ID: 1141553070

View in Genome Browser
Species Human (GRCh38)
Location 16:84819141-84819163
Sequence CCCTTAGCTCTTAAGGAACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141553059_1141553070 18 Left 1141553059 16:84819100-84819122 CCCGTCCACATTTTGTGACTGAG No data
Right 1141553070 16:84819141-84819163 CCCTTAGCTCTTAAGGAACGTGG No data
1141553060_1141553070 17 Left 1141553060 16:84819101-84819123 CCGTCCACATTTTGTGACTGAGG No data
Right 1141553070 16:84819141-84819163 CCCTTAGCTCTTAAGGAACGTGG No data
1141553063_1141553070 13 Left 1141553063 16:84819105-84819127 CCACATTTTGTGACTGAGGCGGG No data
Right 1141553070 16:84819141-84819163 CCCTTAGCTCTTAAGGAACGTGG No data
1141553058_1141553070 26 Left 1141553058 16:84819092-84819114 CCTGCATACCCGTCCACATTTTG No data
Right 1141553070 16:84819141-84819163 CCCTTAGCTCTTAAGGAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141553070 Original CRISPR CCCTTAGCTCTTAAGGAACG TGG Intergenic
No off target data available for this crispr