153565-62153587 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
991046209 5:62225484-62225506 GGGGGTGGGTGGCTAGGGGAGGG - Intergenic
991110185 5:62891013-62891035 GGGTGTGGGGGGCAAGGGGAGGG - Intergenic
991400790 5:66249363-66249385 GTGAGTGAGTGGCGAGCGAATGG + Intergenic
992365153 5:76083349-76083371 GCGTGTCAGCGGCGAGAGGAGGG - Exonic
992492502 5:77259072-77259094 GTGTGTGTGTGGGGGGGGGGCGG - Intronic
992506877 5:77395735-77395757 GTGTGTGTCTGGTGAGGGGGTGG - Intronic
992527797 5:77629343-77629365 GTGTGAGAGTGTAGAAGGGAAGG - Exonic
992775064 5:80082173-80082195 GTGTGTGTGTGGAGGGGGGTGGG - Intronic
993140057 5:84020610-84020632 GTGTGTGTGTGTCGGCGGGAGGG - Intronic
993374411 5:87133180-87133202 GTGAGTGAGTGGTGAGTGAATGG + Intergenic
993553584 5:89307131-89307153 GAGGGTGGGTGGCTAGGGGAGGG - Intergenic
993833663 5:92789821-92789843 GTGTGTGAAGGGTGAGAGGAGGG - Intergenic
993846244 5:92947395-92947417 GTGTGTGTGTGGGGCGGGGGGGG - Intergenic
994034555 5:95184007-95184029 GGGGGTGAGGGGCTAGGGGAGGG + Intronic
994136366 5:96291874-96291896 GTGTGTGTGTGTGGTGGGGAAGG + Intergenic
994232842 5:97329131-97329153 GGGGGTGGGGGGCGAGGGGAGGG - Intergenic
994382177 5:99084576-99084598 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
994594156 5:101809124-101809146 GGGGGTGAGGGGCAAGGGGAGGG + Intergenic
994595709 5:101831850-101831872 GTGGGTGGGAGGCAAGGGGAGGG - Intergenic
994682060 5:102900245-102900267 GTGTGTGTGTGGGGGGGGGGCGG + Intronic
994886927 5:105576449-105576471 GGGGGTGGGTGGCTAGGGGAGGG - Intergenic
995211435 5:109543974-109543996 GGGTGTGGGGGGCTAGGGGATGG + Intergenic
995311475 5:110717180-110717202 GTGTGTATGTGGCGGGGGGTGGG - Intronic
995423714 5:111995063-111995085 GGGTGTGGGGGGCTAGGGGAGGG + Intronic
995540690 5:113183273-113183295 GTGTTTGTGTGTGGAGGGGAAGG + Intronic
995675756 5:114660551-114660573 GTGTCTGAGAGGCCATGGGATGG - Intergenic
995841597 5:116447522-116447544 GTGCATGAGTGGCGTGAGGATGG + Exonic
996117136 5:119631417-119631439 GTGTGTGTGTTGGGAGGGGGAGG + Intronic
996198889 5:120645380-120645402 GTGTGTGTGTGGGGGGGGGATGG - Intronic
996360622 5:122641445-122641467 ATGTGTGTGTGGGGAGGGGAGGG - Intergenic
996677839 5:126197038-126197060 GTGGGTGGGGGGCTAGGGGAGGG - Intergenic
996690743 5:126337289-126337311 GTGTGGAGTTGGCGAGGGGAAGG + Intergenic
996772123 5:127097004-127097026 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
996882897 5:128321435-128321457 GAGGGTGAGGGGCTAGGGGAGGG - Intronic
997096448 5:130918631-130918653 GTGGGTGAGGGGCTGGGGGAGGG + Intergenic
997652590 5:135533618-135533640 GTGTGTGTGTGTTGGGGGGATGG + Intergenic
997884062 5:137615157-137615179 CTATGTGACTGGCGAGGAGATGG - Intergenic
998017330 5:138742880-138742902 GTATGTAAGTGTCGTGGGGATGG - Intronic
998050371 5:139027621-139027643 ATATGTGAGTGGAGTGGGGAAGG - Intronic
998170729 5:139870772-139870794 GTGAGTGTGTGAGGAGGGGAGGG - Intronic
998394201 5:141807780-141807802 GTGTGTGTGTGGGGGGGGGGTGG - Intergenic
998405236 5:141870520-141870542 GTGGGGGAGTGGCCAGGGAAAGG - Intronic
998662025 5:144249417-144249439 TTGTGGGAGAGGGGAGGGGAAGG - Intronic
999195347 5:149778000-149778022 GTGTGTCTGTGGGGGGGGGAAGG - Intronic
999442453 5:151612982-151613004 GTGTGTGTGTGGTGGGGGGGTGG + Intergenic
999574316 5:152957840-152957862 GTGGGTGAGTGGGGTGGGGTGGG + Intergenic
999664166 5:153895390-153895412 GTGTGTGTGTTGCGGGGGTAAGG - Intergenic
999943070 5:156565687-156565709 GTGGGTGGGGGGCTAGGGGAGGG - Intronic
1000067187 5:157704660-157704682 GTGTGTGTGTGTGGTGGGGAAGG + Intergenic
1000102674 5:158031782-158031804 GGGGGTGAGGGGCAAGGGGAGGG - Intergenic
1000150302 5:158494040-158494062 GGGGGTGAGTGGCTAAGGGAGGG - Intergenic
1000373695 5:160560312-160560334 GTGTGTGTGAGGGAAGGGGAGGG + Intergenic
1000579576 5:163018698-163018720 GTGGGTGGGGGGCAAGGGGAGGG + Intergenic
1000714561 5:164624517-164624539 GTGTGTGTGTGGAGAGGTGTTGG - Intergenic
1000983788 5:167845228-167845250 GTGTGTGTGTGGCGCGGGAGGGG - Intronic
1001051192 5:168415789-168415811 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
1001229603 5:169974834-169974856 ATGTGTGTGTGTCGGGGGGAGGG - Intronic
1001230007 5:169978383-169978405 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
1001295752 5:170497766-170497788 GTGTGTGTGTGGTGAGGCGGGGG - Intronic
1001322376 5:170693248-170693270 ATGTGTGTGTGTCGGGGGGATGG - Intronic
1001332580 5:170772699-170772721 GTGTGTGATGGGTGTGGGGAAGG + Intronic
1001332602 5:170772780-170772802 GTGTGTGCATGTGGAGGGGAAGG + Intronic
1001332662 5:170773193-170773215 GTGAGGGGGTGGCGAGGAGATGG + Intronic
1001400856 5:171445720-171445742 GGGTGAGAGTGGCAAGGGGAAGG + Intronic
1001476605 5:172055027-172055049 GTGTGGGAGTGCGGAAGGGAAGG + Intronic
1001523263 5:172410525-172410547 GGTTGTGAGTGGCGAGGACAAGG + Intronic
1001672508 5:173485915-173485937 GGGGGTGAGGGGCTAGGGGAGGG - Intergenic
1001930852 5:175672054-175672076 GTGTGTGTGTGGAGGGGTGAAGG - Intronic
