ID: 1141556544

View in Genome Browser
Species Human (GRCh38)
Location 16:84840186-84840208
Sequence TGCCACAGGCTGAGCTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 333}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141556539_1141556544 17 Left 1141556539 16:84840146-84840168 CCGTCTCATCTGTGTCTTTAAAG 0: 1
1: 0
2: 0
3: 32
4: 354
Right 1141556544 16:84840186-84840208 TGCCACAGGCTGAGCTGGCCTGG 0: 1
1: 0
2: 2
3: 39
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141556544 Original CRISPR TGCCACAGGCTGAGCTGGCC TGG Intronic
900228194 1:1542598-1542620 TGCCCCAGAGTGAGCAGGCCCGG + Intronic
900461613 1:2804652-2804674 TGCCAAAGGCAGTGCAGGCCTGG - Intergenic
902334736 1:15748394-15748416 TGCCTCAGGCTGGCCTGGGCTGG + Intergenic
903168897 1:21540136-21540158 TGGCACAGAGTGAGGTGGCCTGG + Intronic
903587196 1:24425054-24425076 CCCCCCAGGCTGAGCTGCCCAGG + Intronic
903739819 1:25552276-25552298 TGCCAGAGCCTCAGCTGCCCTGG + Intronic
903818866 1:26085542-26085564 TGCCCAAGGCTGAGCTCCCCTGG + Intergenic
904740245 1:32669336-32669358 TGCCACAGGATCAGCTGACAAGG + Exonic
905520872 1:38598715-38598737 TGCCCCAGGCTGGGGTGGGCAGG + Intergenic
905633206 1:39530539-39530561 TGCCAGAGGTGGAGCTGGCTTGG + Intergenic
905873791 1:41419410-41419432 TGGCACAGGCTGAGCCGGCAAGG + Intergenic
905990717 1:42335056-42335078 TACCTCAGGCTGCGCAGGCCGGG + Intronic
906288411 1:44603391-44603413 TGCCCCAGGCCCTGCTGGCCTGG - Intronic
907524781 1:55047794-55047816 GGCCACAGGCTGCCCAGGCCGGG - Intronic
907545148 1:55253316-55253338 TACGACAGGGTGAGCTGGACTGG - Intergenic
908615686 1:65919755-65919777 TGCCACATGCTGAGCTCTCCAGG + Intronic
910094181 1:83501196-83501218 TGCCAAAGGCTGAGCTGTATTGG + Intergenic
912815768 1:112826798-112826820 TGCCACACGCTGCTCTGGCGAGG - Intergenic
914457284 1:147847724-147847746 TCCCACAGGCCCACCTGGCCTGG - Intergenic
915128365 1:153680722-153680744 TGCCACAAGCTGAGACAGCCTGG - Intronic
915605422 1:156947341-156947363 TGCCCCGGGAGGAGCTGGCCCGG - Exonic
916168066 1:161980948-161980970 TGCCAAAGGCGGAGCTGGTTTGG + Intergenic
916735263 1:167601838-167601860 TGAAACAGGCTGACCTGGGCAGG + Intergenic
917470588 1:175322951-175322973 TGTCACAGCCTGACATGGCCAGG - Exonic
917731531 1:177879675-177879697 TGCCACAGGCTGAGCTCCTGAGG - Intergenic
918164841 1:181935324-181935346 AGCCACAGGTAAAGCTGGCCTGG - Intergenic
920088555 1:203435719-203435741 TTCCCCAGGCTGGCCTGGCCTGG + Intergenic
920177168 1:204109114-204109136 GACCCCAGGGTGAGCTGGCCTGG + Intronic
920201306 1:204261434-204261456 CCCCACAGGCTGAGCATGCCGGG - Exonic
922705942 1:227790019-227790041 TGCCACAGGAGGCTCTGGCCAGG + Intergenic
924458133 1:244234450-244234472 TGGCTCGGGCTGAGCTGTCCTGG - Intergenic
1062980340 10:1717326-1717348 TGACACAGGCCCAGCTGCCCTGG - Intronic
1067803614 10:49377463-49377485 TGCCTGAGTCTGGGCTGGCCCGG + Intronic
1067942680 10:50669632-50669654 TGACACGGGCAGAGCTGGGCAGG - Intergenic
1070570970 10:77638796-77638818 TTCCACAGGCTGAGCTCCCCAGG + Intergenic
1070863923 10:79694595-79694617 TGACACGGGCAGAGCTGGGCAGG - Intergenic
1071387059 10:85131979-85132001 TACCAGAGGCTGAGGTGGCTAGG + Intergenic
1072809042 10:98445589-98445611 TGCAAAGGGCTGTGCTGGCCGGG - Intronic
1072918480 10:99555507-99555529 TGGAACAGGCTGAGCAGGACTGG - Intergenic
1073324095 10:102632577-102632599 TGCCAGAAGCTGTGCTGGACAGG - Exonic
