ID: 1141548628

View in Genome Browser
Species Human (GRCh38)
Location 16:84789201-84789223
Sequence CTCGCTCACCGCGACGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141548619_1141548628 27 Left 1141548619 16:84789151-84789173 CCAGGGCCCATAAAGCCTCAGGC No data
Right 1141548628 16:84789201-84789223 CTCGCTCACCGCGACGGCGGCGG No data
1141548622_1141548628 12 Left 1141548622 16:84789166-84789188 CCTCAGGCGCCCGTCATTGCTGC No data
Right 1141548628 16:84789201-84789223 CTCGCTCACCGCGACGGCGGCGG No data
1141548620_1141548628 21 Left 1141548620 16:84789157-84789179 CCCATAAAGCCTCAGGCGCCCGT No data
Right 1141548628 16:84789201-84789223 CTCGCTCACCGCGACGGCGGCGG No data
1141548624_1141548628 2 Left 1141548624 16:84789176-84789198 CCGTCATTGCTGCTGCCTGCGTG No data
Right 1141548628 16:84789201-84789223 CTCGCTCACCGCGACGGCGGCGG No data
1141548621_1141548628 20 Left 1141548621 16:84789158-84789180 CCATAAAGCCTCAGGCGCCCGTC No data
Right 1141548628 16:84789201-84789223 CTCGCTCACCGCGACGGCGGCGG No data
1141548623_1141548628 3 Left 1141548623 16:84789175-84789197 CCCGTCATTGCTGCTGCCTGCGT No data
Right 1141548628 16:84789201-84789223 CTCGCTCACCGCGACGGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141548628 Original CRISPR CTCGCTCACCGCGACGGCGG CGG Intergenic
No off target data available for this crispr