1001966951 5:175916882-175916904 GGGGGTGAGGGGCCAGGGGAGGG - Intergenic
1002249991 5:177922331-177922353 GGGGGTGAGGGGCCAGGGGAGGG + Intergenic
1002475387 5:179462185-179462207 GTGTGGGCGTGGTGGGGGGAGGG - Intergenic
1002726837 5:181304383-181304405 GTATGAGAGTGGGGAGGGAAGGG + Intergenic
1002728494 5:181317541-181317563 GTATGAGAGTGGGGAGGGAAGGG + Intergenic
1002853286 6:1015603-1015625 GGGGGTGAGGGGTGAGGGGAGGG + Intergenic
1002866698 6:1128134-1128156 GTGTGTGTGTGGTTTGGGGATGG + Intergenic
1002913896 6:1513339-1513361 CTGTGTCAGTGGGGAGGGGTTGG - Intergenic
1002923664 6:1592305-1592327 GTGTGTGTGTGGAGAGGGGTAGG - Intergenic
1003612106 6:7622942-7622964 GTGTGTGAGTGGGTTGGGGTGGG + Intergenic
1003963147 6:11228060-11228082 GTGTGTGGGAGGCAAGGGGGCGG + Intronic
1004020850 6:11774626-11774648 GGGTGTCAGGGGCGTGGGGAGGG + Intronic
1004049736 6:12064733-12064755 GTGTGTGTACGGCGTGGGGAGGG - Intronic
1004050144 6:12069374-12069396 GTGAGTGGGTGGTGAGTGGATGG + Intronic
1004193637 6:13486244-13486266 GTGTGTGTGGGGGGGGGGGATGG - Intronic
1004313096 6:14563259-14563281 ATGTGTGTGTGGAGTGGGGAAGG + Intergenic
1004352405 6:14901809-14901831 GTGGGTGAGGAGCTAGGGGAGGG + Intergenic
1004393373 6:15227622-15227644 GGGAGTGGGGGGCGAGGGGAGGG + Intergenic
1004535897 6:16501465-16501487 GTGAGTGGGGGGCAAGGGGAGGG - Intronic
1004578518 6:16923970-16923992 GTGAGTGAGTGGTGAGTGAATGG + Intergenic
1004720687 6:18265188-18265210 GTGTGAGAGAGGAGAGGAGAAGG - Intergenic
1005234899 6:23748333-23748355 GGGGGTGAGGGGCAAGGGGAGGG + Intergenic
1005258837 6:24034948-24034970 GTGTGTGTGTGTGGAGGGGACGG + Intergenic
1005364138 6:25060505-25060527 GTGTGTGTGTGGAAAGGGGAGGG + Intergenic
1005511617 6:26516935-26516957 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1005771499 6:29077458-29077480 GTCTGGGGGTGGAGAGGGGAGGG - Intergenic
1005882647 6:30072653-30072675 GTGTGTGTGTGGAGTGGGGGAGG - Intronic
1005995438 6:30928263-30928285 GTGTTTGTGTGGCGGGGGGCAGG + Intergenic
1006020482 6:31114920-31114942 GAGTTTGGGTGGGGAGGGGAGGG + Intronic
1006200502 6:32284642-32284664 GGGTGTGAGGGGCAAGAGGAGGG + Intergenic
1006452742 6:34114565-34114587 GAGGGTGAGTGGAGAGGGGCTGG - Intronic
1006653901 6:35573847-35573869 AAGTGTGTGTGGGGAGGGGAAGG - Exonic
1006804172 6:36777755-36777777 GTGTGTGTGTGGTGGGGGGGGGG - Intronic
1006917361 6:37603145-37603167 GTGTGTGTGTGGAGGGGGGGCGG + Intergenic
1007098811 6:39230607-39230629 GTGTGTGTGTGGCGGGGAGAGGG - Intergenic
1007123198 6:39400628-39400650 GTGAGTGTGTGGCAAGGAGAGGG + Intronic
1007210174 6:40187386-40187408 GTGTGTGTGTGGCGGGGTGAGGG + Intergenic
1007362839 6:41371257-41371279 GTGTGTGTGTGGGGGGGGGGTGG - Intergenic
1007380759 6:41488755-41488777 GTGTGTCAGTGGGGAGCAGATGG + Intergenic
1007649656 6:43411178-43411200 GGGGGTGAGGGGCAAGGGGAGGG + Intergenic
1007652120 6:43429400-43429422 GTGTGTGTGTGGCGGGGGGGAGG + Intronic
1007724476 6:43906748-43906770 GTGTGTGGGAGGCGGGGGGCAGG + Intergenic
1007779772 6:44246247-44246269 TTGTGTGATTGACGCGGGGAAGG + Intronic
1007783715 6:44268580-44268602 GTGTGTGAATGGAGAAGGCAGGG + Intergenic
1008224235 6:48892898-48892920 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1008396726 6:51017300-51017322 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1008424671 6:51343421-51343443 GTGTGTGGGGGGCTAGAGGAGGG - Intergenic
1008838672 6:55869956-55869978 GTGTGGGAGTGGTAAGGAGAGGG + Intronic
1009711343 6:67325504-67325526 GTGTGTGTGTGGGGTGGGGGGGG + Intergenic
1009823930 6:68841879-68841901 GTGTGTGTGTGGCAAGGAGTGGG + Intronic
1009944791 6:70330777-70330799 GGGAGTGAGGGGCTAGGGGAGGG - Intergenic
1009958946 6:70495778-70495800 GGGGGTGAGGGGCTAGGGGAAGG - Intronic
1010095955 6:72046280-72046302 GTGTGTGTGTGGAAAGGGGTTGG + Intronic
1010922666 6:81703636-81703658 GAGTGGGAGTGGTGAGGGGGTGG - Intronic
1011339140 6:86293293-86293315 GGGTGTGGGGGGCTAGGGGAGGG - Intergenic
1011713862 6:90084093-90084115 GTGTGTGGGAGGGAAGGGGAGGG + Intronic
1011833326 6:91401067-91401089 GTGGGAGAGGGGAGAGGGGAGGG - Intergenic
1011842251 6:91516280-91516302 ATGTGTGTGTGTTGAGGGGAGGG + Intergenic
1011891085 6:92160512-92160534 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1012127762 6:95452917-95452939 GAGGGTGAGAGGCAAGGGGAGGG - Intergenic
1012428382 6:99139809-99139831 GTGTGAGAGAGGCGGGGGGGCGG - Intergenic
1012541118 6:100363046-100363068 GTGTGTGTGGGGAGAGGGGCAGG - Intergenic
1012627727 6:101424708-101424730 GTGGGTGGGGGGAGAGGGGAGGG - Intronic
1012674405 6:102097553-102097575 GGGGGTGGGTGGCTAGGGGAGGG - Intergenic
1012756306 6:103235810-103235832 GTGGGTGGGGGGCTAGGGGAGGG + Intergenic
1013232487 6:108170087-108170109 GTGAGGGCGTGGCGCGGGGAGGG - Intronic
1013244663 6:108275080-108275102 GTGTGTGTGTGGCAGGGGGTGGG + Intergenic
1013637895 6:112046665-112046687 GTGAGTGAGTGGTGAGTGAATGG - Intergenic
1013651632 6:112200882-112200904 GTGGGTGGGGGGCAAGGGGAGGG + Intronic
1013677671 6:112484246-112484268 GTGTGTGTGTGTCGCGGGGGCGG + Intergenic