1074104115 10:110376132-110376154 CGCCCCACGGTGAGCTGGCCGGG - Intergenic
1074853070 10:117454289-117454311 TGCCAGAGGCTGCACTGGCTGGG + Intergenic
1075389680 10:122083522-122083544 TGCCGCACGCAGAGCTGCCCTGG + Exonic
1076216289 10:128696203-128696225 TGCCTGTGGCTGGGCTGGCCTGG - Intergenic
1076614324 10:131746219-131746241 TCCAACAGGATGGGCTGGCCTGG + Intergenic
1076997933 11:308073-308095 TGTCAAATGCAGAGCTGGCCAGG - Exonic
1077134780 11:993072-993094 TGCCACACGCTGACCTGCCCTGG - Intronic
1077164473 11:1128946-1128968 TGGGACAGGCTGAGCTGCCGAGG + Intergenic
1077413918 11:2415713-2415735 TGGCCCAGGCAGAGCTGGCTGGG - Intronic
1077457000 11:2687331-2687353 AGCCAGAGGCTGAGGTAGCCAGG + Intronic
1078022390 11:7666474-7666496 TACCACAGGTTGAACTGGTCTGG + Exonic
1078355142 11:10627415-10627437 AGCCACAGTCTCACCTGGCCTGG + Intronic
1078706233 11:13746804-13746826 AGCCACAGGCAGGGCTGGGCAGG + Intergenic
1078891090 11:15559853-15559875 AGCCAGAGGCAGAGCTGGCAAGG + Intergenic
1081111487 11:39139229-39139251 TACCTCAGGCTCAGTTGGCCAGG - Intergenic
1081573646 11:44306386-44306408 TGGCCCAGGCTCAGCTGCCCGGG + Intronic
1084038962 11:66530668-66530690 AGTCAGAGGCAGAGCTGGCCTGG - Intronic
1084191251 11:67500013-67500035 AGGCTGAGGCTGAGCTGGCCCGG - Intronic
1084490351 11:69475125-69475147 TGGCACAGCCAGAGGTGGCCAGG + Intergenic
1084517332 11:69643984-69644006 TGCCACAGGTAGGGCAGGCCCGG + Exonic
1084592021 11:70096238-70096260 AGCCACAGTCTGAGGTGCCCAGG + Intronic
1084599584 11:70136929-70136951 TGAGACACGCTGAGCTGGGCTGG + Intronic
1084662841 11:70557348-70557370 AGCCTCAGGGTGGGCTGGCCTGG - Intronic
1084893400 11:72248475-72248497 TGCTACAGGGTTAGCTGGGCAGG + Intergenic
1085258594 11:75191340-75191362 TGCCATAAGCTGCTCTGGCCAGG - Intronic
1085461748 11:76698227-76698249 TGCCACAGGCCAAGCCTGCCAGG + Intergenic
1086240922 11:84690088-84690110 TACCAGAGGCTGAGGTGGTCGGG + Intronic
1091704423 12:2684107-2684129 AGCCGCATGCTGTGCTGGCCTGG - Intronic
1091710997 12:2740457-2740479 AGCCGCATGCTGTGCTGGCCTGG - Intergenic
1092728374 12:11506245-11506267 AGCCACATGCTGTGCTGGCCTGG + Intergenic
1096521288 12:52186147-52186169 AGCCCCAGGCTGAGCTCGGCTGG - Intronic
1096521425 12:52186847-52186869 AGCCCCAAGCTGAGCTGGGCTGG - Intronic
1096531226 12:52244049-52244071 CTGCACAGGCTGAGCTGCCCTGG - Intronic
1096630119 12:52921110-52921132 TCCCTGAGGCTAAGCTGGCCTGG - Intronic
1096652970 12:53071182-53071204 TGCTGGAGCCTGAGCTGGCCAGG - Intronic
1096698442 12:53366148-53366170 TGCCACAGGCTCATTTGGCAAGG + Intergenic
1097862612 12:64533197-64533219 GGTAACAGGCTGAGCCGGCCAGG - Intergenic
1098360511 12:69649973-69649995 TGCCACAGGTAGATGTGGCCAGG - Intronic
1102261230 12:111444740-111444762 GGCCAGAGCCTGAGCTGTCCAGG + Intronic
1102349048 12:112178891-112178913 GCCCACAGGCTGGGCTGCCCAGG + Intronic
1103060618 12:117855547-117855569 TCCTCCAGGCTCAGCTGGCCGGG + Exonic
1103330239 12:120149224-120149246 TGCCAGAGGGAGAGCTGGCCAGG + Intronic
1103768823 12:123303792-123303814 TTGCAGAGGCTGAGCTGGTCTGG - Intronic
1103913758 12:124365572-124365594 TGCCACACGCTCAGCTGAGCGGG + Intronic
1103974895 12:124696084-124696106 TGGCAGATGCTGTGCTGGCCAGG + Intergenic
1104799380 12:131543519-131543541 GGCCCCAAGCAGAGCTGGCCAGG + Intergenic
1104843701 12:131836285-131836307 AGCAACAGGCCGTGCTGGCCAGG - Intronic
1110800013 13:79683829-79683851 TGCCACAGCCTGAACTGCCCTGG - Intergenic
