ID: 1141560642

View in Genome Browser
Species Human (GRCh38)
Location 16:84865534-84865556
Sequence AAAAGGCAACAGATGTATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 1, 2: 4, 3: 32, 4: 368}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141560642_1141560648 -6 Left 1141560642 16:84865534-84865556 CCCAAATACATCTGTTGCCTTTT 0: 1
1: 1
2: 4
3: 32
4: 368
Right 1141560648 16:84865551-84865573 CCTTTTTTGCTTGGGGAGCTTGG 0: 1
1: 0
2: 0
3: 14
4: 232
1141560642_1141560651 17 Left 1141560642 16:84865534-84865556 CCCAAATACATCTGTTGCCTTTT 0: 1
1: 1
2: 4
3: 32
4: 368
Right 1141560651 16:84865574-84865596 AGGCCACAGGTTTCCAACTCTGG 0: 1
1: 0
2: 3
3: 20
4: 174
1141560642_1141560650 4 Left 1141560642 16:84865534-84865556 CCCAAATACATCTGTTGCCTTTT 0: 1
1: 1
2: 4
3: 32
4: 368
Right 1141560650 16:84865561-84865583 TTGGGGAGCTTGGAGGCCACAGG 0: 1
1: 0
2: 2
3: 199
4: 1019
1141560642_1141560649 -3 Left 1141560642 16:84865534-84865556 CCCAAATACATCTGTTGCCTTTT 0: 1
1: 1
2: 4
3: 32
4: 368
Right 1141560649 16:84865554-84865576 TTTTTGCTTGGGGAGCTTGGAGG 0: 1
1: 0
2: 1
3: 17
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141560642 Original CRISPR AAAAGGCAACAGATGTATTT GGG (reversed) Intronic
901802088 1:11714220-11714242 AAAGCACAACAGATTTATTTTGG + Intronic
901912862 1:12474748-12474770 AAAAGGCAACAGTTAAATTTCGG - Intronic
902425088 1:16314264-16314286 AAAAAGTAAAAGATGTATATAGG + Intronic
904432485 1:30473475-30473497 AAAAGGCAAGACATTTCTTTAGG - Intergenic
904692510 1:32304371-32304393 AAAAGGCAGAAGATATTTTTAGG + Intronic
906866521 1:49427042-49427064 AAATGTCAACAGATGTAGTGAGG + Intronic
907313376 1:53552518-53552540 AAAAACCAACAGATGCATTTGGG + Intronic
907934940 1:59033572-59033594 GAAAGGCAACAGATATTGTTGGG - Intergenic
908144847 1:61229671-61229693 AAAAGGCAATAAATGCATGTTGG - Intronic
908468754 1:64421464-64421486 TGAATGAAACAGATGTATTTTGG - Intergenic
908814611 1:68018950-68018972 AAAAAGTAACTGATTTATTTAGG + Intergenic
909215505 1:72882541-72882563 AAAAGGGAACAGTTTTCTTTTGG + Intergenic
909855730 1:80528897-80528919 AAAAGGAAACAACTTTATTTTGG - Intergenic
910474101 1:87588496-87588518 ACAAGGCATAATATGTATTTTGG - Intergenic
911087058 1:93987818-93987840 GAAAGGCAAAAGGGGTATTTGGG + Intergenic
911109299 1:94165588-94165610 AAAAGGCCAGAGATCTCTTTGGG + Intronic
911191152 1:94949768-94949790 TAAAGGAAACACATTTATTTGGG - Intergenic
911461505 1:98196778-98196800 AAGAGTCAGCCGATGTATTTGGG + Intergenic
911648585 1:100361643-100361665 AAAAGGCACAAGAGGTGTTTGGG + Intronic
911694762 1:100877576-100877598 AGAAGGCACCAGATGAATTATGG - Exonic
912092059 1:106090833-106090855 AAATGTCAACATATGAATTTTGG - Intergenic
912197075 1:107410563-107410585 CAAAGGCTACAGATTTATTTTGG - Intronic
913465254 1:119134464-119134486 AGAAAGCTACAGATGAATTTTGG + Intronic
916106529 1:161436681-161436703 AAAAGGCCAGAGATTTACTTGGG + Intergenic
916433653 1:164756572-164756594 AAAAGGCATCACATAAATTTTGG + Intronic
916472122 1:165134306-165134328 AGAAGGAAGCAGATGTGTTTTGG - Intergenic
916988290 1:170214999-170215021 AGAGGGAAACAGATTTATTTTGG + Intergenic
917193231 1:172441014-172441036 AATAGGCAAGAGATGGTTTTAGG - Intronic
918187853 1:182143778-182143800 GAAAGGGAACAGATGTTTATTGG - Intergenic
918359469 1:183741060-183741082 TATAGGCACCAGATGTATCTGGG + Intronic
918554876 1:185786752-185786774 AAAATGCAACAGTTTTAATTTGG - Intronic
918927269 1:190804345-190804367 AGAAGGAAAATGATGTATTTAGG + Intergenic
919023483 1:192138014-192138036 AAAATTCAACACATGGATTTTGG + Intergenic
920387054 1:205576654-205576676 AACAGGCAATAAATGTATTTCGG + Intronic
920730714 1:208481396-208481418 AAAAGACAAAAGATAGATTTAGG - Intergenic
921494093 1:215815161-215815183 AAGAGGCAACACAGGTATTGCGG - Intronic
