ID: 1141549388

View in Genome Browser
Species Human (GRCh38)
Location 16:84795209-84795231
Sequence GCCGCAGCGAGATGAAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141549388_1141549395 21 Left 1141549388 16:84795209-84795231 CCTCTCCTTCATCTCGCTGCGGC No data
Right 1141549395 16:84795253-84795275 ATTATTCTCATTTACAGAGGAGG No data
1141549388_1141549394 18 Left 1141549388 16:84795209-84795231 CCTCTCCTTCATCTCGCTGCGGC No data
Right 1141549394 16:84795250-84795272 TTTATTATTCTCATTTACAGAGG No data
1141549388_1141549396 25 Left 1141549388 16:84795209-84795231 CCTCTCCTTCATCTCGCTGCGGC No data
Right 1141549396 16:84795257-84795279 TTCTCATTTACAGAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141549388 Original CRISPR GCCGCAGCGAGATGAAGGAG AGG (reversed) Intergenic
No off target data available for this crispr