ID: 1141562647

View in Genome Browser
Species Human (GRCh38)
Location 16:84879769-84879791
Sequence CAGGATTATGGGAAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 689
Summary {0: 1, 1: 0, 2: 5, 3: 87, 4: 596}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141562647_1141562662 23 Left 1141562647 16:84879769-84879791 CCTTCTTCCTTCCCATAATCCTG 0: 1
1: 0
2: 5
3: 87
4: 596
Right 1141562662 16:84879815-84879837 CGGCTGCCATTTTGGTTTCTTGG 0: 1
1: 0
2: 1
3: 8
4: 143
1141562647_1141562660 15 Left 1141562647 16:84879769-84879791 CCTTCTTCCTTCCCATAATCCTG 0: 1
1: 0
2: 5
3: 87
4: 596
Right 1141562660 16:84879807-84879829 ATGGCTTCCGGCTGCCATTTTGG 0: 1
1: 0
2: 0
3: 10
4: 150
1141562647_1141562655 -4 Left 1141562647 16:84879769-84879791 CCTTCTTCCTTCCCATAATCCTG 0: 1
1: 0
2: 5
3: 87
4: 596
Right 1141562655 16:84879788-84879810 CCTGCCTGCCTGGGGCCAGATGG 0: 1
1: 0
2: 7
3: 69
4: 643
1141562647_1141562664 30 Left 1141562647 16:84879769-84879791 CCTTCTTCCTTCCCATAATCCTG 0: 1
1: 0
2: 5
3: 87
4: 596
Right 1141562664 16:84879822-84879844 CATTTTGGTTTCTTGGTCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 189
1141562647_1141562657 3 Left 1141562647 16:84879769-84879791 CCTTCTTCCTTCCCATAATCCTG 0: 1
1: 0
2: 5
3: 87
4: 596
Right 1141562657 16:84879795-84879817 GCCTGGGGCCAGATGGCTTCCGG 0: 1
1: 0
2: 1
3: 26
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141562647 Original CRISPR CAGGATTATGGGAAGGAAGA AGG (reversed) Intronic
900335353 1:2160468-2160490 CAGGCCTGTGGGAAGGACGAGGG + Intronic
901329061 1:8390516-8390538 CAGAACTTGGGGAAGGAAGAAGG + Intronic
901782967 1:11606599-11606621 CAGAATTGTGGGAAGGGACATGG + Intergenic
902248919 1:15140540-15140562 CTGGAGTGTGGGAAGCAAGAAGG + Intergenic
902464542 1:16607934-16607956 CAGGATTCTGGAATGGGAGATGG + Intronic
902822000 1:18949151-18949173 CAGGAGGATGGGACAGAAGACGG - Intronic
903271034 1:22188449-22188471 CAGGGTTAGGGGCAGGCAGAGGG - Intergenic
903278635 1:22237439-22237461 CAGTCTTTTGGGAAGTAAGAGGG - Intergenic
904950594 1:34235543-34235565 CAGGAATATGGCAAGTATGATGG + Intergenic
905256515 1:36688680-36688702 AAGGAGTATGGGAAGGGAAAGGG + Intergenic
905256614 1:36688950-36688972 AAGGAGTATGGGAAGGGAAAGGG + Intergenic
905530080 1:38671044-38671066 GAGGGTGGTGGGAAGGAAGAAGG - Intergenic
906358413 1:45129615-45129637 CAGGATTATAGCAAGGTTGAAGG - Intronic
906670660 1:47651968-47651990 CAAGATTATGAGAAGAAAGATGG - Intergenic
907275376 1:53314020-53314042 CTTGAATAGGGGAAGGAAGAAGG - Intronic
907656988 1:56353629-56353651 GAGGATTTTGAGAAGGAGGAAGG - Intergenic
907737168 1:57125562-57125584 AAGGATGAGGGAAAGGAAGAAGG + Intronic
908139465 1:61169287-61169309 CAGAATAGTGGGAAGGAAAAAGG - Intronic
908481983 1:64549671-64549693 CAGCAGGATGGAAAGGAAGAAGG + Intronic
909339141 1:74511996-74512018 AAGGAAAATCGGAAGGAAGAGGG + Intronic
910833758 1:91486660-91486682 CAGCATTCTGGCAAGGGAGAGGG + Intergenic
911074008 1:93855486-93855508 GAGAATTATAGGAAGGGAGAGGG + Intergenic
912412731 1:109489570-109489592 CAGGAATATGTGATGCAAGAAGG + Intronic
912696646 1:111847205-111847227 CAATACTATGGGAAGGAAGATGG - Intronic
913600914 1:120420674-120420696 CAGGATTCTGGAATGGGAGATGG - Intergenic
914086143 1:144455959-144455981 CAGGATTCTGGAATGGGAGATGG + Intronic
914192035 1:145419910-145419932 CAGGATTCTGGAATGGGAGATGG + Intergenic
914199859 1:145475272-145475294 TAGGACTATGGGAAGAAAAAGGG + Intergenic
914252938 1:145936752-145936774 AAAGATTATAGGAATGAAGAGGG + Intronic
914362048 1:146944116-146944138 CAGGATTCTGGAATGGGAGATGG - Intronic
914390271 1:147215001-147215023 CAGGATGATCAGAAGGCAGAAGG + Intronic
914478978 1:148048407-148048429 TAGGACTATGGGAAGAAAAAGGG + Intergenic
914489578 1:148142839-148142861 CAGGATTCTGGAATGGGAGATGG + Intronic
914589943 1:149097860-149097882 CAGGATTCTGGAATGGGAGATGG + Intronic
915226728 1:154417200-154417222 CATGCTTCTGGGAAGGCAGAGGG + Intronic
915241071 1:154522196-154522218 CAGGGTTCTAGGCAGGAAGAAGG + Intronic
915279056 1:154810061-154810083 CATGATTATGGCAGGGAAGTGGG + Intronic
915796267 1:158737648-158737670 CAGGATAGTGGCAATGAAGATGG - Intergenic
915826861 1:159087284-159087306 CAGGGTGATGGTAAGGATGATGG + Intronic
915843831 1:159240940-159240962 CAGGATGATGGGCAGCAGGAAGG - Intergenic
916269955 1:162929846-162929868 CAGTATTATGTGAACAAAGATGG + Intergenic
918368183 1:183831450-183831472 AAGGATTATGGGAAGCCAGTGGG + Intronic
919802572 1:201362342-201362364 CAAAACTATGGGGAGGAAGAAGG + Intronic
919812091 1:201415113-201415135 GAGGATTATGGCAAGGAGAAAGG - Intronic
920278211 1:204824290-204824312 CAGCATTAAGGGAAGGAGGGAGG - Intergenic
920496724 1:206460222-206460244 CAGGTTTATGGGGAGGGAGCGGG + Intronic
920581369 1:207111204-207111226 GAGGATAATGGGAAAAAAGAGGG + Intronic
920860126 1:209699106-209699128 CAGGAGGAAGGGAAGGAGGAGGG + Intronic
921116889 1:212100364-212100386 TAGGAGTATTTGAAGGAAGAGGG - Exonic
921132023 1:212227985-212228007 AAGGAGAATGCGAAGGAAGAAGG - Intergenic
921417658 1:214909254-214909276 CAGGAGGAAGAGAAGGAAGAAGG + Intergenic
921568838 1:216754163-216754185 CAGAATATTTGGAAGGAAGAAGG - Intronic
921928160 1:220730526-220730548 GAGGAAAATGGGAAGGAATAAGG - Intergenic
922865988 1:228861962-228861984 CAGGATTACGAAAGGGAAGAGGG + Intergenic
923854206 1:237828523-237828545 CATGAATGTGGGAAGGAGGAGGG + Intronic
924060943 1:240173593-240173615 AATGAATCTGGGAAGGAAGATGG + Intronic
924503402 1:244657777-244657799 CAGCAGTATGTGAAGGAAGATGG + Intronic
924615280 1:245607215-245607237 CAGGCTTATGAGAGGGAAAAAGG - Intronic
1063511278 10:6647253-6647275 AAGGAAGATGGGAAGGAAGGAGG - Intergenic
1063840021 10:10060808-10060830 CAGGGTTATGGGGGAGAAGAGGG + Intergenic
1064702638 10:18037581-18037603 CAGGATTATGAGAAGTAAAAGGG + Intronic
1065245137 10:23748604-23748626 AGGGAGGATGGGAAGGAAGATGG + Intronic
1067092707 10:43277431-43277453 CTTTATGATGGGAAGGAAGAAGG - Intergenic
1067466065 10:46500126-46500148 CTGGATTATGAGAAGGAGCAGGG + Intergenic
1067621123 10:47884480-47884502 CTGGATTATGAGAAGGAGCAGGG - Intergenic
1068638812 10:59378755-59378777 GAGGATGAGGGGAAGGAGGAAGG - Intergenic
1069070648 10:63987772-63987794 CAGGATTAAGGGAACAAGGAGGG + Intergenic
1069569581 10:69486219-69486241 GAAGATTATGGGAGGAAAGATGG - Intronic