1112985296 13:105441945-105441967 TCCCACAGGCTGATGAGGCCTGG - Intergenic
1113460682 13:110479896-110479918 TGCCCCAGCCAGAGCTGGCAAGG + Intronic
1113615483 13:111677561-111677583 AGCCACAGCCTGAGCTCGACAGG - Intergenic
1113620951 13:111762463-111762485 AGCCACAGCCTGAGCTCGACAGG - Intergenic
1113855910 13:113445417-113445439 TGCCACAGCCTGTCCTGGCATGG - Intronic
1115736229 14:36333270-36333292 TGCCACAGGCTATGCTTGTCTGG - Intergenic
1118151155 14:63192288-63192310 TGACAAAGGCTGAGCAGGGCTGG + Intergenic
1118305547 14:64652051-64652073 TCCCATAGGCTGAGGTGGCCTGG + Intergenic
1118714307 14:68548316-68548338 TGCAGCAGGCTGGGCTGGGCAGG - Intronic
1118905910 14:70023056-70023078 TGCCACAGGCTGAGCCGCTGTGG + Intronic
1119379884 14:74221778-74221800 TCCCACAGCCTGGGCTGGTCTGG - Intergenic
1120842379 14:89097221-89097243 GGCCACAAGCCGAGCTGGCAAGG - Intergenic
1122101828 14:99418563-99418585 TGCCACAGGCTGTCCTGCCCAGG - Intronic
1122794536 14:104199475-104199497 GGACACAGGCTGAGCAGGTCAGG + Intergenic
1122803890 14:104247131-104247153 GGCCACAGGGTGCCCTGGCCGGG + Intergenic
1123037174 14:105476203-105476225 AGCCCCAGGCTGGCCTGGCCCGG - Intronic
1123063877 14:105606553-105606575 TGCCCCAAGCTGTGCTGGGCTGG + Intergenic
1123084135 14:105709663-105709685 TGGGCCAGGCTGAGCTGGGCTGG - Intergenic
1123093115 14:105750967-105750989 TGCCCCAAGCTGTGCTGGGCTGG + Intergenic
1124045899 15:26149491-26149513 TGCCACTGGCTGAGCAGCCAGGG + Intergenic
1125420401 15:39498934-39498956 TGCTCCAGGCTGGGCTGGGCTGG + Intergenic
1126792142 15:52231156-52231178 ACCCACAGCCTGAGCTGGTCAGG + Intronic
1127124070 15:55795181-55795203 TGCCAGAGGCTGAGCTAGAAGGG + Intergenic
1127287192 15:57542221-57542243 TGACACAGGCTTACTTGGCCTGG - Intronic
1127981948 15:64041881-64041903 ACCCTCAGGCAGAGCTGGCCTGG + Intronic
1128570719 15:68731135-68731157 AGCCCCAGGCTGGGCTGGGCCGG - Intergenic
1129331585 15:74830565-74830587 CTCCACAGGCTGAGCTGGTGGGG - Exonic
1129387560 15:75204074-75204096 AGCCACAGGCTGAGTTAGACCGG - Intronic
1129467994 15:75734530-75734552 TGGCCCAGGCAGAGGTGGCCTGG - Intergenic
1130906455 15:88243996-88244018 TGACTCAGTCTGACCTGGCCTGG + Intronic
1131132081 15:89906603-89906625 TGCCACATGCTGAGAGGTCCAGG - Intronic
1131192182 15:90325636-90325658 TCCCCCAGGCTGAGCAGACCAGG + Intergenic
1132300092 15:100769816-100769838 TGTGCCAGGCTGGGCTGGCCAGG - Intergenic
1132573956 16:656312-656334 TGACACAGACTGAGCTGACGGGG - Exonic
1132661980 16:1065733-1065755 TGCGAAAGGCTGAGCTGCGCCGG + Intergenic
1132667672 16:1089532-1089554 GGCGACAGGCAGAGCTGGCAGGG + Intergenic
1132860092 16:2066308-2066330 TGCCACAGCCTGGACGGGCCTGG - Intronic
1132863991 16:2084779-2084801 TGCCCCAGGCCGAGCGGGCTGGG + Intronic
1132878063 16:2148999-2149021 CGCCACCTGCTGCGCTGGCCTGG - Intronic
1132933578 16:2470483-2470505 TGCCACGGGCCCAGCTGGCAGGG - Intergenic
1133165942 16:3947238-3947260 GGCCACAGGTTGGGCTGGGCTGG + Intergenic
1134913373 16:18049377-18049399 TGATGCAGGCTCAGCTGGCCTGG + Intergenic
1135247273 16:20867774-20867796 TTCCACAGGCCCAGCTGGCCAGG + Intronic
1135322598 16:21507298-21507320 GGCCGCAGGCTGCGCTGGGCGGG - Intergenic
1136334075 16:29600435-29600457 GGCCGCAGGCTGCGCTGGGCGGG - Intergenic
1137041875 16:35620712-35620734 TGCCACACACTGCTCTGGCCAGG + Intergenic
1138574908 16:57901338-57901360 TGCAAGAAGGTGAGCTGGCCTGG - Exonic