1013758431 6:113487605-113487627 GTGTGTGTGTGTGGAGGGGGTGG - Intergenic
1013759762 6:113503578-113503600 GTGTGTGAGTTGAAGGGGGAGGG + Intergenic
1014193013 6:118519572-118519594 GTGTGTGTGTGGCGGGGGGGGGG + Intronic
1014244554 6:119053675-119053697 GTGTGTGGGTGGCCATAGGATGG - Intronic
1014347517 6:120292866-120292888 GGGTGTGAGGGTCTAGGGGAGGG - Intergenic
1014352959 6:120366722-120366744 GTGGGTGGGGGGCTAGGGGAGGG + Intergenic
1014384949 6:120788668-120788690 GTGTGTGTGTGGGCAGGAGAGGG - Intergenic
1014582336 6:123154292-123154314 GGGGGTGAGGGGTGAGGGGAGGG - Intergenic
1014911925 6:127104855-127104877 GTGTGTGTGTGTGGTGGGGAGGG - Intergenic
1015219480 6:130787833-130787855 GTGTGAGAGTAACCAGGGGAAGG - Intergenic
1015230641 6:130911369-130911391 GGGTGTGGGGGGCTAGGGGAGGG + Intronic
1015583030 6:134747171-134747193 GGGGGTGAGGGGCTAGGGGAAGG - Intergenic
1015847146 6:137532497-137532519 GTGTGTGTGTGGCGGGGGTAGGG + Intergenic
1015988188 6:138907328-138907350 GTGTGTGTGTGTGGCGGGGAGGG + Intronic
1016068354 6:139707591-139707613 GTGTGTGGGTTGCGGGGGGAGGG + Intergenic
1016581455 6:145633153-145633175 GTGTGTGGGTTGGGATGGGATGG + Intronic
1016717919 6:147255306-147255328 GAGGGTGAGAGGCTAGGGGAGGG + Intronic
1016730744 6:147425052-147425074 GGGGGTGAGGGGCAAGGGGAGGG - Intergenic
1017022877 6:150154738-150154760 TTGTGTGAGTGGCTTGGGTAGGG + Intronic
1017048994 6:150372758-150372780 GTGTGTGGGTGGGGTGGGGGTGG + Intronic
1017286264 6:152680157-152680179 GTGTGTGAGGGGAGGGGAGATGG - Intergenic
1017705983 6:157123236-157123258 GTGTGTGTGTGGGGGGGGGGCGG - Intronic
1018093915 6:160368133-160368155 GGGTATGAGTGGGGAGGGGCAGG - Intronic
1018339055 6:162830334-162830356 GTGGGTGAGTGGGTAGGGGCAGG - Intronic
1018397203 6:163387609-163387631 GTGTGTGTGTGGAGCGGGAAGGG - Intergenic
1018619426 6:165715659-165715681 GTGTGTGAGGGGCTAGTGCATGG + Intronic
1018832728 6:167457379-167457401 GTGTGAGAGTGGAGAGAGCAGGG - Intergenic
1019036754 6:169067315-169067337 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1019215299 6:170439175-170439197 GTGGGTGAGTGCTGAGGGAAAGG - Intergenic
1019307745 7:343940-343962 GGGTGTGACTGGGCAGGGGAGGG + Intergenic
1019368154 7:645844-645866 GGGTCTGACTGGCGAGTGGACGG - Intronic
1019463237 7:1172561-1172583 CTGAGTGAGTGGGGAGGGGCTGG - Intergenic
1019472827 7:1230253-1230275 GTGGGGGAGGGGCGCGGGGAAGG + Intergenic
1019475956 7:1244312-1244334 ATGTGTGAGTTGGGAGGGGCGGG + Intergenic
1019486962 7:1293743-1293765 CTGAGTGAGTGGGGAAGGGAGGG + Intergenic
1020082942 7:5296387-5296409 GTGTGTGAGCGGCGTCGGGGTGG + Intronic
1020154498 7:5711387-5711409 GTGTGTGTGTGGGGAGGGAGGGG + Intronic
1020579902 7:9983941-9983963 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1020631269 7:10643093-10643115 GTGTGTGTGTGTAGAGGGGGTGG - Intergenic
1020873577 7:13665850-13665872 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1020877674 7:13718511-13718533 GTGTGTGTGTGGTGGGGAGAAGG + Intergenic
1020899176 7:13982614-13982636 GTGTGTGGGCGGGGAGAGGATGG - Intronic
1021213293 7:17883702-17883724 GGGGGTGAGGGGCAAGGGGAGGG - Intronic
1021652082 7:22842234-22842256 GTATGTGTGTGGCGGGGGGAGGG - Intergenic
1021905163 7:25326263-25326285 GTGTGTGTGTGTTGAGGGGGAGG + Intergenic
1022504143 7:30900152-30900174 GCTTGTGAGGGGTGAGGGGAGGG - Intergenic
1022514452 7:30966388-30966410 GTGTGTGTGTGGGGTGGGGGTGG + Intronic
1022792693 7:33704635-33704657 GTGTGTGCACAGCGAGGGGAGGG - Intergenic
1022812731 7:33885557-33885579 GTGTGTGTTTGGTGGGGGGATGG - Intergenic
1023099656 7:36703535-36703557 GTGGGTGGGAGGCAAGGGGAGGG - Intronic
1023259268 7:38341808-38341830 GTGTGTGTGTGGCGGGGGGCGGG + Intergenic
1023398158 7:39771234-39771256 GTATGAGAGTGGGGAGGGAAAGG + Intergenic
1023806027 7:43873494-43873516 GTGTGTATGTGGCGGGGCGAGGG + Intronic
1023826760 7:44014953-44014975 GTGTGTGTGTGGCGGGGGTAGGG - Intergenic
1024020334 7:45362560-45362582 GGGTGGGAGTGGGGATGGGAAGG + Intergenic
1024343886 7:48293193-48293215 GTGTGTGTGTGGCGGGGGGGGGG - Intronic
1024650771 7:51401435-51401457 GTATGAGAGTGGGGAGGGAAGGG - Intergenic
1024698397 7:51880595-51880617 GTGGGTGGGGGGCTAGGGGAGGG - Intergenic
1024885251 7:54134892-54134914 GAGGGTGGGGGGCGAGGGGAGGG - Intergenic
1024914483 7:54484149-54484171 GTGTCTGAGTGGACAGGGAAGGG - Intergenic
1024967411 7:55036262-55036284 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
1024977739 7:55129566-55129588 GGGTGGGAGTGGTGAGGGTAGGG + Intronic
1025054892 7:55757015-55757037 GTATGAGAGTGGGGAGGGAAGGG - Intergenic
1025132965 7:56387241-56387263 GTATGAGAGTGGGGAGGGAAGGG - Intergenic
1025218803 7:57086355-57086377 GTGTGTGGGGGGGCAGGGGATGG - Intergenic
1025652546 7:63484084-63484106 GTGTGTGGGGGGGCAGGGGATGG + Intergenic
1025911026 7:65828825-65828847 GTATGAGAGTGGGGAGGGAAGGG + Intergenic
1026119565 7:67524967-67524989 GTGTGTTAGAGGTGAGGGTAAGG + Intergenic
1026560100 7:71441627-71441649 GTAGGTGAGGGGCGAAGGGAGGG - Intronic