1069824458 10:71246563-71246585 CTGGGTTGAGGGAAGGAAGAAGG + Intronic
1069994147 10:72332365-72332387 GAGGATGGTGGGAAGGACGATGG + Intergenic
1070091373 10:73288849-73288871 GAATAATATGGGAAGGAAGAAGG - Intronic
1070130317 10:73651277-73651299 CAGCATTATGGGAAGGGAGGGGG + Intronic
1070828226 10:79403558-79403580 CAGGATGCTGGGAGGGAGGAAGG + Intronic
1070906051 10:80074152-80074174 CAGGATTATAGGATGGGGGAAGG - Intergenic
1071151223 10:82636904-82636926 CAGGATTAAGGGTAGGAAATGGG + Intronic
1071438057 10:85665345-85665367 TAGGATCATGGGAAGAAGGAGGG - Intronic
1071711799 10:88057022-88057044 AAGGACTGTGGGAATGAAGAGGG + Intergenic
1071867757 10:89755494-89755516 CAGGATGAAGAAAAGGAAGAAGG - Intronic
1071976170 10:90957521-90957543 CATGATTCTGGGAACCAAGAGGG - Intergenic
1072448446 10:95519619-95519641 TAGGATTATGGTAAAAAAGAGGG - Intronic
1073054568 10:100690851-100690873 CAGGAGGATGTGAAGGAGGAAGG + Intergenic
1073333368 10:102686002-102686024 CTGGATTTTGAGAAGGGAGAGGG + Intronic
1074881728 10:117664944-117664966 CAGGATTAAGTGGAGGGAGAGGG - Intergenic
1075002937 10:118811088-118811110 CAGGCTCATGGGAAGGGTGAAGG - Intergenic
1075429305 10:122366993-122367015 CTGGATATGGGGAAGGAAGACGG + Intergenic
1075647781 10:124107888-124107910 CAGGGTGATGGCAAGGAAGGCGG - Intergenic
1075788608 10:125067334-125067356 CAGGATTCTGGGATGGAAAAAGG + Intronic
1076341300 10:129747729-129747751 CAGGATCCTGGAATGGAAGAAGG - Intronic
1078401540 11:11032198-11032220 CAGCCTTATGGGAAGGAATTTGG - Intergenic
1078545757 11:12245877-12245899 CAGGATGGTGGGAGGGGAGAAGG + Intronic
1078561993 11:12380254-12380276 CAGGGTTAAGGGAACTAAGAAGG + Intronic
1078581696 11:12543973-12543995 TAGGATTAAGGGAAGCAACAAGG + Intergenic
1078828734 11:14957232-14957254 AAGGATTTGGGGGAGGAAGAGGG - Intronic
1079110715 11:17603605-17603627 AAGCAGTATGGGAAGGGAGAGGG - Intronic
1079169736 11:18081413-18081435 CAGGGCTATAGAAAGGAAGAAGG + Exonic
1079254849 11:18819128-18819150 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1079300538 11:19275293-19275315 CAGGAAGGTGCGAAGGAAGAAGG + Intergenic
1080312051 11:30905851-30905873 CAGGATTAGGGAAGGGAGGAGGG + Intronic
1080457284 11:32428766-32428788 CAGGACTTTCGGCAGGAAGACGG + Intronic
1080803415 11:35630330-35630352 CAGGATCATGGGATGGTAGTGGG - Intergenic
1080868658 11:36217062-36217084 CAGGATTGTTGTAAAGAAGAAGG + Intronic
1081293604 11:41357531-41357553 CTTGATTCTGGGAGGGAAGAAGG + Intronic
1081400988 11:42642657-42642679 AAGGAGCATGGGAAGAAAGAGGG - Intergenic
1081747057 11:45480767-45480789 CAGGATGATGGGAAGGTGGTGGG + Intergenic
1081915786 11:46729361-46729383 CAAGCTTTGGGGAAGGAAGAAGG - Exonic
1083051840 11:59784335-59784357 CAGGATTGAGGGAGGGAAAAAGG - Intronic
1083058053 11:59842250-59842272 GAGGAGTAAGTGAAGGAAGAGGG - Intronic
1083096558 11:60256850-60256872 CAGGAGTATCTGAAGGAAGGAGG - Intergenic
1083097634 11:60267776-60267798 CAGAGTTAAGGGAACGAAGAAGG + Intergenic
1084106285 11:66982977-66982999 CAGGATTCTGGGAAGGTGAAGGG - Intergenic
1084595510 11:70114519-70114541 CAGCTTCATGGGGAGGAAGATGG - Intronic
1085354289 11:75821659-75821681 CAGGATCCTGGCACGGAAGAAGG - Intronic
1085618575 11:78020801-78020823 CAGGATGTTGGGAAGGATGGCGG - Intronic
1085803597 11:79613950-79613972 AAGGCTCATGGGAGGGAAGAAGG - Intergenic
1085994011 11:81888767-81888789 AATGAGTATTGGAAGGAAGAAGG - Intergenic
1086142257 11:83512214-83512236 CAGGATTGGGGGAGAGAAGAGGG - Intronic
1086163750 11:83752788-83752810 CTGGAATATGAGAACGAAGAAGG + Intronic
1086405931 11:86499000-86499022 CATGATTCTGGGAGGGAAGCTGG + Intronic
1086426058 11:86683323-86683345 CAGGATGAGGGGAAAGAGGAAGG + Intergenic
1086885560 11:92201227-92201249 CAGGACTATGGCAGTGAAGAAGG + Intergenic
1087139159 11:94748854-94748876 CAGCTTGATGGGAAGGAAGTAGG - Intronic
1087203721 11:95372322-95372344 CAGGAGGATGTGAAGGAGGAGGG + Intergenic
1087403357 11:97696526-97696548 GAGGATTCTGAGAAGGAACAGGG - Intergenic
1088143498 11:106647601-106647623 CAGCATGATGGTGAGGAAGATGG - Intergenic
1088705812 11:112463728-112463750 CTGGAGTCTGGGAAGGTAGAAGG - Intergenic
1089120034 11:116127178-116127200 CAGCACTTTGGGAAGGAAGGAGG + Intergenic
1089577024 11:119452085-119452107 CAAGATTTAGGCAAGGAAGAGGG - Intergenic
1089596854 11:119585926-119585948 CAGGCTGATGGGAAGGAAGGTGG - Intergenic
1089875769 11:121720370-121720392 AAGGATTCTGGGAAAGAGGACGG - Intergenic
1090053505 11:123401658-123401680 CAGGGGTGGGGGAAGGAAGACGG + Intergenic
1090083493 11:123630559-123630581 TAGGATTATGGGAAGAGACAGGG + Exonic
1090109003 11:123884566-123884588 CAGGATTAAGTTAAGGAGGAAGG + Exonic
1090579935 11:128148650-128148672 CATGTTGATGGGAAGGAAGGAGG - Intergenic
1091025828 11:132140319-132140341 AAGGATTAGGGGGAGGAAAAAGG - Intronic
1091321162 11:134652968-134652990 AAGGGTTGTGGGAAGGGAGATGG - Intergenic
1091514153 12:1161176-1161198 CAGAATTATGGGAGGTTAGAAGG + Intronic
1092060654 12:5547812-5547834 CAGGATCACAGGAAGGATGAGGG + Intronic
1092254081 12:6916793-6916815 CAGGAGGAAGGGAAGAAAGAAGG + Intronic
1092907757 12:13117347-13117369 CAGAATTAGGGGGAGGAACAAGG + Intronic
1093007242 12:14063983-14064005 CAGGAGGATGCCAAGGAAGACGG + Intergenic
1094229100 12:28082460-28082482 GAGGAGTATGGTAAGGAATATGG + Intergenic
1095041617 12:37448164-37448186 CTGGATTATAGGAAGAAATAAGG + Intergenic
1095523272 12:43094074-43094096 CAGGGACTTGGGAAGGAAGATGG + Intergenic
1096777411 12:53972803-53972825 CAGGATTGGGGGAAGGAGGAGGG - Intergenic
1097782243 12:63721433-63721455 GAAGAAAATGGGAAGGAAGAGGG + Intergenic
1097987690 12:65801718-65801740 CAGGAAAATGGGAAGAAAGTGGG + Intergenic
1099143370 12:79008202-79008224 CTGGAATATCTGAAGGAAGAGGG + Intronic
1100057083 12:90524866-90524888 CAGTATCATGAGAATGAAGAAGG - Intergenic
1100094223 12:91011460-91011482 GACTATAATGGGAAGGAAGAGGG - Intergenic
1101515293 12:105429559-105429581 AAGGTTTTTGGGAAAGAAGATGG + Intergenic
1101951932 12:109183810-109183832 CCCCATTATGGGAAGAAAGAAGG - Intronic
1102178444 12:110893483-110893505 CAGGACAAGGGGAAGAAAGAGGG - Intronic
1102255786 12:111414200-111414222 CAGGCAGATGGGAAGGGAGAGGG - Intronic
1102781285 12:115567201-115567223 CAGAAATATGAGAAGAAAGATGG + Intergenic
1102804652 12:115769107-115769129 CAGGGTTAAGGGAACAAAGAAGG + Intergenic
1104528335 12:129545911-129545933 CAGGAATATGAGGAGGAACATGG + Intronic