1139949980 16:70663982-70664004 TGCCCCAGGCTGTGTTGGGCAGG + Exonic
1140737486 16:77911358-77911380 TGCCACAGGATGAGAAGGTCTGG - Intronic
1140951892 16:79826276-79826298 TCCAACAGCCTCAGCTGGCCAGG - Intergenic
1141180945 16:81753055-81753077 TGGCTCAGTCTGAGCTGTCCAGG + Intronic
1141556544 16:84840186-84840208 TGCCACAGGCTGAGCTGGCCTGG + Intronic
1141766419 16:86062674-86062696 TGCCGCAGGCTGACCAGGCAGGG + Intergenic
1142034843 16:87856527-87856549 GGCCACAGGCTGCACTGGGCGGG - Intronic
1142418600 16:89956846-89956868 GGCCACAGGCTGAGCTGCAAGGG + Intronic
1142519884 17:497445-497467 GGCCCCAGGCTGATGTGGCCTGG - Intergenic
1142631595 17:1229436-1229458 TCCCGCAGGCCGCGCTGGCCCGG - Intergenic
1143551258 17:7631779-7631801 AGAGGCAGGCTGAGCTGGCCAGG - Intronic
1144646883 17:16981136-16981158 AGCCACAGGCTGAGCACTCCTGG - Intergenic
1144720628 17:17467213-17467235 TGCAGGAGGCTGAGCTGGCTGGG + Intergenic
1144849267 17:18235812-18235834 TGGCCCACGCTGAGCTGCCCAGG + Intronic
1145365840 17:22266271-22266293 TGGTACAGGCAGAGCTGGTCTGG - Intergenic
1145728647 17:27156112-27156134 TGGTACAGGCAGAGCAGGCCTGG + Intergenic
1147148084 17:38497835-38497857 TGCCGCGGGCTGGGCTGGCATGG + Intronic
1147155078 17:38540559-38540581 GGCCACAGGCTGAGCTAGTGTGG + Intronic
1147196164 17:38768263-38768285 AGCCACAGGCTGCTCTGGCCAGG - Exonic
1147311753 17:39599674-39599696 CGCCTGAGGCTGAGCTGGCCAGG - Intergenic
1148829265 17:50419817-50419839 TGCCACATGCTGCTCTGGCAAGG + Intergenic
1149451180 17:56751267-56751289 TGACAGAGGTAGAGCTGGCCTGG - Intergenic
1151404470 17:73877760-73877782 GACCCCAGGCTGAGCTGCCCGGG + Intergenic
1151507876 17:74541349-74541371 GGCCCGAGGCTTAGCTGGCCGGG + Exonic
1151676755 17:75602709-75602731 GGCCATGGGCTGAGCTTGCCAGG + Intergenic
1152735423 17:81994766-81994788 TGGCACTGGTTGAGCTGCCCTGG + Intronic
1152742707 17:82025319-82025341 TGGCAGAGGGGGAGCTGGCCTGG - Intronic
1152980925 18:275686-275708 TGTTACAGCCAGAGCTGGCCTGG + Intergenic
1157075770 18:44465767-44465789 TGCCACAAGTTGAGCTAGCAAGG + Intergenic
1157273915 18:46296826-46296848 AGCCAGAGGCTGAGCAGGCTGGG + Intergenic
1157581513 18:48776649-48776671 TGCCACAGGCTCTGCTGGAGAGG - Intronic
1158291626 18:55951017-55951039 TGCCACACGCTGCTCTGGCGAGG - Intergenic
1158401349 18:57124049-57124071 TCCCATAGGCTGGGCTGTCCAGG + Intergenic
1158558315 18:58493097-58493119 TGCCACAGGGTCATCTGTCCTGG - Intronic
1159573646 18:70148671-70148693 TAACACAGGCTGATCTGGCAAGG + Intronic
1160103627 18:75947772-75947794 TGCCTCAGCCTCAGCTGGGCAGG + Intergenic
1160511159 18:79454314-79454336 ACGCAGAGGCTGAGCTGGCCTGG - Intronic
1160708282 19:539944-539966 TGCCAGAGGCTGGGATGGCCAGG + Intronic
1161009525 19:1953622-1953644 GGCCACGGGCAGAGCTGACCAGG - Intronic
1161515424 19:4693623-4693645 TGGCAGTGGCTGAGCTGTCCTGG - Intronic
1163266786 19:16226802-16226824 TGCCCCAGGCAGAGCAGGGCAGG - Intronic
1165069698 19:33248278-33248300 GGCCACATGGTGAGCTGACCTGG - Intergenic
1165300990 19:34968811-34968833 TACCAGAGGCTGAGGTTGCCAGG - Intergenic
1166270798 19:41712227-41712249 TCCCCCAGGTGGAGCTGGCCAGG + Intronic
1168094523 19:54107052-54107074 AGTCAGAGGCTGGGCTGGCCAGG + Exonic
1168247084 19:55117703-55117725 TGCCCCAGGGTGTGCTGGGCAGG + Intergenic
1168257794 19:55176065-55176087 TGCCACCTGCTGCCCTGGCCCGG + Exonic
925354031 2:3224622-3224644 TAGCAGAGGCTGAGCTGCCCAGG + Intronic