1026796472 7:73369112-73369134 GTGTGTGTGTGAAGAGGGGATGG - Intergenic
1026869106 7:73840123-73840145 GTGTGTGTGTGGGGGGGGGTGGG + Intronic
1027137859 7:75637981-75638003 GTGTGTGTGTGGGGGGGGGGGGG - Intronic
1027218839 7:76201690-76201712 GGAGGTGAGGGGCGAGGGGAAGG + Intergenic
1027236976 7:76303889-76303911 GTGGGTGGGTGGCGTGGGGGTGG + Intronic
1027300874 7:76833386-76833408 GTGGGTGGGAGGCTAGGGGAGGG - Intergenic
1027497836 7:78910135-78910157 TGGGGTGGGTGGCGAGGGGAGGG + Intronic
1027557385 7:79682792-79682814 GTGTGTGTGTGGTGTGTGGAAGG + Intergenic
1027774802 7:82450877-82450899 TTGTATGTGTGGCGGGGGGAGGG + Intergenic
1027828085 7:83142035-83142057 GTGTGTGTGTGTCGGGGGGAGGG - Intronic
1027874520 7:83751342-83751364 GTGTGTGGGAGGTAAGGGGAGGG + Intergenic
1027943483 7:84715518-84715540 GTGTGTGTGTGGCGGGTGGGGGG + Intergenic
1028080841 7:86573172-86573194 GTGGGTGGGGGGCTAGGGGAGGG + Intergenic
1028091692 7:86710554-86710576 GTGTGTGTGTGGTGGGGGGTGGG + Intronic
1028236634 7:88370938-88370960 GTGGGTGAGTGGCTGAGGGAGGG - Intergenic
1028487926 7:91380283-91380305 GTGTGTGTGTGTTGGGGGGAGGG - Intergenic
1028644704 7:93082363-93082385 GTTGGAGAGGGGCGAGGGGAGGG + Intergenic
1028740720 7:94271263-94271285 GTGGGTGAGGGGAGAGGGGAGGG + Intergenic
1029087602 7:98023436-98023458 GTGTGTGTGTGGCGGGGGTTGGG + Intergenic
1029538028 7:101167120-101167142 GTGTGTGTGTAGGGAGGGGGAGG - Intergenic
1029699266 7:102235769-102235791 GTGTGTGTGTGTGGCGGGGACGG - Intronic
1029737916 7:102474704-102474726 GTGTGTGTGTGGCGGGGATAGGG - Intronic
1029755048 7:102568354-102568376 GTGTGTGTGTGGCGGGGATAGGG - Intronic
1029772998 7:102667434-102667456 GTGTGTGTGTGGCGGGGATAGGG - Intronic
1029974607 7:104821214-104821236 GTCTATGAGTGGCGAGGACATGG + Intronic
1030377246 7:108767903-108767925 GTGGGTGGGGGGCAAGGGGAGGG - Intergenic
1030384098 7:108847493-108847515 GGGGATGAGTGGGGAGGGGAGGG - Intergenic
1030655453 7:112162540-112162562 GTGTGTGGGTGGCAGGGAGAGGG - Intronic
1030940007 7:115634207-115634229 GGGGGTGAGGGGCTAGGGGAGGG + Intergenic
1031134485 7:117871835-117871857 GTGTGTGTGTGTGAAGGGGAAGG - Intronic
1031212735 7:118851281-118851303 GTGGGTGAGTGGCTAGAGAAGGG + Intergenic
1031409965 7:121429884-121429906 TTGTGTGTGTGGGGGGGGGAGGG - Intergenic
1031551890 7:123124697-123124719 GTGTGTGTGTGTTGAGAGGATGG + Intronic
1031587690 7:123552486-123552508 GTGGGTGGGGGGCCAGGGGAGGG + Intronic
1031785077 7:126019813-126019835 GTGTGTGTGGTGGGAGGGGATGG - Intergenic
1032048347 7:128629602-128629624 GTATGAGAGTGGGGAGGGAAGGG + Intergenic
1032049948 7:128642425-128642447 GTATGAGAGTGGGGAGGGAAGGG + Intergenic
1032408721 7:131676857-131676879 GTGGGTGAGGGGCTAGGGGAGGG - Intergenic
1032888963 7:136172780-136172802 GAGGGTGAGGGGCAAGGGGAGGG + Intergenic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033027386 7:137788684-137788706 GTGTGTGTATGGCAGGGGGATGG - Intronic
1033480110 7:141731401-141731423 GTGTGTGTGTGTTGAGGGGGAGG - Intergenic
1033491566 7:141848485-141848507 GTGTGTGTGTGTTGCGGGGAGGG + Intergenic
1033600813 7:142887201-142887223 GTGTGTGTGTGGCGTGTGTATGG + Intergenic
1034273178 7:149812988-149813010 GTGGGGGAGTGGCGGGGGGTGGG + Intergenic
1034416373 7:150966378-150966400 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
1034535851 7:151725218-151725240 GTGTGTGGGTGGCGGGTGGCAGG - Intronic
1035122475 7:156579748-156579770 GTCTGTGAGTGGTGGGGGGAGGG + Intergenic
1035189696 7:157155178-157155200 GTGTGTGCGTGTGGAGGGGGTGG - Intronic
1035231640 7:157469256-157469278 GTGTGTGAGTGGCCAGGCCGAGG - Intergenic
1035283219 7:157790307-157790329 GTGTGTGTGTGGTGCGGGGGTGG + Intronic
1035288194 7:157819550-157819572 GTGTGTGCTTGGGGCGGGGAGGG - Intronic
1035291217 7:157840540-157840562 GTGTGGGAGTGGAGAGGGTACGG + Intronic
1035303547 7:157915451-157915473 GTGTGTGTGTGTGGCGGGGAAGG - Intronic
1035449673 7:158968571-158968593 GTGCGTAAGAGGAGAGGGGAGGG + Intergenic
1035602115 8:902871-902893 GTGTGTGGGTGGGCAGGGGTGGG + Intergenic
1035602167 8:902999-903021 GTGTGTGGGTGGGCAGGGGTGGG + Intergenic
1035614044 8:989262-989284 GTGGGTGAGTGAAGTGGGGAGGG - Intergenic
1035650583 8:1261004-1261026 GTGTGACAGTGGCGTGAGGAGGG + Intergenic
1036273169 8:7325883-7325905 GTGTGTGTGTGGCGGGGGGTGGG - Intergenic
1036348181 8:7984467-7984489 GTGTGTGTGTGGCGGGGGGGGGG + Intergenic
1036430482 8:8685277-8685299 GTGTGTGAATGGCGAGGCCAGGG - Intergenic
1036509483 8:9387200-9387222 GCGAGTGAGTGCAGAGGGGAGGG + Intergenic
1037110547 8:15159748-15159770 GTGTGTGTGTGGCGGGGGTGGGG - Intronic
1037118820 8:15258396-15258418 GGGGGAGAGAGGCGAGGGGAGGG - Intergenic
1037548528 8:19947657-19947679 GTGTGTGTGGGGCGGGGGGGGGG - Intronic
1037548530 8:19947659-19947681 GTGTGTGTGTGGGGCGGGGGGGG - Intronic
1037585133 8:20270833-20270855 TTGTGTGTGTGGAGAGGGAAGGG + Intronic
1037634972 8:20693353-20693375 GTGTGTAAGTGGCCTGGGGGAGG + Intergenic
1037659520 8:20914983-20915005 GTTTGTGTGTGGAGAGAGGAGGG - Intergenic