1105599550 13:21874540-21874562 CATGACCATCGGAAGGAAGATGG + Intergenic
1105680751 13:22724983-22725005 CAGGATTATGTGAAATAAGAGGG - Intergenic
1106043910 13:26119777-26119799 CAGGATGCTGGGATGGAAGAAGG + Intergenic
1106200113 13:27528851-27528873 GAGAATTGTGGGAAGGCAGACGG - Intergenic
1106638653 13:31559357-31559379 CAGTATTATGGCAGGGCAGAAGG + Intergenic
1106725293 13:32478256-32478278 CAGGACTCTAGGATGGAAGAAGG - Intronic
1107509051 13:41062880-41062902 CAGGTTGATGAAAAGGAAGAAGG - Intronic
1108147526 13:47495274-47495296 AAGGATGAAGGGAGGGAAGAAGG + Intergenic
1108915532 13:55606137-55606159 CCGGACTATGGGAGTGAAGAGGG + Intergenic
1109065385 13:57682152-57682174 TAGGAGTATAAGAAGGAAGATGG - Intronic
1109606631 13:64705813-64705835 CAGAATTAAGAGAAGGAAAAGGG - Intergenic
1109740690 13:66550759-66550781 CAGATTTGTGGGAAGGAAGAGGG + Intronic
1111007091 13:82262381-82262403 CAGGATGAAGGGAACGAAGATGG - Intergenic
1111051363 13:82886128-82886150 CACAGTTATGGGAAGAAAGATGG - Intergenic
1112059097 13:95719193-95719215 CAGGCATATGGGAAGGGATATGG + Intronic
1112088703 13:96058440-96058462 CAGGTTTATGAGAAAGAAAATGG - Intergenic
1112107298 13:96254576-96254598 CAGGCTTTTGGGAAATAAGATGG - Intronic
1112122220 13:96425669-96425691 CAGGGCTATGGGAAGGAGTAGGG - Intronic
1112446761 13:99471574-99471596 CAGGAAAGAGGGAAGGAAGAGGG + Intergenic
1113786742 13:113006080-113006102 CAGGCTTGTGGGCAGGAAGGCGG - Intronic
1114258171 14:21019816-21019838 CAGGATTTGGGGAAGGAAGAAGG - Intronic
1114985422 14:28221395-28221417 CAGAATTATTGAAATGAAGATGG - Intergenic
1115762536 14:36589874-36589896 CAGGGTGAAGGGAAGGAGGAAGG + Intergenic
1116755812 14:48946657-48946679 CAGGAGGATGGGCAGGAGGAGGG - Intergenic
1118254748 14:64195900-64195922 CAGGCTGATGGGAAGGAAAATGG - Intronic
1119115655 14:72018776-72018798 CAGGATCATGGTGAGGGAGAAGG - Intronic
1120071495 14:80108346-80108368 CGGGGTTATAGGAAGGAATAAGG + Intergenic
1121068171 14:90989851-90989873 CTGGATTATGGGCAGGTAGGGGG + Intronic
1121210108 14:92202141-92202163 CATGATTATGTGAAGGCACAGGG + Intergenic
1121343463 14:93118330-93118352 GAGGGAAATGGGAAGGAAGATGG + Intergenic
1122060477 14:99133762-99133784 CAGGCTTCTTGGAAGGAAGCCGG + Intergenic
1122748720 14:103917359-103917381 CTGGACTATGGGAAGGAAGATGG + Intronic
1124705960 15:31964394-31964416 TAGAAATATGGGATGGAAGAAGG + Intergenic
1125101514 15:35918464-35918486 AGGGATTGGGGGAAGGAAGAAGG + Intergenic
1125697528 15:41651739-41651761 GAGGAGGAGGGGAAGGAAGAGGG - Intronic
1125843206 15:42825147-42825169 AAGGAATATGAGAGGGAAGAGGG + Intronic
1126669049 15:51099723-51099745 CAGGAATATGGGAAGGCACTGGG - Intronic
1127387071 15:58475263-58475285 CTGGATTATGGTGTGGAAGATGG - Intronic
1127483002 15:59394376-59394398 CAGGATGATGGTGATGAAGATGG + Intronic
1127976552 15:64001493-64001515 GAGGAGGATGGGAAGGAAGTGGG + Intronic
1129407500 15:75328957-75328979 GGGGATCCTGGGAAGGAAGAGGG + Intergenic
1129734319 15:77951394-77951416 TGGGACCATGGGAAGGAAGAGGG - Intergenic
1129739518 15:77983504-77983526 CAGTGTTCTGGGCAGGAAGAAGG + Intergenic
1129841267 15:78744597-78744619 TGGGACCATGGGAAGGAAGAGGG + Intergenic
1129846386 15:78769545-78769567 CAGTGTTCTGGGCAGGAAGAAGG - Intronic
1130667442 15:85881568-85881590 AAGGAGTAGTGGAAGGAAGAGGG - Intergenic
1130847971 15:87765296-87765318 GAGGATTATGGGGATAAAGAAGG - Intergenic
1131768731 15:95711073-95711095 CTGGATTATGGTGAGGAAAAGGG - Intergenic
1131992591 15:98105434-98105456 CAGGCTCATAGCAAGGAAGAGGG + Intergenic
1132017508 15:98331801-98331823 AAGGAATATGAAAAGGAAGATGG + Intergenic
1132098339 15:99005040-99005062 CAGGCTCATAGCAAGGAAGAGGG - Intronic
1133552188 16:6867416-6867438 GAGGATTAAGGGAAGAAAGGGGG + Intronic
1133681513 16:8124451-8124473 CAGCACTTTGGGAAGGGAGACGG + Intergenic
1134635030 16:15785661-15785683 CAGGTTTGTGGGTGGGAAGATGG - Intronic
1134810846 16:17165986-17166008 CAGGAGCATGGGGAGGAAGAAGG + Intronic
1136178522 16:28535118-28535140 CAGGGTTCTGGGAAGTGAGATGG - Intronic
1137927088 16:52549987-52550009 AAAGAACATGGGAAGGAAGAAGG + Intergenic
1138370214 16:56520630-56520652 GAAAATTAAGGGAAGGAAGAGGG + Intergenic
1138421283 16:56900947-56900969 GAGGATTAGGGGAAGGGAGGAGG - Intronic
1138457916 16:57131932-57131954 CAGGGCTCTGGGCAGGAAGAAGG - Intronic
1138846046 16:60567761-60567783 GAGGATTGTGGGAGGGAACAGGG - Intergenic
1138971586 16:62150805-62150827 CAGCACTTTGGGAAGCAAGAAGG - Intergenic
1139255908 16:65542433-65542455 CATGATGATGGTAAGGATGAAGG - Intergenic
1140780256 16:78289455-78289477 CAGGGTAGTGGGAAGGAACAGGG + Intronic
1140887591 16:79258627-79258649 CAGGCTTTGGGGAAGGAACAAGG + Intergenic
1141188543 16:81806883-81806905 CAGAGTTATGGGGAGGAAGCAGG + Intronic
1141562647 16:84879769-84879791 CAGGATTATGGGAAGGAAGAAGG - Intronic
1142510368 17:389164-389186 CAGGCTTCTGGGGAGGGAGAGGG - Intergenic
1143270855 17:5673420-5673442 CTGGAGAGTGGGAAGGAAGAGGG + Intergenic
1143523790 17:7461310-7461332 CAGGAATATGGGGAGGAACATGG + Exonic
1144027884 17:11294427-11294449 CAGGATAAGGGGCAGGGAGAAGG + Intronic
1144790262 17:17854293-17854315 CAGGCTGATGGGAGGGAAGTGGG + Intronic
1145415327 17:22709926-22709948 CAGGATGAGGGGATGGAAGATGG + Intergenic
1146138366 17:30343110-30343132 CAAACTTAGGGGAAGGAAGAGGG - Intergenic
1146636907 17:34513314-34513336 CAGATTTATGAGTAGGAAGACGG + Intergenic
1146663131 17:34678473-34678495 CATGATGATGGGATTGAAGAGGG - Intergenic
1147191592 17:38741059-38741081 CAGGAAAATGGAAAAGAAGAGGG + Intronic
1147977426 17:44255709-44255731 CAGCATCATGGCAAAGAAGAAGG + Exonic
1147981933 17:44280157-44280179 CAGGGTCAGGGGAAGGAAGAGGG - Intergenic
1148018379 17:44538421-44538443 TAGGATTTATGGAAGGAAGAGGG - Intergenic
1149631550 17:58129385-58129407 CAGGAATCAGGCAAGGAAGAAGG - Intergenic
1149748082 17:59118918-59118940 CACGAGCATGGGAAGGAGGAAGG - Intronic
1150229737 17:63543557-63543579 CTGCCTTATGGGAAGCAAGAGGG - Exonic
1150651963 17:67016316-67016338 CAGGATGGTGGGGAGGCAGAGGG - Intronic
1150827619 17:68490733-68490755 CAGGATAATAGGAAAGTAGAGGG - Intergenic
1153401874 18:4690801-4690823 CAGAATTAGGAGAAGGAAAAAGG + Intergenic
1153634893 18:7105023-7105045 CAGGGATATGGAAAGGAAAATGG + Intronic
1155358302 18:24975568-24975590 CAGAGTTATGGTAAGGAAAATGG - Intergenic
1157693271 18:49700858-49700880 CAGGATTAGGGGTACGAAGCCGG + Intergenic