925775907 2:7335610-7335632 TTCCACAAGCAGAGCTGGCTGGG + Intergenic
927327138 2:21818152-21818174 TGCGACAGGCTGGGCATGCCAGG + Intergenic
927862963 2:26571433-26571455 GGCGCCATGCTGAGCTGGCCTGG - Intronic
928224752 2:29438961-29438983 TCCCACAGGCAGGGCTGGTCTGG - Intronic
929593552 2:43162020-43162042 AGCCCCAGGGTGAGCTGGCCGGG + Intergenic
929822200 2:45282661-45282683 TGCCAAAGGCTGACCTGGCAGGG - Intergenic
930418459 2:51119443-51119465 TACAACAGGCAGACCTGGCCTGG - Intergenic
931263224 2:60638290-60638312 TCCCCCAGGCTGAGGGGGCCAGG + Intergenic
932297982 2:70642599-70642621 TGCCACAGCCTGACCTGGTGTGG - Intronic
932408777 2:71532534-71532556 GGCCACAGGCAGTGCTGGCTGGG + Intronic
932750427 2:74368117-74368139 TCCCACAGGCAGAGCTGATCCGG - Exonic
933344021 2:81060670-81060692 TGCCAGTGGCTGTGATGGCCTGG - Intergenic
934768547 2:96894124-96894146 TGCCACCAGCTGAGGTGTCCAGG - Intronic
935173913 2:100631352-100631374 TTACACAGGCTGACTTGGCCAGG + Intergenic
935816607 2:106852190-106852212 TACCACAGGCTCCGCTGACCTGG - Intronic
936016025 2:108959622-108959644 TGCCACAGCCGGCACTGGCCTGG - Intronic
936399692 2:112155914-112155936 TGCCAAAGGCTGCGCTGGGAAGG - Intronic
937910861 2:127074994-127075016 TAGAACAGGCTGAGCTGGCCGGG - Intronic
938323562 2:130381943-130381965 TGCCACAGGCCATGCTGGGCAGG - Intergenic
938772576 2:134512945-134512967 TGCCACATCCTCACCTGGCCTGG - Intronic
941095723 2:161238074-161238096 CGCCACAGGCTGGGCGCGCCCGG - Intergenic
945436693 2:209826740-209826762 TTCCACAGTCTGAGCTGGGATGG + Intronic
945875320 2:215272184-215272206 TGCCACAGGAAGGCCTGGCCTGG + Intergenic
945971187 2:216233780-216233802 TGTGACAGGCTGGGCTGGCCAGG + Intergenic
948181980 2:235989465-235989487 TGGGACAGGATGAGCTGGGCTGG + Intronic
948223814 2:236293441-236293463 TGCCCCAGACTCACCTGGCCTGG - Intergenic
948525979 2:238571071-238571093 TGTCACCGGCAGAGCTGGGCGGG - Intergenic
948562605 2:238864545-238864567 CTCCCCAGGCTGACCTGGCCTGG - Intronic
948795506 2:240400315-240400337 AGCCACAGGCAGGGCTGGCAGGG + Intergenic
948846576 2:240685699-240685721 TGCCAGAGGCTGAGGTGCCCAGG - Intergenic
948847285 2:240689035-240689057 TGCCAGAGGCTGAGGTGCCCAGG + Intergenic
948887394 2:240891094-240891116 GGGCACAGGCTGAGCTCCCCTGG - Intronic
1169817627 20:9674559-9674581 TGGAACAGGCTGAGATGTCCTGG + Intronic
1169984624 20:11430200-11430222 TGCCAGAGGCAGAGCAAGCCAGG + Intergenic
1170732672 20:18988240-18988262 TGCTACATGCTGACCAGGCCCGG + Intergenic
1171960253 20:31488381-31488403 GGCCACAAACTGTGCTGGCCTGG + Intergenic
1172620548 20:36315867-36315889 GGCCACAGACTGAGATGGCAGGG - Intronic
1172801417 20:37578987-37579009 GCACAGAGGCTGAGCTGGCCTGG - Intergenic
1172830817 20:37832885-37832907 TGCCACAGTCTGTGCTGTTCTGG + Intronic
1174468015 20:50731939-50731961 GGCGACGGGCTGAGCTGCCCCGG + Intronic
1174713110 20:52728187-52728209 AGGCACAGGCTCAGCGGGCCGGG - Intergenic
1176014462 20:62922716-62922738 TGACACAGCCTGTGCTGGCGAGG + Intronic
1176388685 21:6152302-6152324 ACCCACAGGCTGTCCTGGCCAGG - Intergenic
1177355378 21:19999533-19999555 TGCCACACGCTGCTCTGGCGAGG + Intergenic
1179251337 21:39673837-39673859 GGCAACAGGCTGAGATGTCCTGG - Intergenic
1179416274 21:41200981-41201003 GGACAGTGGCTGAGCTGGCCAGG - Intronic
1179556655 21:42182883-42182905 TGCCGCTGGCTGGGCTGGGCTGG - Intergenic
1179725273 21:43338423-43338445 TGCCCCAGGCTGTGATGGTCTGG + Intergenic