921522858 1:216177920-216177942 GAAAGTCCACAGATGTAGTTTGG - Intronic
921640066 1:217542664-217542686 AAAAGGAAATAGATGTTTATTGG - Intronic
921799908 1:219390769-219390791 AAAAGGTAACAAATTTATTAAGG - Intergenic
922013867 1:221622821-221622843 AACTGGCAACAGATCTATTATGG - Intergenic
922944662 1:229502602-229502624 TAAAGGCAAAAAGTGTATTTGGG + Intronic
924137906 1:240989861-240989883 TAAAGGGAAAGGATGTATTTAGG + Intronic
1063077161 10:2729035-2729057 AAGAGGCGACAGATGTGTCTCGG - Intergenic
1063797559 10:9530006-9530028 AAAAGACAACAGATGTTGGTGGG + Intergenic
1065379935 10:25079695-25079717 AAATGGCAACAGACTTTTTTTGG - Intergenic
1065854144 10:29815996-29816018 GAAAATCAAAAGATGTATTTTGG + Intergenic
1067941777 10:50662618-50662640 AGAAGGCCACAGCTGTCTTTGGG - Intergenic
1068598879 10:58934763-58934785 AAAAGGGAACACATGAATTAAGG + Intergenic
1070863024 10:79687576-79687598 AGAAGGCCACAGCTGTCTTTGGG - Intergenic
1071347971 10:84711472-84711494 CAAGGGAAACAGATGTATTAAGG - Intergenic
1071395259 10:85217441-85217463 AAAAGGCATCTGATATAGTTTGG + Intergenic
1072209462 10:93233074-93233096 AAAAGGCCAGAGGTGTCTTTGGG + Intergenic
1072841197 10:98775850-98775872 AAAAAGAAACAGATTTATTGGGG - Intronic
1073824878 10:107309228-107309250 TAAATGCAACATATGAATTTTGG - Intergenic
1074264127 10:111884041-111884063 AAAAGGGAACAGAGATATTTGGG - Intergenic
1076369986 10:129946309-129946331 AAATGGGAACAAATGTGTTTGGG + Intronic
1078947916 11:16092233-16092255 AAAAGGCAACAAAAGTGTTTTGG + Intronic
1079314627 11:19397174-19397196 AAGAGGGAACTGATGTGTTTAGG + Intronic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1080118830 11:28651036-28651058 AAAAGGCAACAGATGTCTTTGGG - Intergenic
1081089328 11:38843302-38843324 AAAAGGCAAGAGATGAGTTTGGG + Intergenic
1083044761 11:59724318-59724340 AAAAAGCAATAGATGTAGGTGGG + Intronic
1083924280 11:65796592-65796614 AAAAGGCAACAGATACAATTTGG - Exonic
1086138439 11:83466876-83466898 AAAAGGAAACTAATGTATGTAGG + Intronic
1086248544 11:84785968-84785990 AAAAGGTAACAGATCTTCTTGGG - Intronic
1088845908 11:113667139-113667161 AAAAGGGAACAGAACTATATTGG - Intergenic
1089042469 11:115465481-115465503 AGAAGGAAATAAATGTATTTAGG + Intronic
1089241886 11:117088461-117088483 AAAAGTCAAAAGATGTATTAAGG + Intronic
1090553740 11:127851435-127851457 AACAGACAGCAAATGTATTTGGG + Intergenic
1092268606 12:7003061-7003083 AAAATGCTACAAATGTATGTTGG - Intronic
1093206171 12:16253338-16253360 AAAAGGCAACATATGGAATGGGG + Intronic
1093262492 12:16956429-16956451 AAAATGCAATAAATGCATTTGGG - Intergenic
1093301331 12:17460835-17460857 AATAGGAAGCAGATTTATTTTGG + Intergenic
1093562623 12:20560441-20560463 AAAATGTAGCAGATGTCTTTGGG + Intronic
1094177476 12:27556041-27556063 CAAAAGCAATAGATGTATTCAGG - Intronic
1095418951 12:42005402-42005424 GAAAGGCAACAGAATTCTTTGGG - Intergenic
1095433227 12:42157108-42157130 TAAAGAAAACAGATTTATTTTGG + Exonic
1097496116 12:60337389-60337411 AAAAGACAAGAGATAAATTTTGG - Intergenic
1097750804 12:63349965-63349987 AGCAGGGATCAGATGTATTTTGG + Intergenic
1098191118 12:67949755-67949777 AAAAGGCAGCAGTTGAATGTAGG - Intergenic
1098582976 12:72122785-72122807 AAAACGAAAAAGATATATTTGGG - Intronic
1098674615 12:73273130-73273152 TACAGGAAAAAGATGTATTTTGG + Intergenic
1099189445 12:79547500-79547522 AAAGGGCAGCAAAAGTATTTGGG + Intergenic
1099302114 12:80909871-80909893 AAATGCCAACAGGTGTTTTTAGG - Intronic
1099539783 12:83893402-83893424 AAAAAGCAGAAGATGTATGTAGG + Intergenic
1099664848 12:85614801-85614823 AAAAGGAAAAAGAAGTGTTTGGG - Intergenic
1099859275 12:88207814-88207836 ATAAGGCAAAAGCAGTATTTGGG + Intergenic
1100682957 12:96948950-96948972 AGAAGTCAACAGATGTCTTGAGG + Intronic