1037670726 8:21013138-21013160 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1037767414 8:21780668-21780690 GTCTTAGAGTGGAGAGGGGAGGG - Intronic
1038100838 8:24372670-24372692 GGGGGTGGGGGGCGAGGGGAAGG + Intergenic
1038183044 8:25246746-25246768 GTGTGTGTGTGGCGGGGGCGGGG + Intronic
1038212240 8:25529575-25529597 GGGGGTGAGGGGCTAGGGGAGGG + Intergenic
1038268645 8:26056824-26056846 GGGGGTGGGTGGCTAGGGGAGGG - Intergenic
1038403844 8:27307335-27307357 GTGTGTGTGTGGCGGGGGTGTGG - Intronic
1038533824 8:28339590-28339612 GTGTGTGTGTGGAGTGGGGAGGG - Intronic
1038540536 8:28386480-28386502 GTGTGTGTGTGTGGAGGGGGGGG - Intronic
1038650824 8:29401779-29401801 CTGTGTGTGTGGCGGGGGGGCGG - Intergenic
1039287781 8:36061365-36061387 TTGTGTGTGTGGGCAGGGGATGG + Intergenic
1039457470 8:37717050-37717072 GTGTGTGGGGGGCGGGGGGGTGG + Intergenic
1039802320 8:40969833-40969855 GGGAGTGAGGGGCAAGGGGAGGG + Intergenic
1039803753 8:40981764-40981786 GTGGGTGAGTAGGGAGGGGAAGG + Intergenic
1039925827 8:41931568-41931590 GTGTGTGTGTGAGGAGTGGAGGG + Exonic
1040109385 8:43560117-43560139 TTGTGTGAATGGTGAGTGGATGG - Intergenic
1040471089 8:47736768-47736790 GTGTGGGGGGGGCGGGGGGATGG - Intergenic
1040516123 8:48136532-48136554 ATGTCTGAGGGGCAAGGGGAGGG - Intergenic
1041219263 8:55632872-55632894 GTTGGAGAGTGGGGAGGGGAGGG - Intergenic
1041330964 8:56724566-56724588 GTGTGTGAGTGTTTAGGGGGCGG - Intergenic
1041500170 8:58531684-58531706 GTGGGTGAGGGGCAAGGGGAGGG + Intergenic
1041575271 8:59386946-59386968 GGGGGTGAGGGGCTAGGGGAGGG + Intergenic
1041708959 8:60875974-60875996 TTGTGTGAGGGCCCAGGGGAGGG - Intergenic
1041750507 8:61255486-61255508 ATGTGTGTGTGGAGAGGTGAAGG + Intronic
1041837892 8:62237665-62237687 GGGTGTGGGGGGCTAGGGGATGG - Intergenic
1041930042 8:63276727-63276749 GAGTGCAAGTGGGGAGGGGATGG - Intergenic
1042164044 8:65928015-65928037 GTGAGTGAGTGGTGAGTGAATGG + Intergenic
1042594609 8:70433530-70433552 GAGTGTGAGTGGTGATGGAATGG + Intergenic
1042662592 8:71171873-71171895 GTGTGTGTGTGTTGTGGGGATGG - Intergenic
1042910532 8:73821510-73821532 GTGTGTGTGTGGTGGGGGGGTGG + Intronic
1043157323 8:76800070-76800092 GTGTGTGTGTGTTGTGGGGAGGG + Intronic
1043165318 8:76896239-76896261 GGGTGTGAGGGGCTGGGGGAGGG - Intergenic
1043725079 8:83601309-83601331 GTGTGTGTGTGGTCGGGGGAGGG + Intergenic
1043792483 8:84490111-84490133 GTGTGTGTGTTGAGTGGGGAGGG + Intronic
1044341466 8:91050747-91050769 ACGTGTGAATGGCAAGGGGAGGG - Intergenic
1044514972 8:93127188-93127210 GTGGGTGAGTGGAGAGTGAATGG + Intergenic
1044646492 8:94449189-94449211 GTGTGTGTGTGGTGGGGGGCGGG - Intronic
1045319389 8:101070204-101070226 GTGTGGGAGTGGGGCAGGGAGGG + Intergenic
1045430318 8:102107927-102107949 GTGTGGGTGGGGTGAGGGGAAGG - Intronic
1045536996 8:103039718-103039740 CTGTGTGTGTGGGAAGGGGAAGG + Intronic
1045594532 8:103636789-103636811 GTGTGTGTGTGGGGGGGGGGGGG - Intronic
1045683407 8:104686837-104686859 GTGTGTGTGTGTCGTGGGGGTGG + Intronic
1045737974 8:105318698-105318720 GTGTGACAGTGAGGAGGGGAGGG - Exonic
1045739143 8:105334150-105334172 GTGTGTGTGTGGTGGGGGGAGGG + Intronic
1045788055 8:105946887-105946909 GTGTGTGTGTGGCGGGGGGTTGG - Intergenic
1046148670 8:110194845-110194867 GTGGGTGGGAGGCTAGGGGAGGG - Intergenic
1046217557 8:111169278-111169300 GTGTGTGACTGTCAAGGTGAGGG + Intergenic
1046291230 8:112164582-112164604 GGGTGTGGGGGGCAAGGGGAGGG - Intergenic
1046432784 8:114151094-114151116 GGGAGTGTGGGGCGAGGGGAGGG - Intergenic
1046498287 8:115042817-115042839 GGGGGTGGGTGGCTAGGGGAGGG - Intergenic
1046605694 8:116369247-116369269 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1046707492 8:117471369-117471391 GTGTGTGTGTGGAGTGGGGTGGG - Intergenic
1046739821 8:117816006-117816028 GTGTGTGTGTGGGGTGGGGAGGG + Intronic
1046779851 8:118203396-118203418 GTGTGTGTGTGTCGAGGGAGAGG + Intronic
1046862724 8:119112190-119112212 GTGGGTGGGGGGCTAGGGGAGGG + Intergenic
1046890357 8:119415853-119415875 GTGTGTGTGTGTTGGGGGGAGGG - Intergenic
1047054655 8:121150700-121150722 GTGGGTGGGGGGCAAGGGGAGGG + Intergenic
1047086871 8:121527371-121527393 GTGAGTGGGGGGCTAGGGGAGGG - Intergenic
1047097860 8:121642857-121642879 GTGTGTGTGTGGCGTGGCGGGGG - Intergenic
1047163588 8:122410430-122410452 GTGTGTGGGTAGCAAGGAGAGGG - Intergenic
1047231069 8:122998547-122998569 GGGTGTGGGAGGCAAGGGGAGGG - Intergenic
1047662082 8:127048084-127048106 GGGTGTGGGGGGCTAGGGGAGGG + Intergenic
1048294366 8:133203359-133203381 GTGTGTGATGGGCGGGTGGAGGG + Intronic
1048351159 8:133617842-133617864 GTGTGTGTATGGGGCGGGGAGGG + Intergenic
1048633611 8:136271550-136271572 GTGTGTGTGTGGCGGGGGGGGGG - Intergenic
1049090764 8:140511850-140511872 GTGAGGGAGCGGCGAGGGGTGGG - Intronic
1049179712 8:141216040-141216062 GGATGTGGGGGGCGAGGGGAGGG - Intronic
1049273650 8:141709031-141709053 GAGTGTGAGCGGTGAGGGAAGGG + Intergenic
1049347759 8:142147847-142147869 GTGTGGGAGTGCAGAGAGGAAGG - Intergenic
