ID: 1141550776

View in Genome Browser
Species Human (GRCh38)
Location 16:84805369-84805391
Sequence GGACATTCATGGTTGCACTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141550776_1141550782 22 Left 1141550776 16:84805369-84805391 CCTAAGTGCAACCATGAATGTCC No data
Right 1141550782 16:84805414-84805436 CGCGAGGACAGAGGCAGCGATGG No data
1141550776_1141550783 23 Left 1141550776 16:84805369-84805391 CCTAAGTGCAACCATGAATGTCC No data
Right 1141550783 16:84805415-84805437 GCGAGGACAGAGGCAGCGATGGG No data
1141550776_1141550780 6 Left 1141550776 16:84805369-84805391 CCTAAGTGCAACCATGAATGTCC No data
Right 1141550780 16:84805398-84805420 GAAGAGAAGAAGGCTACGCGAGG No data
1141550776_1141550778 -4 Left 1141550776 16:84805369-84805391 CCTAAGTGCAACCATGAATGTCC No data
Right 1141550778 16:84805388-84805410 GTCCGTATAAGAAGAGAAGAAGG No data
1141550776_1141550781 13 Left 1141550776 16:84805369-84805391 CCTAAGTGCAACCATGAATGTCC No data
Right 1141550781 16:84805405-84805427 AGAAGGCTACGCGAGGACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141550776 Original CRISPR GGACATTCATGGTTGCACTT AGG (reversed) Intergenic
No off target data available for this crispr