1101151529 12:101887203-101887225 AAAAGGCTACAAATTTTTTTCGG - Intronic
1101201713 12:102443316-102443338 AAAAAGCAAAGGATGCATTTTGG - Intronic
1102831107 12:116000599-116000621 AAAAGGAAAGAGTTGGATTTTGG - Intronic
1103313438 12:120031591-120031613 AAAAGGAAACTGAAGTATGTAGG - Intronic
1104202710 12:126607288-126607310 AAGAGGAAACATATTTATTTTGG + Intergenic
1104617698 12:130284250-130284272 AAAAGGCACCTGATATAGTTTGG + Intergenic
1105959692 13:25320501-25320523 AAAATGCAAAACATGTATTAAGG - Intronic
1106352703 13:28949035-28949057 AAAAGGGAACATGTGTATGTAGG + Intronic
1106778521 13:33032242-33032264 TAATGGGAACAGATGTATCTGGG - Intronic
1107472671 13:40704901-40704923 AAAAGAAAAGAGATTTATTTTGG - Intergenic
1107502321 13:40993241-40993263 CAAAAGCAACAGATGTTGTTGGG + Intronic
1108075836 13:46678912-46678934 AAAAGATAACAGATACATTTAGG - Intronic
1108105071 13:47000036-47000058 AAAATGCCACAGAAATATTTAGG - Intergenic
1110239445 13:73250643-73250665 AAAAGGCAACATTTACATTTTGG - Intergenic
1111366262 13:87249835-87249857 AAAAGGAAAGAGATGTATTTTGG + Intergenic
1113503616 13:110797933-110797955 AAAAGGAAATACATATATTTAGG + Intergenic
1117693774 14:58338182-58338204 AAAATTCAACAGATGTCTGTAGG + Intronic
1118500672 14:66359504-66359526 AAATGGCATCTGATGTATTTGGG - Intergenic
1119020441 14:71106761-71106783 AATAGGCAAAAGATGTAACTAGG - Intronic
1119377916 14:74209493-74209515 AAAATGTTAAAGATGTATTTTGG - Intergenic
1119908822 14:78331150-78331172 AAAAGTCAACTCATATATTTTGG - Intronic
1119997219 14:79266515-79266537 AAAATGCATCTGATGTTTTTTGG - Intronic
1120322484 14:82981957-82981979 AAAAAAAAAAAGATGTATTTTGG + Intergenic
1120332601 14:83112586-83112608 AAAAGGCAGCAGATGTGCATGGG - Intergenic
1123808828 15:23902944-23902966 AAACAGCAATATATGTATTTTGG - Intergenic
1124828475 15:33124230-33124252 AAAAGGAAACAGATGTTATGTGG + Intronic
1126285006 15:47000325-47000347 AAAATCCAACAGATGTAAGTAGG + Intergenic
1128517923 15:68354919-68354941 AAAAGGCACCAGCTGTAGTTTGG + Intronic
1131112367 15:89773237-89773259 AAAAGGTAACAGCTGTTATTAGG - Intronic
1131698452 15:94905924-94905946 AAAAGACAGCAGATATATTCTGG + Intergenic
1132159838 15:99530106-99530128 CAAAGGCACCAAATATATTTAGG + Intergenic
1134295002 16:12937890-12937912 AAAGGGCAAAAGATATATCTAGG - Intronic
1134510734 16:14844936-14844958 AGAACGCAGCAGGTGTATTTAGG + Intronic
1134973461 16:18551255-18551277 AGAACGCAGCAGGTGTATTTAGG - Intronic
1136241593 16:28947920-28947942 AACAGGCACCAGATGGCTTTGGG + Intergenic
1138119622 16:54388969-54388991 CAAATGCAAAAGATGGATTTGGG - Intergenic
1138932854 16:61682476-61682498 CAAAAGCAACACAAGTATTTAGG - Intronic
1140678063 16:77353347-77353369 AAAAGGCATATAATGTATTTGGG + Intronic
1140682019 16:77394391-77394413 AAAAGACAATAGCTTTATTTGGG + Intronic
1141560642 16:84865534-84865556 AAAAGGCAACAGATGTATTTGGG - Intronic
1143785947 17:9255822-9255844 AAAAGCCAACTGCTGTCTTTTGG + Intronic
1146780384 17:35665833-35665855 AGAAGCAAACAGATGTACTTTGG + Intronic
1147035024 17:37673465-37673487 AAAAGCAAACAGATGGATTATGG - Intergenic
1148404028 17:47396091-47396113 AAATGCCAACATATGCATTTAGG + Intronic
1148425260 17:47589954-47589976 AAAAGACAACAGATAAATATAGG - Intronic
1149137430 17:53385552-53385574 AAAAGACAATAGATAAATTTTGG + Intergenic
1149236491 17:54596415-54596437 AAAAAACAACAGATTTATATGGG + Intergenic
1150417030 17:64996079-64996101 AAAAGAAAACAACTGTATTTAGG - Intergenic
1150624315 17:66831908-66831930 AAAAGCCAACAGCTGTGCTTGGG - Intergenic
1151735840 17:75939930-75939952 AAAAGAAAACACATGTATTCAGG - Intronic
1153296700 18:3553059-3553081 AAAAGGATACACATGTATCTTGG - Intronic
1155417614 18:25616847-25616869 AAATGGCAAGAGTTGAATTTGGG + Intergenic
1155805636 18:30167935-30167957 AAAAGGCAAAAGATAAGTTTTGG - Intergenic