1049430092 8:142558350-142558372 GTGCCTGAGTGGCGAGTGAATGG + Intergenic
1049543205 8:143217984-143218006 GTGTGGGGGTGGTGTGGGGATGG - Intergenic
1049573091 8:143378642-143378664 GTGTGTGAGTGGGGTGGGCCAGG + Intronic
1049600563 8:143505555-143505577 GTGTGGGAGTGGAGTGGGGAGGG - Intronic
1050175582 9:2866580-2866602 GTGAGTCAGAGGAGAGGGGAGGG + Intergenic
1050200639 9:3142086-3142108 GTGGGTGAGGGGCTAGGGAAGGG - Intergenic
1050233818 9:3557012-3557034 GGGGGTGAGGGGCTAGGGGAGGG - Intergenic
1050336331 9:4593573-4593595 GTTTGTGAGTGGGGAGGAAATGG - Intronic
1050525823 9:6545501-6545523 GTGAGTGAGTGGTGAGTGAACGG + Intronic
1050651851 9:7785315-7785337 GTGTGTGTGGGGCGGGGGGGGGG - Intergenic
1050651853 9:7785317-7785339 GTGTGTGTGTGGGGCGGGGGGGG - Intergenic
1050791675 9:9479217-9479239 GTGTGTGTGTGGGGGGGGGGGGG - Intronic
1050812729 9:9769750-9769772 GTGGGTGGGGGGCTAGGGGAGGG - Intronic
1050860129 9:10418436-10418458 GTGTGTGTGTGTAGAGGGGAAGG - Intronic
1050884214 9:10743449-10743471 GCGGGTGAGGGGCTAGGGGAGGG + Intergenic
1051157523 9:14167071-14167093 GTGTGTGTGTGTCGGGGGGGGGG + Intronic
1051512383 9:17892798-17892820 ATGTGGGAGTGGGGAGGTGATGG - Intergenic
1051604798 9:18908649-18908671 GGGTGTGTGTGGAGTGGGGAGGG - Exonic
1051718076 9:20006331-20006353 GTGGGTGAGGGGAGGGGGGATGG + Intergenic
1052078249 9:24171938-24171960 GTGTGTGTGTGGCAGGGGGAGGG + Intergenic
1052209864 9:25891582-25891604 AGGTGTGAGTGTGGAGGGGAGGG - Intergenic
1052328875 9:27246950-27246972 GTGTGTGTGTGGGGTGGGGGGGG - Intergenic
1052386702 9:27831258-27831280 CTGTGGGAGTGGCAGGGGGAGGG - Intergenic
1052781081 9:32782914-32782936 GTGGGTTAGTGGTGAGGGGTGGG - Intergenic
1052804254 9:32998720-32998742 GGGGGTGAGGGGCTAGGGGAGGG + Intronic
1053020470 9:34690682-34690704 GTGTGGGAGGGGCGTGGGGTAGG + Intronic
1053104567 9:35398836-35398858 GTGTGTGTTTGGGGAGGGAAAGG + Intronic
1053272412 9:36759392-36759414 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1053606650 9:39666820-39666842 GTGTGTGTGTGGGGGGGGGGTGG - Intergenic
1053640821 9:40077039-40077061 GAGGGTGAGGGGCTAGGGGAGGG + Intergenic
1053765315 9:41388433-41388455 GAGGGTGAGGGGCTAGGGGAGGG - Intergenic
1054246887 9:62675586-62675608 GTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1054321508 9:63673022-63673044 GAGGGTGAGGGGCTAGGGGAGGG + Intergenic
1054740477 9:68801144-68801166 TTGTGTGTGTGAGGAGGGGATGG + Intronic
1054932165 9:70646568-70646590 GGGGGTGAGGGGCTAGGGGAGGG + Intronic
1055094129 9:72392990-72393012 GTGGGTGGGGGGCGATGGGAGGG + Intergenic
1055403596 9:75950139-75950161 GTGTGTGGGGGGGGCGGGGAGGG + Intronic
1055611875 9:78031907-78031929 GTGTGTGTGTGGCGAGGGGGAGG - Intergenic
1055726159 9:79231529-79231551 GTGGGTGTGGGGTGAGGGGAGGG + Intergenic
1055743906 9:79421921-79421943 GTGGGTGGGGGGCTAGGGGAGGG - Intergenic
1055800966 9:80035229-80035251 GTGCGTGAGTGGGGCAGGGAGGG + Intergenic
1055836868 9:80454110-80454132 GGGGGTGAGTGGTGAGGGGAGGG + Intergenic
1055913550 9:81377273-81377295 GTCTGTGTGTGGTGTGGGGAAGG - Intergenic
1056327817 9:85494928-85494950 GTGTGTGTGTGGCGAGTTGGGGG - Intergenic
1056336854 9:85579593-85579615 GTGTGTGTGGGGCGAGGGGGGGG + Intronic
1056470941 9:86903931-86903953 GTGTGTGTGTGGCAGGGGGTGGG - Intergenic
1056759489 9:89404925-89404947 GTGGGTGGCTGGCGATGGGATGG - Intronic
1057439306 9:95071279-95071301 GTGTGTGTGGGGCGGGGGGAGGG - Intronic
1057837310 9:98455552-98455574 GTGTGTGTGTGGTGGAGGGAGGG + Intronic
1057869568 9:98708169-98708191 ATGTGTGTGTGGGGAGGGGTGGG - Intronic
1057949763 9:99360369-99360391 CTGTGTGAGTGGCTAAGGGCAGG - Intergenic
1057995731 9:99820547-99820569 GTGTGTGTGTGGCGGGGGCGGGG - Intergenic
1058622613 9:106899230-106899252 GTGTGTGTGTGGGGGGGGGGGGG + Intronic
1059369304 9:113812831-113812853 TTGTGTGTGTGGTGAGGGGAGGG - Intergenic
1059438919 9:114291860-114291882 TTGTGGGAGAGGAGAGGGGAAGG + Intronic
1059682278 9:116597697-116597719 GTGAGTGAGAGGTGAGGGGTGGG + Intronic
1059842035 9:118228420-118228442 GTGTGTGAGGGGACAGGGAATGG - Intergenic
1059950720 9:119459839-119459861 GTGTGTGTGTTTTGAGGGGATGG - Intergenic
1059954527 9:119501774-119501796 GTATGTGTGTTGGGAGGGGATGG - Intronic
1059955124 9:119507793-119507815 GGGTTTGAGGGGCTAGGGGAGGG + Intronic
1059995002 9:119900269-119900291 GTGGGTGGGGGGCTAGGGGAGGG - Intergenic
1059996932 9:119920000-119920022 GTGGGTGGGGGGCTAGGGGAGGG - Intergenic
1060116133 9:120942498-120942520 GTGGGAGAGGGGGGAGGGGAAGG + Intergenic
1060174242 9:121485804-121485826 GTATGTGGGTGCAGAGGGGAGGG - Intergenic
1060192761 9:121603496-121603518 GTGTGTATGTGGGCAGGGGAGGG + Intronic
1060368374 9:123043627-123043649 GTGTTTGGGGGGTGAGGGGAAGG + Intronic
1060418475 9:123450146-123450168 GACTCTGAGTGGGGAGGGGAGGG - Intronic
1060439576 9:123626349-123626371 GTGTCTGGGGGGAGAGGGGATGG + Intronic
1060506610 9:124202644-124202666 GTGTGAGGGTGGAGAGGGGGTGG - Intergenic
1060584842 9:124779535-124779557 GTGTGTGTGTGGTGGGGGGGGGG + Intronic