1179734787 21:43385946-43385968 ACCCACAGGCTGTCCTGGCCAGG + Intergenic
1179781498 21:43703778-43703800 TGTCACGGGCTGTGCTAGCCGGG - Intergenic
1180011363 21:45053676-45053698 TTCCACAGTCTGCCCTGGCCAGG + Intergenic
1180109441 21:45641262-45641284 TGACACACGCTGATCCGGCCTGG - Intergenic
1180174002 21:46078740-46078762 TGGCAGAGGCTGAGCTGGAGAGG + Intergenic
1180179200 21:46110522-46110544 GGCCCCAGGCTGAGCAGGTCTGG + Intronic
1180987207 22:19912003-19912025 TGCCACAGGCTGAGGTGGGCAGG + Intronic
1181107824 22:20585166-20585188 TGCTCCAGGGTGAGGTGGCCAGG + Exonic
1184229862 22:43152549-43152571 TGCCTCAGGCTGCCCTGTCCCGG - Intronic
1184230716 22:43157049-43157071 AGCAGTAGGCTGAGCTGGCCTGG + Intronic
1184477796 22:44730782-44730804 GACCACAGGCAGAGCTGGCCTGG + Intronic
1184509603 22:44925916-44925938 CCCCACAGTCTGGGCTGGCCTGG - Intronic
1184769405 22:46588815-46588837 TGGCCCAGGCTGGGCTGGGCTGG + Intronic
1185247219 22:49779626-49779648 AGCCACACGCTGAGCTGCCCTGG + Intronic
950831186 3:15877928-15877950 TGCCGCGGGCTGGGCAGGCCAGG - Intergenic
952966752 3:38625774-38625796 TGCCTCTGGCTGGGCTGGGCAGG + Intronic
953546107 3:43864640-43864662 AGCCACAGGCTGGGATGGGCTGG - Intergenic
954432025 3:50475921-50475943 TGCCTCAGGAAGAGCAGGCCAGG + Intronic
954453214 3:50582864-50582886 AGCCACTGGCTGCCCTGGCCTGG - Exonic
954714130 3:52518715-52518737 TGCTCCAGGATGAGCTGGCCCGG + Exonic
955333813 3:58068889-58068911 TGCCCCATGCTCACCTGGCCTGG - Intronic
955427004 3:58801705-58801727 TCCCGCTGGCTCAGCTGGCCTGG - Intronic
957909006 3:86597498-86597520 TTCCACAGTCTGCTCTGGCCTGG - Intergenic
960103784 3:113772129-113772151 TGCATCAGGCTGAGATGGCTGGG + Intronic
961354758 3:126330172-126330194 TGACTCAGGCTGGGCTGGCTGGG - Intergenic
961452988 3:127010829-127010851 TGCTGCAGGCTGAGCTGCCTGGG + Intronic
966525148 3:180912327-180912349 TGCCACAGAATGAACTGCCCAGG - Exonic
967198015 3:187046146-187046168 TACCACAGCCTGGGCAGGCCTGG - Intronic
968001054 3:195207084-195207106 TACCACAGGCTGAGCCAGCCTGG + Intronic
968233186 3:197016135-197016157 TGCCCGAGGTTGAGCTGGGCTGG + Intronic
968489726 4:883550-883572 TGCCGGAGGCTGCGCTTGCCCGG - Intronic
968515314 4:1013160-1013182 GGGCACACGCTGTGCTGGCCTGG + Intronic
968730078 4:2265368-2265390 TGCCACAGCCTCAGCTTCCCTGG + Intergenic
969505315 4:7583100-7583122 TGTCCCAGGCTGACCTGGGCAGG - Intronic
969699564 4:8760749-8760771 AGCCACAGCCTGTGTTGGCCTGG + Intergenic
969904485 4:10381642-10381664 TGCCTGAGGCTGAGCTGCCTTGG + Intergenic
971420736 4:26471925-26471947 TGCCCCAGGGTGACCAGGCCTGG + Intergenic
972639264 4:40910909-40910931 TCCCATAGGCTGTGCTGGGCTGG - Intronic
973571804 4:52247847-52247869 AGCCTTAGGCTGAGCTGGCAAGG + Intergenic
975205359 4:71638931-71638953 TGCCACATGCTGCTCTGGCGAGG - Intergenic
975661872 4:76696579-76696601 TGTCATAGGCTGGCCTGGCCTGG + Intronic
977244735 4:94618070-94618092 TGCCAGAGGTTGGGCTGTCCAGG - Exonic
978824669 4:113007311-113007333 GGCCACAGGCTGTGCTATCCTGG + Intronic
982306971 4:153943069-153943091 TGCCAAAGGCAGAGCTGAACAGG + Intergenic
985697179 5:1347182-1347204 CTCCCCAGGCTTAGCTGGCCTGG + Intergenic
992091578 5:73322535-73322557 GACCCCAGGCTGAGCAGGCCAGG - Intergenic
992143099 5:73819219-73819241 TGCCAAATGTTGCGCTGGCCTGG + Intronic
992565741 5:77993890-77993912 TGCAGCAGGCTGAGCCAGCCGGG + Intergenic