1156700540 18:39819385-39819407 AAAAGGAAAGAGAGTTATTTGGG - Intergenic
1157528015 18:48399878-48399900 AAAAAGCAGCAGGTGTGTTTGGG - Intronic
1158203707 18:54967646-54967668 AAAAGGCAATAGAAATAATTGGG + Intergenic
1159240549 18:65737799-65737821 GAAAGGCAACAGATGTTGCTAGG - Intergenic
1159825468 18:73203374-73203396 AAAAGGCAAAAGATGTAAATAGG - Intronic
1163626093 19:18390674-18390696 CAAAGGCAACAGCTGTTGTTTGG - Intergenic
1164052318 19:21593892-21593914 GAAAGTCAACACCTGTATTTTGG - Intergenic
1164200204 19:23011797-23011819 AAAAGGCCAGAGATCTACTTGGG + Intergenic
1166334488 19:42097048-42097070 AAAAAGCAACAGCTCTATCTGGG + Intronic
1167425329 19:49427230-49427252 AAAATGCAACAGATGTACCCAGG + Exonic
925682821 2:6440819-6440841 AAAAGTCCAGAGCTGTATTTTGG + Intergenic
926838965 2:17057434-17057456 AAAAAGAAACAAATGTACTTTGG - Intergenic
927074313 2:19562009-19562031 AAAAGCCAAAAGATTTACTTAGG + Intergenic
927270292 2:21200457-21200479 TAAAGACAGCAGATGTAATTAGG - Intergenic
928678415 2:33673452-33673474 ATAAGGCTACAGATATATTCAGG - Intergenic
929292966 2:40214354-40214376 AAAAGACAGCAGATATATTTGGG - Intronic
929961698 2:46502054-46502076 AAAAGGCAAAAGAGGCATCTAGG - Intronic
930330304 2:49975009-49975031 CACTGGAAACAGATGTATTTGGG - Intronic
931047144 2:58367226-58367248 AAAAGTGAACAGATGTATTTTGG - Intergenic
931523224 2:63122991-63123013 TAAGGGCAACACATGTATGTAGG + Intronic
932177044 2:69612532-69612554 AAACGACAACAGTTGTATTTTGG + Intronic
933179059 2:79209767-79209789 GAAAGGGAACTGATGTAGTTGGG - Intronic
933238731 2:79895858-79895880 AATGGGCAGCAGATCTATTTTGG + Intronic
935022709 2:99247072-99247094 AAAAGACTGCACATGTATTTAGG - Intronic
936246258 2:110830415-110830437 AAAATGCAATAGATTTATTGTGG - Intronic
939324769 2:140673919-140673941 AAAAGAAAAGAGATATATTTCGG - Intronic
939772475 2:146338615-146338637 ATAAGGTAACAGATGTAGTCTGG - Intergenic
939937994 2:148315388-148315410 TAAAACAAACAGATGTATTTTGG - Intronic
940071570 2:149694063-149694085 AAAATGCAAAAGATTTAGTTTGG - Intergenic
940442258 2:153730882-153730904 AAAAGACAACAGATGTTGATGGG + Intergenic
940461745 2:153972593-153972615 AAAATGCTACAGATGAATTGGGG + Intronic
940513336 2:154647684-154647706 AGAAGGCAACAACTGTTTTTGGG + Intergenic
940550530 2:155150244-155150266 AAAAGACCACATTTGTATTTTGG - Intergenic
940666817 2:156618915-156618937 AAATGGCAACACTTGAATTTTGG - Intergenic
941362520 2:164569782-164569804 AAAAAGTCACAGATCTATTTTGG + Intronic
941542917 2:166809021-166809043 AAAAGGCTAGAAATGTAATTAGG - Intergenic
941578018 2:167259748-167259770 AAAAAGTTACAGAAGTATTTTGG - Exonic
941743681 2:169063783-169063805 AAATGTCAACACAAGTATTTTGG - Intergenic
942798507 2:179849419-179849441 CAAAGGCAACACATCTATTTGGG + Intronic
943284788 2:185983858-185983880 AAAAGGCAACAGAAGCTTCTTGG - Intergenic
945190041 2:207178472-207178494 AAAAGAAAAGAGATGTATTTTGG - Intergenic
945367883 2:208978566-208978588 AAAAGGGAAAAGAAGTATGTTGG - Intergenic
945616961 2:212083361-212083383 AAATGGCAACAGATAGAATTGGG + Intronic
945758565 2:213881815-213881837 AAAAGGCATCTGATATAGTTAGG - Intronic
946477282 2:220019673-220019695 TAAAGGCAACAAATATTTTTAGG - Intergenic
946816560 2:223584217-223584239 ACAAGGCAATAGATATATTCAGG + Intergenic
947126236 2:226871509-226871531 CAAAGGCAATATATGAATTTTGG - Intronic
947952118 2:234157253-234157275 AAAAGTCTACAGATATATTTTGG - Intergenic
948512972 2:238484452-238484474 AAAACTCAACATACGTATTTGGG - Intergenic
1170295779 20:14823754-14823776 AAAAGCCACCAAATATATTTGGG - Intronic
1170373075 20:15670574-15670596 AAAATGTCTCAGATGTATTTGGG - Intronic
1170781925 20:19433560-19433582 ACAAGGCAGCAGAAGAATTTTGG - Intronic
1170982061 20:21223592-21223614 AAAAGTCATCAAATATATTTAGG - Intronic