1060727232 9:126014731-126014753 GGGCGTGAGTGGGGAGTGGATGG + Intergenic
1060893283 9:127201984-127202006 GTGTGAGAGAGGAGAGGGGGAGG + Intronic
1061005182 9:127924863-127924885 GTGTGTGTGTGTAGAGGGGAGGG - Intronic
1061318018 9:129809430-129809452 GTGTGTGAGGGCCGAGATGAGGG + Exonic
1061451763 9:130670749-130670771 GTGTGGGGTTGGTGAGGGGATGG - Intronic
1061716240 9:132520133-132520155 CTGAGTGAGAGGAGAGGGGAGGG - Intronic
1061883930 9:133582139-133582161 CTGTGTGTGTGCCGAGAGGACGG + Intronic
1061900413 9:133669345-133669367 GTGTCAGAGTGACGAGGGGAGGG - Intronic
1062141397 9:134961049-134961071 GTGTGTGATGGGAGAGGGGAGGG + Intergenic
1062403425 9:136382392-136382414 GTGTGTGGGCAGCGAGGGGAGGG - Intronic
1062751955 9:138261859-138261881 GTATGAGAGTGGGGAGGGAAGGG + Intergenic
1062753557 9:138274640-138274662 GTATGAGAGTGGGGAGGGAAGGG + Intergenic
1202788593 9_KI270719v1_random:60113-60135 GAGGGTGAGGGGCTAGGGGAGGG + Intergenic
1203740325 Un_GL000216v2:172068-172090 GTGTGGGAGTGGGGAGGGGGTGG - Intergenic
1203471761 Un_GL000220v1:118264-118286 GTGCGTGACGGGCGAGGGGGCGG - Intergenic
1203576069 Un_KI270745v1:9419-9441 GTATGAGAGTGGGGAGGGAAGGG + Intergenic
1203655961 Un_KI270752v1:25056-25078 GTGTGTGTGTGTTGGGGGGAGGG - Intergenic
1185511859 X:669733-669755 GGGGGTGAGGGGCTAGGGGATGG + Intergenic
1185621587 X:1453704-1453726 CGGTGCGAGTGGCGTGGGGATGG + Intronic
1185674750 X:1840195-1840217 GGGGGTGAGGGGCTAGGGGAGGG - Intergenic
1185683454 X:1907851-1907873 GGGGGTGAGGGGCTAGGGGAGGG + Intergenic
1185709724 X:2293809-2293831 GTGTGTGTGTGGTGGGGGGAGGG + Intronic
1185803563 X:3035486-3035508 GTGTGTGTGTGTGGAGGGGGGGG + Intergenic
1185988203 X:4860303-4860325 GGGGATGAGGGGCGAGGGGAGGG + Intergenic
1186148406 X:6648607-6648629 TTGTGTGTGTGGCAGGGGGATGG + Intergenic
1186314333 X:8352488-8352510 GTGTGTGTGTTGCTCGGGGAGGG + Intergenic
1186532221 X:10308903-10308925 GCATGTGTGTGGTGAGGGGAGGG - Intergenic
1186772706 X:12833172-12833194 GGGTGTGAGGGGCTAGAGGAGGG - Intergenic
1186808232 X:13161482-13161504 GTGTGTGTGTGGCGGGTGGGGGG + Intergenic
1186840564 X:13480771-13480793 GTGGGTGGGGGGCTAGGGGAGGG - Intergenic
1186909779 X:14150615-14150637 GTTTGGGAGTGATGAGGGGAGGG - Intergenic
1187237249 X:17479045-17479067 GGGAGTGAGGGGCTAGGGGAGGG - Intronic
1187331668 X:18345852-18345874 GTGTGTGTGTGTCGGGGGTAGGG - Intronic
1187648166 X:21373151-21373173 GTGTGTGTGTGTGGGGGGGAAGG + Intergenic
1187686749 X:21823017-21823039 GTGTGTGAGTGGCCCTGTGATGG - Intergenic
1188170465 X:26918187-26918209 GTGTGTGTGTGGAGGGGGGTGGG + Intergenic
1188243352 X:27814193-27814215 GGGTGTGAGGGGCAGGGGGAGGG - Intronic
1188350327 X:29122458-29122480 GTGTGTGGGTGGGGTGGGGGTGG - Intronic
1188370020 X:29358404-29358426 CTGTGTGTGTGGCGGGGGGTGGG - Intronic
1188574636 X:31632117-31632139 GTGTGTGTGTGGCGGGAGTAGGG - Intronic
1188607846 X:32054817-32054839 GTGTGAGAGAGGGGAGGGAAGGG + Intronic
1188693533 X:33159426-33159448 GTGGGTGAGGGGCTATGGGAGGG - Intronic
1189269267 X:39739423-39739445 GTGTGTGTGTGTCGGGGGGTGGG - Intergenic
1189579612 X:42392278-42392300 GTGTGTGTGTGTGGAGGGGAGGG + Intergenic
1189673554 X:43437903-43437925 GTGGGTGGGGGGCTAGGGGAGGG + Intergenic
1189740476 X:44112619-44112641 ATGTGTGTGTTGCCAGGGGAAGG - Intergenic
1189861963 X:45281957-45281979 GGGGGTGAGGGGTGAGGGGAGGG - Intergenic
1189921943 X:45910861-45910883 CTGTGTGTGTGGGGAGGGGAGGG + Intergenic
1190055801 X:47180339-47180361 GTGGGAGGGTGGGGAGGGGAAGG - Intronic
1190238933 X:48641629-48641651 GTGTGTGAGTGGTGAGTGAATGG + Intergenic
1190368808 X:49722502-49722524 GTGTGTGTGTGGTGAGGGGAAGG + Intergenic
1190440636 X:50471298-50471320 GTGTGTGTGTGGTGGGGGGGGGG + Intergenic
1190454641 X:50615774-50615796 GTTTGTGTGTGGTGGGGGGAGGG + Intronic
1190493693 X:51007122-51007144 GGGGGTGAGGGGCAAGGGGAGGG - Intergenic
1190511965 X:51182459-51182481 GTGAGTGAGTGGTGTGGGCAAGG + Intergenic
1190542708 X:51495621-51495643 GTGTGTGGGGGGCGAGGGGTGGG - Intronic
1190582708 X:51903921-51903943 GAGTGTGGGTGGTGATGGGAGGG - Intergenic
1190639068 X:52465521-52465543 GTGTGTGTGTGTCGTGGGGTGGG - Intergenic
1190924575 X:54890970-54890992 GTGGGTGGGAGGCGAGGGGAGGG + Intergenic
1191113469 X:56827513-56827535 GGGTGTGGGGGGCTAGGGGAGGG - Intergenic
1191143671 X:57141941-57141963 GGGTGTGGGGGGCAAGGGGAGGG - Intergenic
1191728692 X:64310641-64310663 GGGGGTGAGGGGCTAGGGGACGG - Intronic
1191734347 X:64373646-64373668 GTGTGTGGTTGGGGAGAGGAAGG + Intronic
1191902229 X:66053367-66053389 GTGTGTGTGTGGGGGGGGGCGGG - Intergenic
1192013946 X:67307842-67307864 GGGGGTGAGGGGCTAGGGGATGG - Intergenic
1192026879 X:67462452-67462474 GGGGGTGAGTGGCGAGGAGAGGG + Intergenic
1192083990 X:68077002-68077024 GTGTGGGAGTGGCCTGGAGAGGG + Intronic
1192133140 X:68571696-68571718 GTGTGTGAGCAGGGAGGGGATGG + Intergenic
1192556111 X:72090801-72090823 GTGTGTGTATGGAGAGGGGGTGG + Intergenic
1192623861 X:72707655-72707677 GTGTGTGTGTGTGGAGGGGTGGG + Intronic
1192702281 X:73487389-73487411 GGGGGTGAGGGGTGAGGGGAGGG + Intergenic