995146970 5:108797310-108797332 TGCTGCAAGCTGTGCTGGCCGGG + Intronic
997337465 5:133118373-133118395 TCCCACAGCCTGACCTGCCCTGG + Intergenic
998399910 5:141843265-141843287 TGCCCCAGGCTGGGCTGGCCAGG - Intergenic
1001257434 5:170194768-170194790 TGCCTGATGCTGAGTTGGCCTGG - Intergenic
1001820774 5:174708589-174708611 TGCCACTGGCAGAGGTTGCCGGG - Intergenic
1002164692 5:177337085-177337107 TCCCTCAGGGTGAGCTGGGCTGG + Intronic
1002433663 5:179218779-179218801 TGGCTGAGGCTGAGCAGGCCTGG - Intronic
1004193946 6:13487582-13487604 TCCCAGAGCCTGAGCCGGCCTGG - Intronic
1004481421 6:16023190-16023212 TGCTCCAGTGTGAGCTGGCCAGG - Intergenic
1004858948 6:19781551-19781573 AGCCAAAGGCTGTGATGGCCCGG + Intergenic
1005986481 6:30878920-30878942 TGCTACAGGCAGAGCTGGAAAGG - Intronic
1006912440 6:37572123-37572145 TGACACAGGCTGAGAAGGGCTGG + Intergenic
1007091081 6:39185374-39185396 TGTGGCAGGCTGAGTTGGCCTGG - Intergenic
1007370677 6:41425097-41425119 TGCCCCAGGCTGAGCACACCAGG + Intergenic
1007787050 6:44286592-44286614 TGCCTCAGGCTGGGCCTGCCTGG + Intronic
1010867843 6:81001924-81001946 TGCCACAGGGTGGGATGGCGGGG + Intergenic
1011617745 6:89212553-89212575 TCCCACAGCCTGAGCTGGCATGG + Intronic
1013251852 6:108342217-108342239 TCCCACAGGCTGAACCAGCCAGG + Intronic
1015485394 6:133764295-133764317 TGCCACAGGCTGGCCTGAGCTGG - Intergenic
1019516599 7:1442876-1442898 TGTCAGAGGCTGGGCCGGCCTGG + Intronic
1019706830 7:2500733-2500755 TGCCACAGGATGGGGGGGCCAGG - Intergenic
1023028670 7:36074482-36074504 TGCCACAGGCTGACAGGGCCTGG - Intergenic
1023674725 7:42617513-42617535 TGCCTGGGGCTGAGCAGGCCTGG - Intergenic
1024579310 7:50788871-50788893 TGCCACAGGCTCCACAGGCCTGG + Intronic
1024780118 7:52837854-52837876 TGCCAGAGGCTGGGAGGGCCTGG - Intergenic
1024811405 7:53217066-53217088 CGCCACTGGCTTAGGTGGCCAGG - Intergenic
1026878784 7:73895016-73895038 GGCCCTAGGCTGGGCTGGCCCGG - Intergenic
1026951984 7:74353818-74353840 TGGCACAGGCAGAGATGGCAGGG - Intronic
1029571684 7:101373987-101374009 TGCCCCAGGCTGAATTGGTCCGG - Intronic
1031723132 7:125202088-125202110 TGCTGCAGGCTGAGCAGGCTGGG + Intergenic
1032237647 7:130139332-130139354 TGAGACAGGCTGTGCTGCCCAGG + Intergenic
1035478352 7:159159653-159159675 TGGCACAGGATGGGCTGGGCTGG - Intergenic
1035871955 8:3144905-3144927 TGCCACTGGCTGGGCAGTCCAGG - Intronic
1044351228 8:91168658-91168680 TGTCACAAGTTGAGCAGGCCAGG - Intronic
1044726275 8:95196612-95196634 TGGCACAGTCTAAACTGGCCCGG - Intergenic
1047498711 8:125426771-125426793 TGCCACAGGTTGAACTCCCCAGG + Intergenic
1048020795 8:130537302-130537324 TGCCAAAGGAAGAGCTGGCAGGG + Intergenic
1049001175 8:139826431-139826453 GGCCACAGCCCCAGCTGGCCAGG - Intronic
1049518863 8:143078094-143078116 AGCCACAGGCTGTGCCCGCCAGG + Intergenic
1049519783 8:143082194-143082216 TGCCGCGGGCGGAGGTGGCCTGG + Intronic
1049617105 8:143580432-143580454 GGTCACAGGCTGAGCCGGCTAGG + Intronic
1049807442 8:144547403-144547425 TGGCGCAGGCTCGGCTGGCCTGG - Exonic
1051154606 9:14126887-14126909 TGCCACATGCTGCACTAGCCTGG + Intronic
1051740984 9:20251976-20251998 TGCCACATGCTTCACTGGCCAGG + Intergenic
1053415558 9:37944936-37944958 AGACACAGGCTGGCCTGGCCAGG + Intronic
1055623555 9:78150164-78150186 TCCCACAGCCTGACCTGGGCTGG + Intergenic
1056243448 9:84670587-84670609 TATCAGAGGCTGAGCTGGTCCGG - Exonic
1057250544 9:93497760-93497782 GGCCAGAGGCTGAGGTAGCCTGG + Intronic