1171194993 20:23189895-23189917 AAAATGCAGCAGAAGGATTTGGG - Intergenic
1172646087 20:36470530-36470552 AAAAAGCAATACATGTATGTTGG + Intronic
1173048611 20:39537049-39537071 AAATGGAAACAGCTTTATTTGGG - Intergenic
1175821513 20:61912369-61912391 AAAAGGAAAAAGATGACTTTGGG - Intronic
1176295994 21:5073489-5073511 AGAAGGGAACAGATGATTTTGGG - Intergenic
1176691082 21:9910400-9910422 AAAAGGCAAAAAAATTATTTTGG - Intergenic
1177153096 21:17474123-17474145 TAAAGGCAAGAGGTTTATTTTGG - Intergenic
1177703454 21:24669231-24669253 AAATGGCAAAAGATCTGTTTGGG + Intergenic
1178202239 21:30420706-30420728 ATTAGGCCACAGAGGTATTTTGG - Intronic
1178328750 21:31667226-31667248 AAAAAGCATCAGATGGATTAGGG - Intronic
1178768240 21:35475767-35475789 AAAAGATAACAGATGTGTTGGGG + Intronic
1179037190 21:37768488-37768510 TAAATTCAACAGTTGTATTTTGG - Intronic
1184501627 22:44878207-44878229 CACAGGCAACAGCTGGATTTTGG + Intergenic
950564242 3:13756763-13756785 AAATCCCAACAGATTTATTTGGG - Intergenic
950882223 3:16331636-16331658 AAAATGGAACTAATGTATTTAGG - Intronic
952057066 3:29460476-29460498 AAAATGCCACTGATGTATCTGGG + Intronic
953705681 3:45228095-45228117 AAAAGACAAGAGATCTATTTGGG + Intergenic
954337655 3:49929273-49929295 AAAAAGCAACAGAGGTAACTGGG - Intronic
954991563 3:54844894-54844916 TAAAGGCAAAAATTGTATTTGGG - Intronic
955307375 3:57847772-57847794 TAATGTCAAAAGATGTATTTTGG - Intronic
958074678 3:88660943-88660965 AAAGGGCAAAAGCAGTATTTGGG - Intergenic
958520159 3:95174962-95174984 CAACAGCAACAAATGTATTTGGG - Intergenic
959339274 3:105108306-105108328 AAAAGGTTCCAAATGTATTTTGG + Intergenic
959692063 3:109208581-109208603 AAAAGTCAATAGTTGTATTTTGG - Intergenic
959912610 3:111780543-111780565 TAAAGAAAACAGATTTATTTTGG - Intronic
960235195 3:115273778-115273800 AAAAAGCAACAGATAGATGTTGG - Intergenic
961111156 3:124284273-124284295 AAAGGGCAAAAGATGCATTGGGG - Intronic
961159549 3:124711616-124711638 ACAGGGCAACAGCTGTATCTGGG + Intronic
962056589 3:131878485-131878507 AAGAGGCAAAAGAGGAATTTTGG + Intronic
963512207 3:146260913-146260935 AAAGAGCAACTGAAGTATTTGGG + Intergenic
963826960 3:149966289-149966311 AAAAGTGAACAGAATTATTTTGG + Exonic
963871209 3:150415990-150416012 ATTAGGAAACAGATTTATTTGGG - Intronic
965866805 3:173214973-173214995 AAAAGGCAACTGGTGCAGTTTGG - Intergenic
966045303 3:175541643-175541665 AAAAGGAAACAAGTGTATCTTGG - Intronic
966457810 3:180137498-180137520 AAAAGGAATGAGATATATTTTGG - Intergenic
967605128 3:191435880-191435902 AAAAGGCAACTCAGATATTTTGG - Intergenic
967728787 3:192887515-192887537 AAAAGGAAAAAGATATATTTAGG + Intronic
967774298 3:193370443-193370465 AAAATGCATCAGAAGTAGTTTGG + Intronic
968410097 4:383068-383090 AAAAGATAACAGAAGCATTTAGG - Intronic
968421294 4:487270-487292 AAAAGATAACAGAAGCATTTAGG - Intronic
970898170 4:21127326-21127348 TAAAGGCAAGTGATGTATTAGGG - Intronic
971282570 4:25253026-25253048 AAAAGGCTACAGCTGAATGTGGG - Intronic
971871039 4:32238733-32238755 TAAAGGCAATTGATTTATTTGGG - Intergenic
972461610 4:39308871-39308893 AAAAGGAAACAGATGTGTTTTGG - Exonic
973616626 4:52685435-52685457 TAAAGGAAAGAGATTTATTTTGG + Intergenic
973633102 4:52838012-52838034 AAAAGGGAACAGAAGCATCTTGG - Intergenic
973637540 4:52874136-52874158 AGAATGCAACAAATGTCTTTGGG + Intronic
975171122 4:71232797-71232819 AAAAGGCAACAAAAGACTTTAGG + Intronic
975403829 4:73967466-73967488 AAAAAACCACAGATGTACTTAGG + Intergenic
975510535 4:75189935-75189957 AATAGGCAACAAATTTATCTGGG + Intergenic
975785150 4:77879676-77879698 AGAAGCCAACAGAAGGATTTTGG - Intronic
976010716 4:80485442-80485464 CAAAGTCCACACATGTATTTTGG - Intronic
976151120 4:82093011-82093033 AAAAGGAAAATGATATATTTTGG + Intergenic