1158420560 18:57289243-57289265 CAGGCTTGAGGGTAGGAAGAAGG + Intergenic
1158996287 18:62923494-62923516 CAGGATTATGTGAAGGGGGTGGG + Intronic
1159029258 18:63214168-63214190 AAGGAAGATGGGAAGCAAGAAGG + Intronic
1160045330 18:75381366-75381388 CCTGATTATGGGAAGTGAGAAGG - Intergenic
1160089539 18:75813471-75813493 TAGGATGATAGGAATGAAGATGG + Intergenic
1160244605 18:77146964-77146986 CAGGAGTCTGGGCAGGAAGTGGG - Intergenic
1160676397 19:393641-393663 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676403 19:393666-393688 AAGGATGGTGGGAAGGATGATGG + Intergenic
1160676410 19:393691-393713 AAGGATGATGGGAAGGTTGATGG + Intergenic
1160676413 19:393703-393725 AAGGTTGATGGGAAGGATGATGG + Intergenic
1160676416 19:393715-393737 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676419 19:393727-393749 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676422 19:393739-393761 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676428 19:393764-393786 AAGGATGATGGGAAGGATGGTGG + Intergenic
1160676442 19:393818-393840 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676447 19:393843-393865 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676452 19:393868-393890 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676457 19:393893-393915 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676480 19:393986-394008 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676488 19:394023-394045 AAGGTTCATGGGAAGGATGATGG + Intergenic
1160676491 19:394035-394057 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676494 19:394047-394069 AAGGATGATGGGAAGGATGACGG + Intergenic
1160676497 19:394059-394081 AAGGATGACGGGAAGGATGATGG + Intergenic
1160676515 19:394122-394144 AAGGTTCATGGGAAGGATGATGG + Intergenic
1160676518 19:394134-394156 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676521 19:394146-394168 AAGGATGATGGGAAGGATGACGG + Intergenic
1160676524 19:394158-394180 AAGGATGACGGGAAGGATGATGG + Intergenic
1160676535 19:394196-394218 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676538 19:394208-394230 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676542 19:394220-394242 AAGGATGATGGGAAGGGTGATGG + Intergenic
1160676548 19:394245-394267 AAGGGTGATGGGAAGGATGATGG + Intergenic
1160676555 19:394270-394292 AAGGTTGATGGGAAGGATGATGG + Intergenic
1160676558 19:394282-394304 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676610 19:394543-394565 AAGGAAGATGGGAAGGATGATGG + Intergenic
1160676623 19:394594-394616 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676628 19:394619-394641 AAGGATGAAGGGAAGGATGATGG + Intergenic
1160676640 19:394682-394704 AAAGATGATGGGAAGGATGATGG + Intergenic
1160676646 19:394707-394729 AAAGATGATGGGAAGGATGATGG + Intergenic
1160676652 19:394732-394754 AAAGATGATGGGAAGGATGATGG + Intergenic
1160676665 19:394792-394814 AAAGATGATGGGAAGGATGATGG + Intergenic
1160676671 19:394817-394839 AAAGATGATGGGAAGGATGATGG + Intergenic
1160676677 19:394842-394864 AAAGATGATGGGAAGGATGATGG + Intergenic
1160676690 19:394902-394924 AAAGATGATGGGAAGGATGATGG + Intergenic
1160676696 19:394927-394949 AAAGATGATGGGAAGGATGATGG + Intergenic
1160676717 19:395025-395047 AAAGATAATGGGAAGGATGATGG + Intergenic
1160676723 19:395050-395072 AAAGATGATGGGAAGGATGATGG + Intergenic
1160676733 19:395088-395110 AAGGATGATGGGAGGGATGATGG + Intergenic
1160676738 19:395113-395135 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676741 19:395125-395147 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676747 19:395150-395172 AAAGATGATGGGAAGGATGATGG + Intergenic
1160676753 19:395175-395197 AAAGATGATGGGAAGGATGATGG + Intergenic
1160676762 19:395213-395235 AAGGTTGATGGGAAGGATGATGG + Intergenic
1160676765 19:395225-395247 AAGGATGATGGGAAGGATAATGG + Intergenic
1160676767 19:395237-395259 AAGGATAATGGGAAAGATGATGG + Intergenic
1160676778 19:395275-395297 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676787 19:395313-395335 AAGGTTGATGGGAAGGATGATGG + Intergenic
1160676790 19:395325-395347 AAGGATGATGGGAAGGATAATGG + Intergenic
1160676792 19:395337-395359 AAGGATAATGGGAAAGATGATGG + Intergenic
1160676803 19:395375-395397 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676812 19:395413-395435 AAGGTTGATGGGAAGGATGATGG + Intergenic
1160676815 19:395425-395447 AAGGATGATGGGAAGGATAATGG + Intergenic
1160676817 19:395437-395459 AAGGATAATGGGAAAGATGATGG + Intergenic
1160676828 19:395475-395497 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676831 19:395487-395509 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676851 19:395573-395595 AAGGACGATGGGAAGGATGATGG + Intergenic
1160676854 19:395585-395607 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676861 19:395610-395632 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676871 19:395647-395669 AAGGTTGATGGGAAGGATGATGG + Intergenic
1160676874 19:395659-395681 AAGGATGATGGGAAGGATGATGG + Intergenic
1160676877 19:395671-395693 AAGGATGATGGGAAGGATAATGG + Intergenic
1160676913 19:395875-395897 AAGGACGATGGGAAGGATGATGG + Intergenic
1160676916 19:395887-395909 AAGGATGATGGGAAGGACAATGG + Intergenic
1160676919 19:395899-395921 AAGGACAATGGGAAGGATGATGG + Intergenic
1160676936 19:395989-396011 AAGGTTGATGGGAAGGACGACGG + Intergenic
1160695185 19:480455-480477 GAGGATGATGGGAAGGATGATGG + Intergenic
1160695191 19:480480-480502 AAGGATGATGGTAAGGATGATGG + Intergenic
1160695219 19:480607-480629 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695225 19:480632-480654 AAGGATGATGGTAAGGATGATGG + Intergenic
1160695236 19:480709-480731 AAGGAATGTGGGAAGGATGATGG + Intergenic
1160695239 19:480721-480743 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695252 19:480823-480845 AAGGATGATGGAAAGGATGATGG + Intergenic
1160695255 19:480835-480857 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695263 19:480899-480921 AAGGAATGTGGGAAGGATGATGG + Intergenic
1160695270 19:480924-480946 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695275 19:480949-480971 AAGGAATGTGGGAAGGATGATGG + Intergenic
1160695287 19:481026-481048 AAGGAATGTGGGAAGGATGATGG + Intergenic
1160695293 19:481051-481073 AAGGATGATGGAAAGGATGATGG + Intergenic