1058855220 9:109055364-109055386 TTCTACAGGCTGACCTGGCAGGG + Intronic
1059320102 9:113462708-113462730 TGCCAGAGGCTGAGCTGAGCTGG - Intronic
1060897064 9:127225013-127225035 TGTAACAGGCTGAGCGGGCGCGG + Intronic
1061193709 9:129096189-129096211 TGCCACAGGCTGAAGAGGGCAGG - Intronic
1061478753 9:130885984-130886006 TGCCCCAGACTGAGCTCTCCAGG + Intronic
1061489548 9:130937709-130937731 TGCCCCAGGCTGGGCTGCCAAGG - Intronic
1061918561 9:133769816-133769838 TCACACAGGCCGAGCTGGACAGG - Intronic
1062288572 9:135784624-135784646 TGCCCCTGGCTGCGCTGGGCTGG + Intronic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1062614624 9:137390810-137390832 TGAAGGAGGCTGAGCTGGCCTGG - Intronic
1188630194 X:32347474-32347496 TTCCACAAGCTGAGTTGGCAAGG + Intronic
1189160382 X:38804085-38804107 GGCGAGAGGCGGAGCTGGCCCGG + Exonic
1190739761 X:53281264-53281286 GGCCACAGGCTGTGCTGCTCAGG + Intronic
1192445873 X:71210788-71210810 TTCCACAGCCTGAGCTGGCATGG + Intergenic
1198823958 X:140679532-140679554 TGTCACAGGCTGAGCTGATGAGG + Intergenic
1198969469 X:142265796-142265818 TGCCACACGCTGCTCTGGCGAGG - Intergenic
1199854518 X:151749774-151749796 GGACTCAGGCTGGGCTGGCCAGG - Intergenic
1200394695 X:155977020-155977042 TGCCACATGCTGCTCTGGCGAGG + Intergenic
1200700859 Y:6401367-6401389 TGGTACAGGCAGAGCTGGCTTGG + Intergenic
1200703704 Y:6423653-6423675 TGGTACAGGCAGAGCTGGCTTGG + Intergenic
1200705397 Y:6438358-6438380 TGGTACAGGCAGAGCTGGCCTGG + Intergenic
1200910458 Y:8527198-8527220 TGGTACAGGCGGAGCCGGCCTGG - Intergenic
1200915095 Y:8564542-8564564 TGGTACAGGCAGAGCCGGCCTGG - Intergenic
1200915407 Y:8567028-8567050 TGGTACAGGCAGAGGTGGCCTGG - Intergenic
1200917389 Y:8583306-8583328 TGGTACAGGCAGAGCCGGCCTGG - Intergenic
1200921575 Y:8618073-8618095 TGCCACAGGCAGAGCCGGCATGG - Intergenic
1200923991 Y:8638081-8638103 TGGTACAGGCAGAGCTGGCCTGG - Intergenic
1200927961 Y:8671500-8671522 TGGTAGAGGCAGAGCTGGCCTGG - Intergenic
1200933955 Y:8722098-8722120 TGGTACAGGCAGAGCTGGTCTGG + Intergenic
1200938112 Y:8756096-8756118 TGGCACAGGCAGGGCTGGCCAGG + Intergenic
1200939784 Y:8769412-8769434 TGGTACAGGCAGAGCTGGCCTGG + Intergenic
1200962241 Y:9006277-9006299 TGGTACAGTCGGAGCTGGCCTGG - Intergenic
1200963006 Y:9012157-9012179 TGGTACAGGCATAGCTGGCCTGG - Intergenic
1200980499 Y:9259426-9259448 TGGTATAGGCAGAGCTGGCCTGG - Intergenic
1200981336 Y:9265761-9265783 TGCTACAGGCAGAGCCGCCCTGG + Intergenic
1201028714 Y:9726350-9726372 TGGTACAGGCAGAGCTGGCCTGG - Intergenic
1201030407 Y:9741054-9741076 TGGTACAGGCAGAGCTGGCTTGG - Intergenic
1201033253 Y:9763331-9763353 TGGTACAGGCAGAGCTGGCTTGG - Intergenic
1202125798 Y:21567909-21567931 TGCTACAGGCAGAGCCAGCCTGG - Intergenic
1202128756 Y:21591499-21591521 TGGTACAGTCGGAGCTGGCCTGG - Intergenic
1202130264 Y:21602884-21602906 TGGTACAGGCAGAGCTGACCTGG + Intergenic
1202148958 Y:21827666-21827688 TGGTACAGGCAGAGCTGGCCTGG - Intergenic
1202179598 Y:22128340-22128362 TGGTACAGGCAGAGCTGGCCTGG + Intergenic
1202180152 Y:22132893-22132915 TGCTACAGGCAGAGTTGGCCTGG + Intergenic
1202182414 Y:22150857-22150879 TGGTACAGCCAGAGCTGGCCTGG + Intergenic
1202208946 Y:22435545-22435567 TGGTACAGCCAGAGCTGGCCTGG - Intergenic
1202211208 Y:22453506-22453528 TGCTACAGGCAGAGTTGGCCTGG - Intergenic
1202211763 Y:22458054-22458076 TGGTACAGGCAGAGCTGGCCTGG - Intergenic