976240250 4:82947833-82947855 AAAAGACAACTGATGTATGATGG + Intronic
976542940 4:86298738-86298760 AAATGGTAAAAGTTGTATTTGGG - Intronic
976929306 4:90544823-90544845 AAAAGACAAGACATGAATTTGGG + Intronic
977465949 4:97383052-97383074 AAAAGGCACAACATGGATTTTGG + Intronic
979303931 4:119120502-119120524 AAATAGGAACAGATATATTTTGG + Intergenic
979419958 4:120491430-120491452 AAAAAGCAACTGGTGGATTTTGG + Intergenic
980182304 4:129416079-129416101 AAAATGCAACAGTGGGATTTTGG - Intergenic
980363657 4:131770574-131770596 AAAAGGCAAAAAAATTATTTTGG - Intergenic
981129283 4:141140480-141140502 AAAAGGAAACAGATGTATTGTGG - Intronic
981390696 4:144187604-144187626 AAAAGGGCACAACTGTATTTTGG - Intergenic
981390748 4:144188669-144188691 AAAAGGGCACAAATGTATTTTGG - Intergenic
981791939 4:148547904-148547926 AAAAGGCAAAAGATAAATGTTGG + Intergenic
982242166 4:153311155-153311177 AATGGGCAATAGTTGTATTTTGG - Intronic
983731162 4:170995382-170995404 AAAAGGAAACAGATGGATCATGG - Intergenic
986384711 5:7220731-7220753 AAAAGGCAAATAGTGTATTTGGG - Intergenic
987104746 5:14627046-14627068 AAAAGGCAAGAGATAAATGTTGG + Intergenic
987197885 5:15545803-15545825 AAAAAGTAAAAGATGTATTAGGG + Intronic
988125985 5:27037912-27037934 AAAATGCCACAGATGCATATTGG - Intronic
988190985 5:27934064-27934086 AAAAGGCAACATACAAATTTTGG - Intergenic
988210006 5:28191497-28191519 AAAGGTCAACAAATTTATTTTGG + Intergenic
988617513 5:32789675-32789697 AAAAGGAAAGTGATGCATTTGGG - Exonic
989249160 5:39288243-39288265 AAAAGGCAATAGAATTTTTTTGG + Intronic
990275766 5:54194437-54194459 AAAAGACCTCAGAAGTATTTTGG + Intronic
990727050 5:58767545-58767567 AAGAGGCTGCAGAGGTATTTGGG + Intronic
991221509 5:64224754-64224776 CATAGGCAACATATGCATTTTGG - Intronic
993855513 5:93069752-93069774 ACAAGACAACAGATGCATTTTGG + Intergenic
994289968 5:98017523-98017545 AAGAGAAATCAGATGTATTTTGG - Intergenic
994789066 5:104200962-104200984 AGAGGGCAGCAGATGAATTTTGG - Intergenic
995166043 5:109042802-109042824 AAAAGGCATGACACGTATTTAGG + Intronic
995543531 5:113207136-113207158 AAAAGGTTACACATGAATTTGGG + Intronic
995584767 5:113636761-113636783 AAAATGAAACAGTAGTATTTAGG + Intergenic
996216932 5:120879756-120879778 AAAAGGTACCTGCTGTATTTGGG - Intergenic
996904336 5:128580545-128580567 AAAAGGAAAAAAATGTACTTTGG + Intronic
997109568 5:131059948-131059970 AAAAGGCAAAAGAATTATCTAGG + Intergenic
997309685 5:132869462-132869484 AAAAGGCAATAGCAGTAATTAGG - Intergenic
997664592 5:135619997-135620019 AAATGGCAACAGAAGTAGGTTGG + Intergenic
997846843 5:137294152-137294174 AAATGGCCACATATGTCTTTTGG + Intronic
998091296 5:139371826-139371848 AAAAGTCAACATACGGATTTTGG - Intronic
998874887 5:146589180-146589202 ACAAGGCAGCAGATGGAATTTGG + Intronic
999904221 5:156121735-156121757 AAAAGGGAAGAGATGCATTTAGG - Intronic
1000530252 5:162410469-162410491 GAAAAGCCAGAGATGTATTTTGG - Intergenic
1001095160 5:168770323-168770345 AAAAGACAGCTGATGTAATTAGG - Intronic
1002956847 6:1873963-1873985 CAAAGGCCACAGCTGTATTAGGG + Intronic
1003684701 6:8290389-8290411 AATAGGCAACAACTGTATCTTGG - Intergenic
1004074374 6:12331618-12331640 AAAAGGGAAAAAATTTATTTTGG + Intergenic
1004089267 6:12483494-12483516 AGAAAGGAACAGATTTATTTTGG + Intergenic
1004242449 6:13937295-13937317 AAAAGGCAAAGGAAGGATTTGGG - Intronic
1005054182 6:21714505-21714527 AAAAGGCAACCCATGGAATTTGG + Intergenic
1006330451 6:33386597-33386619 AAATGTCAACATATGAATTTTGG - Intergenic
1006410454 6:33870596-33870618 AATAGACAGCAGAAGTATTTGGG - Intergenic
1007095271 6:39209096-39209118 AAAAAGCAAAAGGAGTATTTAGG + Intronic
1008107650 6:47456910-47456932 GAAAGGAGACAGATGGATTTGGG + Intergenic
1008521952 6:52370276-52370298 AAAAGGCAATAGATGTTGTTGGG + Intronic
1008527147 6:52418678-52418700 AACAGGAAACAGATGTAGTAAGG + Intergenic