1160695296 19:481063-481085 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695303 19:481114-481136 AAGGAATGTGGGAAGGATGATGG + Intergenic
1160695310 19:481139-481161 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695313 19:481151-481173 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695318 19:481176-481198 AAGGAATGTGGGAAGGATGATGG + Intergenic
1160695323 19:481201-481223 AAGGATGATGAGAAGGATGATGG + Intergenic
1160695330 19:481226-481248 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695333 19:481238-481260 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695340 19:481276-481298 AAGTATGATGGGAAGGATGATGG + Intergenic
1160695343 19:481288-481310 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695351 19:481339-481361 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695357 19:481377-481399 AAGGAATGTGGGAAGGATGATGG + Intergenic
1160695364 19:481402-481424 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695377 19:481453-481475 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695384 19:481478-481500 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695387 19:481490-481512 AAGGATGATGGGAAGGATGATGG + Intergenic
1160695403 19:481551-481573 AAGGATGATGGGAAGGATGGTGG + Intergenic
1160695406 19:481563-481585 AAGGATGGTGGGAAGGATGATGG + Intergenic
1160695411 19:481588-481610 AAGGATGATGGGAAGGACAATGG + Intergenic
1160695424 19:481648-481670 AAGGATAATGGGAAGGATGATGG + Intergenic
1162153969 19:8664364-8664386 CAGGCTGATGGGCAGGAAGTGGG - Intergenic
1162180851 19:8867756-8867778 CAGGTGAATGGGCAGGAAGATGG + Intronic
1162741129 19:12774572-12774594 CTGGGTGATGGGCAGGAAGAGGG - Intronic
1163376376 19:16934733-16934755 CAGAAATTTGGGAAGGTAGAAGG - Intronic
1164745711 19:30611205-30611227 CAAGATGATGGGAAGCAGGAAGG + Intronic
1165268859 19:34687401-34687423 CAGGTCTCTGAGAAGGAAGAAGG + Intergenic
1165275283 19:34745713-34745735 CAGGTCTATGGGAAGGAAGGAGG + Intergenic
1165448981 19:35871564-35871586 CAGGATTGTGGGATGGGAGGGGG - Intronic
1165711938 19:38017776-38017798 CAGCATTTTGGGAGGCAAGATGG - Intronic
1166505394 19:43368391-43368413 CTGGCTTAGGGGAAGGCAGAAGG - Intergenic
1167439548 19:49500403-49500425 CAGGCTGCTGGGAAGGAAGTGGG + Intergenic
1167866239 19:52330801-52330823 CTAGATTATGGGAAGGCAAATGG + Intergenic
1168433845 19:56302472-56302494 AAGAAGGATGGGAAGGAAGAAGG - Intronic
1168539956 19:57201961-57201983 CAGCAGTATGGGAGGCAAGAGGG + Intronic
925253673 2:2464149-2464171 CTGGATGAAGGGTAGGAAGATGG + Intergenic
925370618 2:3342592-3342614 CAGCTTTATGGGAAGAAAGGCGG - Intronic
925516414 2:4688489-4688511 TAAGACTATGGGAAGGAGGAAGG + Intergenic
926064745 2:9829536-9829558 CATGAATATGCGAAGGAATAGGG - Intergenic
926148438 2:10411270-10411292 CAGGACAATGGGAAGGAGGTGGG + Intronic
927505168 2:23608150-23608172 CAGCATGATGGGAGGGAAAAAGG + Intronic
927648436 2:24896026-24896048 CAGGATGATGGGAAGAGAAATGG - Intronic
927786297 2:25977511-25977533 CAGGGTTATGGCAAGGCAGCTGG + Intronic
928249572 2:29663425-29663447 GAGGACGATGGGAAGGAGGAAGG - Intronic
929190623 2:39136171-39136193 CAGGATTTGGGTAAGGAATAGGG - Intergenic
929864358 2:45705538-45705560 CAGGCTTATTGGAAGGAGGGAGG + Intronic
930170980 2:48251618-48251640 CAGGAAGAAGGGAAGGATGAAGG - Intergenic
931159618 2:59674335-59674357 CAGGAATATGGAGAAGAAGAGGG - Intergenic
932093753 2:68828953-68828975 AAGGAGTTTGGGAGGGAAGAGGG - Intergenic
932333627 2:70916533-70916555 CAGGATTTGGGGATGGAGGAAGG - Intronic
933553509 2:83804758-83804780 GAGGATTATGGGAAATAAGATGG - Intergenic
933707704 2:85304154-85304176 GAGAAATATGGGAAGGAAGCGGG - Intronic
934736860 2:96694010-96694032 AAGGAGTTGGGGAAGGAAGAGGG + Intergenic
934817856 2:97345738-97345760 CAGGACTATAAGAAGGGAGATGG - Intergenic
934819840 2:97362746-97362768 CAGGACTATAAGAAGGGAGATGG + Intergenic
935086436 2:99850196-99850218 CAGGTTTATAAGTAGGAAGAGGG - Intronic
937064513 2:119007044-119007066 CTGGAGTAGTGGAAGGAAGAAGG - Intergenic
937352179 2:121173111-121173133 CAGAAGTACGGGAAGTAAGAGGG + Intergenic
937484107 2:122295893-122295915 CAGGAATTTGGGAAGAAAGCAGG - Intergenic
937484203 2:122297068-122297090 CAGGAGTTTAGGAAGAAAGATGG + Intergenic
937755866 2:125538139-125538161 AAGGAGTAATGGAAGGAAGATGG + Intergenic
938995876 2:136677165-136677187 CAGTGTTATGGGAAAGAAAAGGG + Intergenic
939949151 2:148447596-148447618 CAGGCTGATGGGAATGAAGCAGG + Intronic
940317749 2:152342659-152342681 CAGGTTTCTGGAAAGGAGGAAGG - Intronic
940437106 2:153668602-153668624 TAGGATGAAGGGAAGGAAGCTGG + Intergenic
940823735 2:158386778-158386800 AAGGAGTATGGGAAGGATGAGGG - Intronic
941087093 2:161130669-161130691 CAGGAGGATGGGAAGGGAAAAGG - Intergenic
941198745 2:162483010-162483032 AAGGAGAATGGGAATGAAGAAGG + Intronic
941573944 2:167206776-167206798 CAGTCTTATGGAAAGGATGACGG - Intronic
941629254 2:167865975-167865997 TAGGATGATGGGGAGGAGGATGG - Intergenic
941753962 2:169164637-169164659 CATAATTATGGGATGGAGGAGGG + Intronic
941915701 2:170812270-170812292 CAGGATTAGGGGAAGAAACCTGG + Intergenic
942468487 2:176233846-176233868 CAGTATTATTGCAAGGAAGAAGG + Intergenic
942496384 2:176544518-176544540 CTGGGTCATGGGAAGGAAGAGGG - Intergenic
942564703 2:177254884-177254906 CAAGATTATGGGGAAGAAAAGGG - Intronic
942672271 2:178388731-178388753 CAGAAGTATGGGAGGGTAGATGG - Intronic
942964592 2:181876324-181876346 GAGGATTAGTGGAAGGAGGAAGG - Intergenic
944087270 2:195863801-195863823 CAGGGTTAAGGGAACCAAGAGGG - Intronic
945003356 2:205376123-205376145 CAGGATTATGGAAAGTTAAATGG - Intronic
945534509 2:210997712-210997734 CAGGAATAGGGGAAGTAGGAGGG + Intergenic
945556277 2:211280420-211280442 AAGCATTATGAGTAGGAAGAGGG - Intergenic
946025459 2:216669299-216669321 AAGGATTAAGAGAAGGAAGAGGG + Intergenic
946138243 2:217665842-217665864 CAGGAACATGGAGAGGAAGAAGG + Intronic
946440006 2:219687092-219687114 CAGGAATTAGGGAAGAAAGAAGG - Intergenic
947415607 2:229892199-229892221 GAGGATAATGGGAAGGAGGAAGG + Intronic
947859481 2:233348533-233348555 CAGGCTTCTGGGATGGAACATGG + Intergenic
948061504 2:235045921-235045943 CAGGGAGATGGGAAGGAAAAAGG + Intronic
948277965 2:236724649-236724671 GAGGAATATCTGAAGGAAGATGG - Intergenic
948556046 2:238812122-238812144 GAGGATGACGAGAAGGAAGAAGG - Intergenic