1192957556 X:76089390-76089412 GGGGGTGAGGGGCAAGGGGAAGG - Intergenic
1192998976 X:76542727-76542749 GGGAGTGAGGGGCTAGGGGAGGG - Intergenic
1193331458 X:80239340-80239362 GTGTGTGGTAGGGGAGGGGAGGG + Intergenic
1193435414 X:81469626-81469648 GGGGGTGGGTGGCTAGGGGAGGG - Intergenic
1193442270 X:81557036-81557058 GTGTGTGTGTGGGAGGGGGAAGG - Intergenic
1193782432 X:85719990-85720012 GAGGGTGAGGGGCTAGGGGAGGG + Intergenic
1193988850 X:88280641-88280663 GTGGGTGGGAGGCTAGGGGAAGG + Intergenic
1194031390 X:88820226-88820248 GTGGGTGGGGGGCAAGGGGAGGG + Intergenic
1194196971 X:90905929-90905951 GTGGGTGGGGGGCTAGGGGAGGG + Intergenic
1194231141 X:91324828-91324850 GGGGGTGAGGGGCTAGGGGAGGG + Intergenic
1194354184 X:92860296-92860318 GTGGGTGGGGGGCTAGGGGAGGG + Intergenic
1194456220 X:94106913-94106935 GGGGGTGAGGGGCAAGGGGAGGG + Intergenic
1194492140 X:94565172-94565194 GGGGGTGAGGGGCAAGGGGAGGG - Intergenic
1194643920 X:96434908-96434930 GTGTGGGGGTGAGGAGGGGATGG + Intergenic
1194653864 X:96547881-96547903 GTGTGTGTGTAGCTGGGGGAAGG - Intergenic
1194754585 X:97723388-97723410 GGGTGTGGGGGGCTAGGGGAGGG - Intergenic
1194806004 X:98328794-98328816 GTGTGTGTGTGTTGAGGGGTGGG - Intergenic
1194889700 X:99363809-99363831 GTGTGTGGGCGGGGAGGGGGTGG - Intergenic
1194935980 X:99949499-99949521 AGGGGTGAGTGGCTAGGGGAGGG - Intergenic
1194975922 X:100396031-100396053 GTGTGTGAGAGGTGGGAGGATGG - Intronic
1194976890 X:100405559-100405581 GTGTGTGTATGGGGGGGGGAGGG - Intronic
1194985780 X:100488247-100488269 GTGTGTGTGTGGGGGGGGGGTGG - Intergenic
1195109631 X:101633927-101633949 GTGGGTGGGTGGCTAGGGGAGGG - Intergenic
1195481586 X:105351630-105351652 GTGGGTGGGGGGCTAGGGGAGGG + Intronic
1195557933 X:106248568-106248590 ATGTCTGGGTGGTGAGGGGAGGG + Intergenic
1195600019 X:106735900-106735922 GTGTGTGTGTGTTGGGGGGAGGG - Intronic
1195660278 X:107371183-107371205 GTGTGCGTGTGGAGTGGGGAGGG - Intergenic
1196060448 X:111402811-111402833 GTGTGTGTGTGCGGAGGGGGAGG + Intronic
1196175344 X:112633947-112633969 GTGTGTGTGTGTCCAGGGGGAGG - Intronic
1196238985 X:113318013-113318035 GGGGGTGAGGGGCTAGGGGAGGG + Intergenic
1196387858 X:115177784-115177806 GGGTGTGGGGGGCAAGGGGAGGG - Intronic
1196802794 X:119558698-119558720 GTGGGGGTGTGGCTAGGGGACGG - Intronic
1196857826 X:120000278-120000300 GTGTGTGTGTGGCGGACGGAAGG + Intergenic
1196893611 X:120311932-120311954 GTGTGTGTGGGGCGGGGGGAGGG + Intergenic
1197401184 X:125992792-125992814 GTGTGTGAGTGGGAAGAGGCAGG - Intergenic
1197636965 X:128926204-128926226 GAGTGTGGGGGGCTAGGGGAGGG - Intergenic
1197644788 X:129005722-129005744 GTGTGTGGGTGGGGCGGGGGGGG - Intergenic
1197708507 X:129650453-129650475 GTGTGTGTGTGTGGAGGGGGTGG - Intronic
1197905413 X:131419694-131419716 CTGTGGGAGGGGTGAGGGGAGGG + Intergenic
1198005159 X:132486260-132486282 ATGTGTGAGGGACGAGGGGAGGG - Intronic
1198042896 X:132871780-132871802 GGGAGTGAGGGGCTAGGGGAGGG + Intronic
1198123205 X:133615604-133615626 GTGGGTGAGGGGCTAGGAGAGGG + Intronic
1198369259 X:135974380-135974402 GTGGGTGAGGGCCGAGGGGGCGG + Intergenic
1198372768 X:136007221-136007243 GTGTGTGTGTGGTGAGGGGGTGG - Intronic
1198722374 X:139636545-139636567 ATGTGTGAGGGAGGAGGGGATGG + Intronic
1198835676 X:140802564-140802586 GGGTGTGGGGGGCTAGGGGAGGG - Intergenic
1198978188 X:142361364-142361386 GTGGGTGGGGGGCTAGGGGAGGG - Intergenic
1199053053 X:143260063-143260085 GTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1199265549 X:145822181-145822203 GTGTGTGGGTGGCCTCGGGATGG + Exonic
1199524367 X:148776000-148776022 GGGTGTGGGGGGCAAGGGGAGGG - Intronic
1199756427 X:150869320-150869342 GGATGTGGGTGGTGAGGGGAAGG - Intronic
1200068082 X:153514497-153514519 GTGGGAGAGTGGGGTGGGGACGG + Intergenic
1200108885 X:153728994-153729016 GAGAGGGAGTGGAGAGGGGACGG + Intronic
1200122548 X:153798002-153798024 GTGTGGGGGTGGGGAGGGGAGGG - Intronic
1200140694 X:153901503-153901525 GTGTGTGTGTGGCGTTGGGGGGG - Intronic
1200167994 X:154050551-154050573 GTGTGTGTGTCGCGGGGGGGAGG + Intronic
1200542820 Y:4480135-4480157 GTGGGTGGGGGGCTAGGGGAGGG + Intergenic
1200562247 Y:4719392-4719414 GGGGGTGAGGGGCTAGGGGAGGG - Intergenic
1200662537 Y:5977317-5977339 GTGGGTGGGGGGCTAGGGGAGGG + Intergenic
1200965041 Y:9027949-9027971 GTGTGTGTGTGGGAAGGGCAGGG - Intergenic
1201490881 Y:14540114-14540136 GTGTGTGTGTGGTGGGGGGGCGG + Intronic
1201637816 Y:16144725-16144747 GTGTGTGTGTGTCGGGGGGGTGG + Intergenic
1201676165 Y:16586949-16586971 GTGTGTGTGTGGCGGGGTGGGGG - Intergenic
1201753737 Y:17464227-17464249 GTGTGTGAGTGCAGAGATGATGG + Intergenic
1201847816 Y:18441758-18441780 GTGTGTGAGTGCAGAGATGATGG - Intergenic
1201850557 Y:18475161-18475183 GTGTGTTATAGGTGAGGGGAGGG - Intergenic
1201882761 Y:18845216-18845238 GTGTGTTATAGGTGAGGGGAGGG + Intergenic
1201888646 Y:18916713-18916735 GGGTGTGGGGGGCTAGGGGAGGG + Intergenic
1202148070 Y:21820830-21820852 GTGTGTGTGTGGGAAGGGCAGGG + Intergenic