1008638314 6:53434763-53434785 AAAGGGCAACAGAAGGATTATGG + Intergenic
1010431014 6:75778691-75778713 AAATGGCAACAGAAGTAATTAGG - Intronic
1010690334 6:78903492-78903514 AAAAAGAAAAAGATGTATTAGGG + Intronic
1011103047 6:83745485-83745507 AAAAGGAAACAGATGACTGTAGG + Intergenic
1011510267 6:88093154-88093176 AAAAGGCAAAAGTTGCCTTTTGG + Intergenic
1014015644 6:116527134-116527156 AAAAGGCAACTAAATTATTTGGG - Intronic
1014034751 6:116753396-116753418 ACCAGGCAATAGATGTATATTGG + Intronic
1014972996 6:127841974-127841996 AAAAGGCAGGAGCTCTATTTAGG + Intronic
1015301862 6:131661832-131661854 AAAAGGCAACATATGAAATGGGG - Intronic
1015320989 6:131874532-131874554 AAAAAACAACAGATGTAGTAAGG + Intronic
1016064401 6:139664406-139664428 AAAAAACAAGAGATTTATTTTGG + Intergenic
1016345613 6:143110766-143110788 TAAAGGCAGCAGATGTGTGTGGG + Intronic
1016357670 6:143235685-143235707 AAAAGGATACCGTTGTATTTAGG + Intronic
1016443198 6:144106082-144106104 AAATGTCAACAAATGAATTTTGG + Intergenic
1017071002 6:150575691-150575713 CAAAGGCCACAGATGTTTTAGGG + Intergenic
1017576549 6:155811290-155811312 AAAAAGGAACAGGTGTAATTCGG + Intergenic
1020529940 7:9320652-9320674 AATAGTCAACAGAAGTATTTTGG + Intergenic
1022219361 7:28297261-28297283 AACAGTCACCAGAAGTATTTTGG - Intergenic
1022267240 7:28769051-28769073 TAAAGGAAACACATTTATTTGGG + Intronic
1022760158 7:33340298-33340320 AAAAGTTAATAGATATATTTTGG + Intronic
1023026583 7:36056350-36056372 AAAATGCAAGAGATTTATTGGGG + Intergenic
1023302853 7:38792372-38792394 AAAAGGCAAGAGTTGGTTTTAGG - Intronic
1024154468 7:46606091-46606113 AAAAAGCTACAGTTGCATTTGGG - Intergenic
1024389837 7:48795679-48795701 AAAAGTCAACAGCTTTTTTTGGG + Intergenic
1024958579 7:54951524-54951546 ATAAGCAAACAGATGTATTGGGG + Intergenic
1026111860 7:67464832-67464854 AAAAGGAAAGAGGTTTATTTTGG - Intergenic
1027474773 7:78615552-78615574 AAAAGGGAACAGATCCCTTTGGG + Intronic
1028202424 7:87977014-87977036 AAAAGAAAACAGATTTAGTTGGG + Intronic
1028754425 7:94419349-94419371 AGAAGGCCTCTGATGTATTTTGG - Intronic
1029900835 7:104037309-104037331 AAAAGGCAAGAGATAAATGTTGG + Intergenic
1030604548 7:111625681-111625703 AAGAGGAAACACATGTATTGTGG + Intergenic
1030982377 7:116201341-116201363 TACATGAAACAGATGTATTTTGG + Intergenic
1031810751 7:126365232-126365254 AAATGACAATATATGTATTTTGG + Intergenic
1032810555 7:135411056-135411078 AAAAGGAGACTGATGAATTTTGG - Intronic
1032976545 7:137230883-137230905 CAAAGAGAAAAGATGTATTTGGG - Intronic
1034878341 7:154744686-154744708 AAAAGGCAACAGATGCAAGCAGG + Intronic
1036132790 8:6131943-6131965 AAATGGCACCAAATGAATTTGGG + Intergenic
1036288624 8:7467079-7467101 GAAAGGCAACAGATTTGTTTGGG + Intergenic
1036332851 8:7844449-7844471 GAAAGGCAACAGATTTGTTTGGG - Intergenic
1037609257 8:20462675-20462697 AAAAGGAAACATATTTATTAAGG - Intergenic
1037669389 8:21001293-21001315 AAAATTCAACATATGAATTTTGG - Intergenic
1037966624 8:23139374-23139396 AAACGGCAACTGAGGTTTTTCGG + Intronic
1039006029 8:33038105-33038127 AAAAACAAACAAATGTATTTCGG + Intergenic
1040066737 8:43151068-43151090 AAAAGGCACCAAATTTATGTGGG + Intronic
1041019794 8:53627228-53627250 GAATGGCAACAGAGGAATTTTGG - Intergenic
1041319657 8:56600141-56600163 AAAAAACAAAAAATGTATTTTGG + Intergenic
1042219960 8:66463406-66463428 AAAAGGCAGCAGATGCCTTGGGG - Intronic
1042379982 8:68102815-68102837 TACAGGCCACAGATGTTTTTTGG + Intronic
1043549395 8:81352746-81352768 AAAAGACAAAAGATAAATTTTGG - Intergenic
1044788331 8:95820256-95820278 AAAAGATAGCAGATGTATTGAGG + Intergenic
1045818094 8:106301409-106301431 AAAATAAAAAAGATGTATTTGGG + Intronic
1046024066 8:108700949-108700971 AAAAGGAAATAGATGCATTGAGG + Intronic