948958257 2:241312055-241312077 CATGATTAGGGGAAGGATGTTGG + Intronic
1169325253 20:4670551-4670573 CAGGATGAGGAGGAGGAAGAGGG + Intergenic
1169867236 20:10215266-10215288 CAGTATGGTGAGAAGGAAGAAGG - Intergenic
1170690974 20:18614814-18614836 CAGGAGGAAGGGAAGGAGGAAGG - Intronic
1171255802 20:23688311-23688333 CATGACTTGGGGAAGGAAGAAGG + Intronic
1171557988 20:26095699-26095721 CGGCATAATGGGAAGGAAGTAGG - Intergenic
1171804873 20:29668082-29668104 CTGGATTATAGGAAGAAATAAGG - Intergenic
1171839186 20:30188346-30188368 CTGGATTATAGGAAGAAATAAGG + Intergenic
1171862464 20:30413165-30413187 CAGGAAGGAGGGAAGGAAGAAGG + Intergenic
1172110885 20:32544282-32544304 AAGGATGATGGGAAGGCAGGGGG + Intronic
1172451808 20:35031119-35031141 CAGGAATAATGGAAGGCAGAAGG - Intronic
1172633972 20:36396990-36397012 CTGGAATATGGGAATAAAGATGG - Intronic
1172815824 20:37685149-37685171 GAGGAGGAAGGGAAGGAAGAGGG + Intergenic
1173317117 20:41955022-41955044 CAGGCTGAAGGGGAGGAAGAAGG - Intergenic
1173443975 20:43101345-43101367 TAGTATTATGGGCAGGAACATGG + Intronic
1175048457 20:56129559-56129581 CAGGGTTAGGGGAAGAAAGCAGG + Intergenic
1175366471 20:58459704-58459726 TAGGATTATGGCAAGGAGGCTGG + Exonic
1176275597 20:64265707-64265729 AAGGAGAAGGGGAAGGAAGAGGG - Intronic
1176289346 21:5035865-5035887 GGGGATTCTGGGAAGTAAGAAGG - Intronic
1176308323 21:5135967-5135989 CAGGATGCTGGGCAGGAGGATGG - Exonic
1177937776 21:27370506-27370528 CAGCATTAGGGGAAGCAAGGTGG + Intergenic
1177959147 21:27640313-27640335 CAGGATATTGGGAGGGAAGGAGG - Intergenic
1177965814 21:27725232-27725254 CAGGATAATAGGAAAGTAGAGGG - Intergenic
1178358893 21:31931875-31931897 CAGGGTTGTGGGATGGGAGAAGG - Intronic
1178721895 21:35017721-35017743 CAGAACTATGAGAAGAAAGATGG - Intronic
1179006837 21:37522777-37522799 CAGGCTTTTGAGAAGGAAGGAGG - Intergenic
1179155898 21:38851085-38851107 CAGGATTAGGGGCAGGAAAGAGG - Intergenic
1179329151 21:40381665-40381687 TAGGATTATGGGAAAGAATCTGG + Intronic
1179848737 21:44126065-44126087 CAGGATGCTGGGCAGGAGGATGG + Exonic
1179867883 21:44227722-44227744 GGGGATTCTGGGAAGTAAGAAGG + Intronic
1180723421 22:17926582-17926604 CATAAGTTTGGGAAGGAAGATGG - Intronic
1184737931 22:46410024-46410046 CAGGAACATGGGAACTAAGAAGG + Intronic
949134039 3:540986-541008 CAGAATGGAGGGAAGGAAGAGGG - Intergenic
949542451 3:5044099-5044121 CTGGATTACGGGGAGGAAAAAGG + Intergenic
949803083 3:7924728-7924750 CATGATTGTGGGAATGGAGAGGG - Intergenic
949833610 3:8244109-8244131 CAGGAAAAGGGGAAGGGAGAAGG + Intergenic
949833985 3:8248153-8248175 CAGTACTATGAGAAGGATGAAGG - Intergenic
950913747 3:16621553-16621575 CAGGAGAAAGGGAAGGAATATGG + Intronic
950920236 3:16686601-16686623 AAGGACCATGGGAAGGCAGAAGG + Intergenic
951954706 3:28241615-28241637 TAGGAGCCTGGGAAGGAAGAGGG + Exonic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
952213476 3:31252604-31252626 CAGAATCATGGAAAGAAAGAGGG + Intergenic
952262549 3:31754389-31754411 CAAGATGAGCGGAAGGAAGAGGG + Intronic
952590117 3:34942518-34942540 AAGGAAAAAGGGAAGGAAGAAGG - Intergenic
953438217 3:42896658-42896680 CAGGATTAAGGGAATGAGGGGGG + Intronic
953547423 3:43873838-43873860 GAAGATTATGCGAAGAAAGAAGG + Intergenic
953677875 3:45017386-45017408 CAAGGTTGTGGGAAGGAGGAGGG - Intronic
954033663 3:47838215-47838237 CAGGATTATGGGACAGACGATGG - Intronic
954196558 3:49000580-49000602 CAGGAACAAGGGAAGGAAGCAGG + Intronic
955305088 3:57822599-57822621 CAGGATTGAGGGATGGGAGATGG - Intronic
955307446 3:57848530-57848552 GAGGAAAAAGGGAAGGAAGAAGG - Intronic
955537751 3:59942330-59942352 CAGGAGTGTGGGGAGGAGGAAGG - Intronic
955973907 3:64462800-64462822 CAGTATTAGAGGGAGGAAGAGGG - Intergenic
956064365 3:65381349-65381371 AAAGCTTATGGGCAGGAAGAAGG + Intronic
956465047 3:69511731-69511753 AAGGAGAAGGGGAAGGAAGAAGG - Intronic
957508850 3:81160907-81160929 GAGGAGTAAAGGAAGGAAGATGG + Intergenic
959462210 3:106641352-106641374 AAGGATGATGTGAATGAAGATGG + Intergenic
959491761 3:106998578-106998600 AAGGAATATGGGATGAAAGATGG - Intergenic
960708942 3:120507790-120507812 CAGGATAATAGGAATGTAGAGGG + Intergenic
960746656 3:120897820-120897842 CATGCTCATGGGTAGGAAGAAGG - Intergenic
961387254 3:126529751-126529773 CAGGATGATGGGAGGGGAGGAGG - Intronic
962384946 3:134925368-134925390 CTGCATAATGGGGAGGAAGAAGG + Intronic
965347836 3:167574115-167574137 CAGGATTGTGGAATGAAAGAAGG - Intronic
965937051 3:174127508-174127530 CAGGAATATGGGAAGAAGGAGGG - Intronic
966319891 3:178690516-178690538 GAGGAGAATGAGAAGGAAGAAGG + Intronic
966387921 3:179421337-179421359 AAGGATTATCAAAAGGAAGACGG + Intronic
966470488 3:180283402-180283424 CAGGATCAGGGCAAGGAGGAGGG + Intergenic
966802318 3:183775789-183775811 GAGGAAAATGGGAAAGAAGAAGG + Intronic
966888807 3:184391430-184391452 CAAGACTAGGGGAAGGAATAAGG + Intronic
967101568 3:186220442-186220464 AAGGAGTATGGGCTGGAAGACGG - Intronic
967142798 3:186576356-186576378 CAGCATTAGGGGAAGGAATTAGG + Intronic
967261727 3:187649155-187649177 CAGGATTTAGGAAAGGACGATGG + Intergenic
967311457 3:188110264-188110286 CAGCATTACAGGAAGGAAGGAGG + Intergenic
968236201 3:197031129-197031151 CTGGATCAGGGGAAGGAACATGG + Intergenic
968292162 3:197547279-197547301 CAGGCCTAAGGGAAGGAAGGCGG + Intronic
968895789 4:3402405-3402427 CAGGCTTCAGGGAAGGAGGAAGG - Intronic
969143565 4:5100776-5100798 AAGGAATAAAGGAAGGAAGAAGG - Intronic
969167525 4:5329753-5329775 CAGAATTAAGGCAAGGAAGGGGG - Intronic
969576604 4:8039576-8039598 GTGGAGTGTGGGAAGGAAGAAGG - Intronic
969652354 4:8475209-8475231 CAGCATTACGGGCAGAAAGAGGG - Intronic
969658808 4:8514335-8514357 CTCGAATATGGGAAGGCAGAGGG - Intergenic
972699307 4:41478725-41478747 AATGAGGATGGGAAGGAAGAAGG - Intronic
972841509 4:42935404-42935426 CAGAAGTATAGGAAGGAAGAGGG + Intronic
974209585 4:58752673-58752695 CAGGATTAAGGTAAGGATTAAGG + Intergenic
975197354 4:71541365-71541387 CTGGATGGTGTGAAGGAAGAAGG + Intronic
975745162 4:77468143-77468165 CAGGGTGATGGGACTGAAGAAGG + Intergenic
978303949 4:107301597-107301619 CAGGATTTTGGTAAGACAGATGG + Intergenic
980173156 4:129313452-129313474 CAGGATTCTGGGCAGGAAGAGGG - Intergenic
980206629 4:129727508-129727530 TAGGAATAAGGTAAGGAAGAAGG - Intergenic
981340084 4:143611531-143611553 CAGAAATATGAGAAGGAACAGGG + Intronic
981899122 4:149841624-149841646 GAAGATTGTGGGAAGGAACAGGG - Intergenic
982076788 4:151745692-151745714 CAGAATAAGGGGAATGAAGAGGG - Intronic
982551383 4:156804532-156804554 AAAGATTTTGAGAAGGAAGATGG - Intronic
982783569 4:159516526-159516548 CAGTCTCATGGGAAGGAGGAAGG + Intergenic
983104767 4:163672981-163673003 CTGGATTAAGGGGAGGAAGGAGG - Intronic
984334679 4:178375651-178375673 AATGGTTATGAGAAGGAAGAGGG + Intergenic
984973688 4:185210984-185211006 AAGGATTATGAGAAGGAATGTGG - Intronic
986145550 5:5073984-5074006 CTGGCTTATGGGAAGGGACAGGG - Intergenic
986428037 5:7654233-7654255 CAGGGTTTCAGGAAGGAAGAAGG + Intronic
986573672 5:9191073-9191095 CAGGAATATGGAAAAGAACATGG + Intronic
986784909 5:11105247-11105269 CAGGATTATCTGAAGGAGGTTGG - Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987121069 5:14767147-14767169 CACGATTATGGGAAACAAAATGG + Intronic
987334528 5:16887152-16887174 CAGGATAAGGGGAAGGAATGTGG - Intronic
987427570 5:17791042-17791064 CAGAGTTTTGGGGAGGAAGACGG + Intergenic
987690931 5:21265878-21265900 CAGCCTTATGAGAAGGAAGAAGG + Intergenic
988529101 5:32011651-32011673 CAGGAGAGTGGGAAGGAGGAAGG - Intronic
988856738 5:35234405-35234427 CAGGATTAGATGAAGGAAGGAGG - Intergenic
989563756 5:42880372-42880394 TAGGAGGAGGGGAAGGAAGATGG - Intronic
990303475 5:54472493-54472515 AAGGATTAAGGGAAAGAAAATGG - Intergenic
990640706 5:57780589-57780611 AAGGAATAGGGGAAGGAAGAGGG - Intergenic
990681024 5:58244660-58244682 CATGGTTATGGGAAGGCAGCTGG - Intergenic
991337596 5:65566395-65566417 TAGGATTGAGGAAAGGAAGAAGG + Intronic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
991601054 5:68351508-68351530 CAGGATAAGGGGAAAGGAGAAGG - Intergenic
991659501 5:68935843-68935865 CAGGAGTAAGAGAAAGAAGAGGG - Intergenic
992096770 5:73370087-73370109 CAGAAATATGTGAAGGAAGCTGG + Intergenic
992266316 5:75021492-75021514 GAAGATTCTGGGATGGAAGAAGG + Intergenic
992267702 5:75034518-75034540 AAGGCTTATGGGCAGGAAGCAGG + Intergenic
992791953 5:80221544-80221566 CAGGATTATGGGATGTTAGATGG + Intronic
993326622 5:86546562-86546584 CAGGATTAAGAGAAGGGAGATGG + Intergenic
993843501 5:92910217-92910239 CAGTATAATGTGAAGTAAGAAGG - Intergenic
995669742 5:114588776-114588798 AAGGATGAAGGGAAAGAAGAGGG + Intergenic
996849679 5:127938084-127938106 CAGGAGTAGGAGAAGGAAAATGG - Intergenic
997854208 5:137358522-137358544 GAGGAGTGGGGGAAGGAAGAGGG + Intronic
998547663 5:143044636-143044658 CAGGATTATTGATAGGAAGATGG + Intronic
998636077 5:143956164-143956186 CAGGATTATAGGAACCCAGAAGG + Intergenic
998661966 5:144248670-144248692 CATGATAATAGGAATGAAGAAGG + Intronic
999692204 5:154157857-154157879 CAGGAGGCTGGGATGGAAGAGGG - Intronic
999936722 5:156494721-156494743 CAGAAAAGTGGGAAGGAAGAAGG - Intronic
1001425379 5:171618969-171618991 CATGAATTTGGGAAGGAAGGGGG + Intergenic
1001664941 5:173424759-173424781 CAGGCTGGTGAGAAGGAAGATGG - Intergenic
1001924660 5:175627386-175627408 CAGGGCTATGGGAAGGAGCAAGG + Intergenic
1002168891 5:177364343-177364365 CCGGGTGATGGGAAGAAAGATGG + Intronic
1002590796 5:180290996-180291018 CATGACTAAGGGAAGAAAGAGGG + Intronic
1003477610 6:6498538-6498560 GAGGATAAAGGGGAGGAAGAGGG - Intergenic
1004634995 6:17458277-17458299 CAGGATAAAGAGAAAGAAGATGG + Intronic
1005765732 6:29010149-29010171 AAAGATTATTGGAAGGAAAATGG - Intergenic
1005918673 6:30378337-30378359 AAGTATTAGGGGCAGGAAGAGGG + Intergenic
1006258367 6:32848884-32848906 CAGCATTATGTGAAGCAAGAAGG + Intronic
1007086634 6:39152385-39152407 CAGGAGAATGGATAGGAAGAGGG + Intergenic
1007136908 6:39531385-39531407 AAGAATTATGAGAAGGGAGATGG + Intronic
1007665793 6:43512308-43512330 CAGGATCCCTGGAAGGAAGATGG + Exonic
1008494153 6:52115793-52115815 GAGGATGATGGGAGGGAAGGAGG + Intergenic
1008593866 6:53021428-53021450 CAGGATTATAGGAGAGAAGCTGG - Intronic
1009554066 6:65139433-65139455 GAGGGTGAAGGGAAGGAAGAGGG + Intronic
1011259149 6:85453697-85453719 CAGCCTTATGGGCAGGAAGTGGG - Intronic
1011259826 6:85459209-85459231 CAGCATTTTGGGAGGCAAGAAGG - Intronic
1012992265 6:105938193-105938215 CAGGATAATGGCATGGAAGGTGG - Intergenic
1014243467 6:119042233-119042255 CAGGATAATGGGAAGAAAGGGGG + Intronic
1014946122 6:127500062-127500084 CAGGATTATGGGAACAAACCAGG - Intronic
1015220310 6:130796629-130796651 AAATATTAAGGGAAGGAAGAGGG - Intergenic
1015951868 6:138561476-138561498 TAGGATTAGTGGAATGAAGAGGG - Intronic
1016008655 6:139115507-139115529 AAGGATAAAGGGAAGGAAAAGGG - Intergenic
1016444375 6:144117555-144117577 TAGAATTAGGGGAAGGAAAAAGG - Intergenic
1016697312 6:147012444-147012466 CAGGGTTATGCAAAGGAAGATGG + Intergenic
1017071131 6:150576411-150576433 CTGGCGTATGGGAAGGAGGAAGG + Intergenic
1017859472 6:158382061-158382083 CAGGAGTATGGGGAGGAGGTAGG + Intronic
1018072485 6:160177459-160177481 CAGGAGTGTGGGAAGAGAGAGGG + Intronic
1018160894 6:161041374-161041396 CAGGGTTAGGGGAAGGACCAGGG - Intronic
1018410573 6:163542241-163542263 GAGGATTAACGGAAGGAGGAAGG - Intronic
1018996568 6:168714801-168714823 GAGAATGATGGGGAGGAAGAGGG + Intergenic
1019320796 7:414419-414441 GAGGATGAGGGGAAGGAAGGAGG - Intergenic
1019334844 7:478278-478300 CAGGGCTATGGGAAGGACCAGGG + Intergenic
1020897580 7:13960101-13960123 GAGGACAATGGAAAGGAAGACGG + Intronic
1021890865 7:25185029-25185051 CAGGTTTATGGAAATGGAGAAGG - Intergenic
1022113387 7:27244463-27244485 GAGGGTTATGGGAAGGAGGCTGG - Intronic
1022677285 7:32511775-32511797 GAGGAGTAAGGGGAGGAAGAAGG + Intronic
1024204209 7:47141615-47141637 CAGTATCAGGGGCAGGAAGAGGG - Intergenic
1024646441 7:51374984-51375006 CTGGATTCTGGAAAGGAAGAAGG - Intergenic
1025120974 7:56302043-56302065 CAGAATTGTGGGAAGGGACAGGG + Intergenic
1025287699 7:57679782-57679804 CTGGATTATAGGAAGAAATAAGG + Intergenic
1025612182 7:63084214-63084236 CAGGAAGATGGTAAAGAAGATGG - Intergenic
1026158965 7:67852284-67852306 CAGAAGGATGGGAAGAAAGAAGG + Intergenic
1026275112 7:68869908-68869930 GAGGATTGTAGGAAAGAAGAGGG + Intergenic
1026334133 7:69379238-69379260 AAGGATTATTGGAAGGTACAGGG - Intergenic
1026787602 7:73311715-73311737 CAGGATTGTGGGGAGGCTGAGGG + Intergenic
1027980226 7:85209450-85209472 AGGGATGATGGGGAGGAAGAAGG + Intergenic
1028313202 7:89365041-89365063 CAGCATTAAGGGAATGAAAATGG - Intergenic
1028610746 7:92708516-92708538 CTGGATTATGTGGAGGAAAAAGG + Intronic