1046155295 8:110281341-110281363 AAATGGCAACAGTTATATTAGGG + Intergenic
1046201195 8:110929456-110929478 TAAATGCAACAGAATTATTTTGG - Intergenic
1047083945 8:121495696-121495718 AAAAATCATGAGATGTATTTGGG - Intergenic
1047947087 8:129891167-129891189 AAAAGAGAAGAGATGGATTTGGG - Intronic
1048059591 8:130904298-130904320 AAAAGCCAAAAGATGTGCTTAGG - Intronic
1048322271 8:133409251-133409273 AAAATGCTTCAGCTGTATTTGGG - Intergenic
1049981698 9:909651-909673 AAATGGCAAAAGCTGTATTTGGG - Intronic
1050015682 9:1231330-1231352 AACAGGCAACAGATGACATTTGG + Intergenic
1050063127 9:1731239-1731261 AAATGTCAACATATGAATTTTGG + Intergenic
1050073995 9:1845116-1845138 GAAGGGCAAGAGATGCATTTCGG - Intergenic
1050432911 9:5580115-5580137 AGAAGTCCACAGATGCATTTGGG - Intergenic
1051262638 9:15279836-15279858 AAAAGGCAGCAGGTGGAATTTGG - Intronic
1052107677 9:24539192-24539214 AAAAGGAAAGGGATGTAGTTAGG + Intergenic
1052288780 9:26818847-26818869 AAAACAAAACAGATGTATTCTGG - Intergenic
1052365316 9:27605947-27605969 AAATGGCAACAGTAGTATTTGGG - Intergenic
1053627880 9:39895217-39895239 AAAAGGCAAAAAAAATATTTTGG - Intergenic
1054216008 9:62355485-62355507 AAAAGGCAAAAAAAATATTTTGG + Intergenic
1054671473 9:67799864-67799886 AAAAGGCAAAAAAAATATTTTGG - Intergenic
1054831729 9:69632764-69632786 TAAAGGAAATAGATGTTTTTGGG + Intronic
1056976803 9:91264759-91264781 AAAAGCAAAAAGAGGTATTTGGG + Intronic
1057987380 9:99731124-99731146 AAAAAGTAACAGAAGAATTTTGG + Intergenic
1058278647 9:103082387-103082409 AAAAGGCAACAGGAATAATTTGG + Intergenic
1058348060 9:103988341-103988363 AAAAGGAAACAAAAGTTTTTGGG + Intergenic
1058889698 9:109350849-109350871 AAAATGTAACAGATGGACTTAGG - Intergenic
1059016546 9:110522921-110522943 AAAAGGCAACCTATGTATGGAGG - Intronic
1059851550 9:118346747-118346769 AAAATTCAACATATGAATTTTGG - Intergenic
1186287576 X:8062345-8062367 AACAGGCCACAGATGGATTGAGG - Intergenic
1187463002 X:19504150-19504172 AAGAGAAAAGAGATGTATTTAGG + Intronic
1187544571 X:20235582-20235604 GAAAGGCAAAAGGTGTCTTTGGG - Intronic
1187858306 X:23657997-23658019 AAAAGTCAACAGATGTCTATGGG + Intergenic
1188657602 X:32717351-32717373 AAAAGGCCCCAGATGTGTCTTGG + Intronic
1188972243 X:36632462-36632484 AAAGAGCACCAGATGGATTTGGG - Intergenic
1192845431 X:74902485-74902507 AAAAGGTAACAGAAGGATTGGGG + Intronic
1192898602 X:75471007-75471029 AACAGAAAACAGATGGATTTTGG + Intronic
1193548995 X:82866329-82866351 ATAAGAGAACAGATGAATTTTGG + Intergenic
1193753601 X:85379014-85379036 AACAGCCAAGAGATGAATTTGGG + Intronic
1193921342 X:87431169-87431191 AAATGGCAACAGAGGAATATGGG - Intergenic
1194151819 X:90335119-90335141 CAGAAGCAACAGATGTATTGTGG + Intergenic
1194171518 X:90589766-90589788 AAAAGGCAATATATGAATTAAGG - Intergenic
1194940862 X:100008465-100008487 AAAAGGAGACAAATTTATTTGGG + Intergenic
1197069021 X:122270905-122270927 CAGAGGAAACAGACGTATTTGGG - Intergenic
1197645714 X:129014437-129014459 AAAGGGAAAGAGATTTATTTAGG + Intergenic
1197960603 X:132001492-132001514 AAAAAGCAACAGTTGTAACTTGG + Intergenic
1197960740 X:132003433-132003455 AAAAAGCAACAGCTGTAACTTGG - Intergenic
1198377699 X:136055389-136055411 AAAAAGCTCCAGATGTTTTTAGG - Intergenic
1199286318 X:146058459-146058481 AAAATACAACAAATCTATTTTGG - Intergenic
1199386610 X:147230416-147230438 ATAAGGCAAGAAGTGTATTTGGG + Intergenic
1199934453 X:152558652-152558674 TAAAGGAAAGAGATTTATTTTGG + Intergenic
1200498175 Y:3911884-3911906 CAGAAGCAACAGATGTATTGTGG + Intergenic
1200517750 Y:4167517-4167539 AAAAGGCAATATATGAATTAAGG - Intergenic
1201230989 Y:11864064-11864086 AAAAGGCAGCAGCTGCATTTAGG - Intergenic
1201327499 Y:12779541-12779563 CAAAGGAAAGAGATGTATCTGGG - Exonic
1201731519 Y:17209816-17209838 AAAATGCATTAGATGTTTTTAGG + Intergenic