1029371375 7:100153197-100153219 CAGTATTATGGGAAACAGGATGG + Intronic
1029875020 7:103741550-103741572 AAGGAGGATGGGAGGGAAGAAGG + Intronic
1030058872 7:105607320-105607342 CAGGATTGTGTGCAGGGAGAGGG - Exonic
1031312696 7:120218464-120218486 AGGGAGTAAGGGAAGGAAGAAGG + Intergenic
1031627752 7:124009802-124009824 CTGGCCCATGGGAAGGAAGAGGG + Intergenic
1032134700 7:129265249-129265271 CAGCATTATATGAAGCAAGAAGG + Intronic
1032494297 7:132349311-132349333 CAGCATTGAGGGAAAGAAGAGGG + Intronic
1033275975 7:139971854-139971876 CAAGAATAAGGGAAGAAAGAGGG - Intronic
1033789948 7:144779500-144779522 CAGGAATATGGGAATAAACATGG + Intronic
1034384984 7:150733451-150733473 CAGGATTTTGGGAAGAAAAGAGG - Intronic
1035419704 7:158717345-158717367 CAGGAGGAGGAGAAGGAAGAAGG - Intergenic
1035973556 8:4281266-4281288 CAGCATTATGGGAAAATAGAAGG + Intronic
1037348978 8:17929075-17929097 ATGTATTATTGGAAGGAAGAGGG - Intronic
1037609848 8:20466779-20466801 GATGATTAAGGAAAGGAAGAGGG - Intergenic
1038485100 8:27929403-27929425 CATGTGTATGGGAGGGAAGAAGG + Intronic
1038514808 8:28178358-28178380 TAGGATACTGGGAAGGAAGAGGG - Intronic
1038693734 8:29786290-29786312 CAGGATAATAGGCTGGAAGATGG - Intergenic
1039085394 8:33774927-33774949 CAAGATTAAGGGAAGGTTGAGGG - Intergenic
1039180694 8:34862644-34862666 TAGGATTATGAGACTGAAGAAGG + Intergenic
1040826318 8:51624144-51624166 TAGGATTCTGACAAGGAAGAAGG - Intronic
1041552113 8:59114685-59114707 GAGGAGTATGGGAAGAAAGAAGG - Intronic
1041957108 8:63568450-63568472 CAGGAATTTCTGAAGGAAGATGG - Intergenic
1042152419 8:65802573-65802595 CAGGATAATGGGAAGGTACTTGG + Intronic
1042317715 8:67441849-67441871 AAGGATGATGTGAAGGAAAAGGG - Intronic
1042524941 8:69754256-69754278 CAAAATCATGGGAAGGGAGAGGG + Intronic
1042835152 8:73072863-73072885 GAGGGTTGTGGGGAGGAAGAGGG - Intronic
1043381459 8:79706572-79706594 CTGGATTATTGGGAGGCAGAAGG - Intergenic
1043590035 8:81820623-81820645 TAAGATTATGGGTAGGAAAATGG - Intronic
1045985905 8:108249508-108249530 CATGATTATGGTAAGGAATATGG + Intronic
1046316414 8:112508738-112508760 CAGGATTATTGCAAGGAGCAGGG - Intronic
1047041241 8:120998642-120998664 CAGGATTAGAGGAAGATAGAAGG + Intergenic
1047537683 8:125734488-125734510 CAGGAAGAGGGGAAGGGAGAGGG - Intergenic
1048007477 8:130431177-130431199 CAGGAGTCTGGGAGGGAAGATGG - Intronic
1048909396 8:139120179-139120201 CAGGAGTCTGGGAAGTATGAAGG + Intergenic
1049356694 8:142192693-142192715 CAGGAGGGAGGGAAGGAAGAGGG + Intergenic
1049653504 8:143787748-143787770 CAGGATGAGGGGAAGGAGGTGGG - Intergenic
1049963756 9:760345-760367 GAGGATGAGGGGAAGGAGGAGGG + Intergenic
1050088678 9:1993411-1993433 CGGGATAAAGGGAAGGAGGAAGG - Intergenic
1050856723 9:10366914-10366936 CAGGATAATGATTAGGAAGAAGG + Intronic
1051309430 9:15753840-15753862 GAGGAATATTGGAAGGAATATGG + Intronic
1051433628 9:17006951-17006973 GAAGAATATAGGAAGGAAGAAGG + Intergenic
1051718231 9:20008195-20008217 CAGGCTTAAGAGAGGGAAGAGGG - Intergenic
1051882518 9:21854428-21854450 CAGGATTATGTGAATGAGAAAGG + Intronic
1053106502 9:35413802-35413824 AAGGACTCTAGGAAGGAAGAGGG + Intergenic
1053430916 9:38041259-38041281 CATGGTTATGGGAAGGGAGCTGG - Intronic
1053512673 9:38702125-38702147 CAGGACTGGGGGACGGAAGATGG + Intergenic
1055928601 9:81536486-81536508 GAGGAAGAGGGGAAGGAAGAAGG + Intergenic
1056310520 9:85336157-85336179 CAGGCTTATCAGAATGAAGAAGG + Intergenic
1056587691 9:87939032-87939054 GAGGATTAGGAGAAGGAAGAGGG - Intergenic
1056808995 9:89749974-89749996 CAGGATCATGGGGAGGATGCAGG - Intergenic
1057298895 9:93865279-93865301 CAGGTTTCTGGGGAAGAAGATGG - Intergenic
1057576658 9:96247589-96247611 CTGGATTTTGGGGAAGAAGAGGG + Intronic
1058638026 9:107055929-107055951 CAGTATTCAGGGAAGGAATAAGG + Intergenic
1058850399 9:109006477-109006499 CAGGATTATGTTAAGGATCAAGG + Intronic
1059177400 9:112179777-112179799 CATGGGTATGGGAAGGCAGAGGG + Intergenic
1059575326 9:115481958-115481980 CAGGATTGTGGTAAGGAAGATGG + Intergenic
1060104672 9:120866181-120866203 GAAGATTATGGGAAGGTAGGTGG - Intronic
1061696613 9:132380544-132380566 CAGCATTATGGGAAGGGAAAAGG - Intronic
1062276226 9:135732816-135732838 CAGGAAGGAGGGAAGGAAGAAGG - Intronic
1062638429 9:137503655-137503677 AAGGAGAAGGGGAAGGAAGAAGG + Intronic
1186551186 X:10507305-10507327 CAGGGTTGTGGGAAGGGAGAGGG + Intronic
1186826579 X:13346434-13346456 CAGGATAAAGGGGAGGAAGCAGG + Intergenic
1187264553 X:17718977-17718999 AAGGATGGAGGGAAGGAAGAAGG + Intronic
1188385099 X:29546788-29546810 CAGGAATATGGGAGAGGAGAAGG - Intronic
1188798730 X:34499967-34499989 CAAGATTGTGGAAGGGAAGATGG + Intergenic
1189430037 X:40938159-40938181 AAGGATGGAGGGAAGGAAGAAGG + Intergenic
1189558471 X:42168827-42168849 CAGGATTATGGAAACTAACAAGG - Intergenic
1189573158 X:42321181-42321203 CAGGAAGGTGGGAGGGAAGAAGG + Intergenic
1190656138 X:52613806-52613828 CAGGATTTTGGGAGGCAAGGTGG + Intergenic
1191128616 X:56984553-56984575 GAGATTTATGGGAAGGAGGAAGG + Intronic
1191951717 X:66600137-66600159 GAAGATTATGGCAAGGGAGATGG - Intronic
1192237410 X:69304728-69304750 CAGGAATGGGGGAAGGAAGGAGG - Intergenic
1192903488 X:75524129-75524151 CAGGATTTTGGAAAGGAAGATGG + Intergenic
1192939639 X:75899509-75899531 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1194153384 X:90354863-90354885 CAGGATTATGAAAACTAAGAGGG - Intergenic
1194884878 X:99301715-99301737 CAGGGTTATGTGATGGAGGATGG + Intergenic
1195944779 X:110198147-110198169 AAGGAAAACGGGAAGGAAGAAGG + Exonic
1196373157 X:115001153-115001175 CAGTTTTAGGGGCAGGAAGATGG + Intergenic
1196641124 X:118062449-118062471 CAGGTTTATGAGAAGTAACAAGG - Intronic
1196977173 X:121172253-121172275 GAGGATAATGGCAGGGAAGATGG - Intergenic
1197174383 X:123469870-123469892 CAAGATTAAGGGAATGAAGTAGG - Intronic
1198058864 X:133023434-133023456 CAGGATTTTGGTAAGAATGAAGG - Intergenic
1198675327 X:139124837-139124859 CAGGATTTGGGGAAGAAAGCAGG + Intronic
1198951383 X:142076317-142076339 TAGGATTGTGGGAAAGAATATGG + Intergenic
1199437271 X:147826855-147826877 AAGTATAATGGGAAGGAAGAGGG - Intergenic
1199538730 X:148933452-148933474 AAGGACTATGGGAAGGGAGCAGG + Intronic
1199628678 X:149761736-149761758 CAGGATCAATGGGAGGAAGAGGG - Intergenic
1199860573 X:151797374-151797396 CAGGAACATGGGAAGGCAAAGGG - Intergenic
1200499724 Y:3931648-3931670 CAGGATTATGAAAACTAAGAGGG - Intergenic