ID: 1141565194

View in Genome Browser
Species Human (GRCh38)
Location 16:84896943-84896965
Sequence GATTAAGGAGGGTGGACGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141565194_1141565204 6 Left 1141565194 16:84896943-84896965 CCGGCCGTCCACCCTCCTTAATC 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1141565204 16:84896972-84896994 GTGTGTTGGGTGATGCCAAAAGG 0: 1
1: 0
2: 1
3: 10
4: 152
1141565194_1141565200 -8 Left 1141565194 16:84896943-84896965 CCGGCCGTCCACCCTCCTTAATC 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1141565200 16:84896958-84896980 CCTTAATCCCGTCTGTGTGTTGG 0: 1
1: 0
2: 1
3: 3
4: 67
1141565194_1141565206 25 Left 1141565194 16:84896943-84896965 CCGGCCGTCCACCCTCCTTAATC 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1141565206 16:84896991-84897013 AAGGCAAGCTCTTCCTCCTCAGG 0: 1
1: 0
2: 2
3: 23
4: 353
1141565194_1141565201 -7 Left 1141565194 16:84896943-84896965 CCGGCCGTCCACCCTCCTTAATC 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1141565201 16:84896959-84896981 CTTAATCCCGTCTGTGTGTTGGG 0: 1
1: 0
2: 0
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141565194 Original CRISPR GATTAAGGAGGGTGGACGGC CGG (reversed) Intronic
900388691 1:2423570-2423592 GATTATGGAGGGTGAGGGGCTGG + Intergenic
900687790 1:3959578-3959600 GATTTAAGAGGCAGGACGGCGGG - Intergenic
902809214 1:18878866-18878888 GAGTAGGGAGGGAGGAGGGCTGG - Intronic
903116537 1:21183086-21183108 GATTAAAAAGGAAGGACGGCCGG + Intergenic
907998608 1:59657826-59657848 GTTTAGGGATGGTGGAGGGCAGG + Intronic
908389184 1:63669845-63669867 GATTCAGGTGGGTGGAGGTCAGG + Intergenic
913480606 1:119285673-119285695 GATTATGGAGGGTGAGGGGCTGG - Intergenic
914744723 1:150493306-150493328 TATTAAGGGGGGTGGAGGGGTGG + Intronic
919775220 1:201190114-201190136 TCTTAAGGAGAGTGGAGGGCAGG - Intergenic
922702432 1:227769702-227769724 GGTTGTGGAGGGTGGAGGGCCGG + Intronic
924794474 1:247283222-247283244 GACTAAGGAGGCAGGACAGCTGG - Intergenic
1068796920 10:61093574-61093596 CAGTGAGGAGGGTGGAAGGCAGG + Intergenic
1070716905 10:78729136-78729158 GATTCAGATGGGTGGAAGGCAGG + Intergenic
1071892391 10:90024564-90024586 GATTAAGAAGCATGGCCGGCCGG - Intergenic
1072710783 10:97714442-97714464 GATTAAGGAGGCTGGTCTCCGGG - Exonic
1075152695 10:119948746-119948768 GGTTAAGGTGGGTGGATCGCTGG + Intergenic
1075723212 10:124599087-124599109 GACAGAGAAGGGTGGACGGCAGG - Intronic
1076676677 10:132150636-132150658 GATTATGGAGGATGGATGGATGG - Intronic
1076884495 10:133255554-133255576 TGTCAAGGAGGGTGGGCGGCGGG - Intergenic
1080411249 11:32027201-32027223 AATTAAGGTGGGTGGAAGGCGGG - Intronic
1085529423 11:77182724-77182746 GACAAAGGAGGGTGGCAGGCAGG - Intronic
1088031242 11:105253709-105253731 GATTAAGGCAGGTGGAGGGTGGG - Intergenic
1089914651 11:122141766-122141788 CATTAAGGAGGGTGGAGGAGGGG - Intergenic
1096797330 12:54086068-54086090 GATTAATGGGGGTGAACGGAGGG - Intergenic
1098940322 12:76527224-76527246 AATTAAGGAGGGTGGTGGGCCGG + Intronic
1104549884 12:129746781-129746803 GATGCAGGAGGGGAGACGGCAGG - Intronic
1107271743 13:38626998-38627020 CATTAAGGAGGGGGGATGGTTGG + Intergenic
1109158861 13:58947332-58947354 AGATAAGGAGGGTGGACTGCAGG - Intergenic
1109472340 13:62825582-62825604 GAATAAGGAGGGTGGAAGACTGG - Intergenic
1123979532 15:25588268-25588290 GGTTAAGGAGGGTGAAGGGAGGG + Intergenic
1131261332 15:90889562-90889584 GCTTGAGGAGGGTGAACCGCTGG + Exonic
1131692726 15:94844815-94844837 GCTTTTGGAGGGTGGGCGGCCGG + Intergenic
1132733984 16:1376492-1376514 CATGAAGGAGGATGGACGCCAGG - Intronic
1134901076 16:17938628-17938650 GATTAAGGAGGGAGGTTGGGGGG - Intergenic
1136622879 16:31442107-31442129 GAGAATGGAGGGTGGACGGCCGG + Intronic
1138513055 16:57519762-57519784 GATTCAGGAGGGTGGAGGCGAGG + Intronic
1141421619 16:83921390-83921412 GATGGAGGAGGGTGGATGGAAGG + Exonic
1141565194 16:84896943-84896965 GATTAAGGAGGGTGGACGGCCGG - Intronic
1142635785 17:1256764-1256786 GAGAACGGAGGGTGGACGCCAGG + Intergenic
1143373083 17:6452324-6452346 GATAAAGGAAGGTGGCAGGCAGG + Exonic
1143924808 17:10360094-10360116 GATAAAGGAGAGTGGAAGGGAGG + Intronic
1147438273 17:40431304-40431326 GAGTAGGGTGGGTGGACGACAGG - Intergenic
1149658308 17:58321733-58321755 TATTATGGAGGGTGGACTGTGGG - Intronic
1150216621 17:63475115-63475137 TCTTCAGGAGGGTGGAGGGCGGG - Intergenic
1150812228 17:68365614-68365636 GATGATGAAGGGTGGACAGCAGG + Intronic
1151197486 17:72441828-72441850 GATTAACCAGGGAGGAAGGCAGG + Intergenic
1151368147 17:73630461-73630483 GGTTGAGGAGGGAGGAGGGCGGG - Intronic
1152013348 17:77734497-77734519 AATTAAGGAGGGAGGAAGGCAGG - Intergenic
1152473485 17:80503251-80503273 GATTATGGGGGGTGGATGGGTGG + Intergenic
1160348224 18:78152111-78152133 GATGAAGGAGGGAGGAGGACGGG - Intergenic
1160516021 18:79479762-79479784 GACAAAGGGCGGTGGACGGCAGG - Intronic
1163284260 19:16336600-16336622 GAAAAAGGAGGGGGGATGGCGGG - Intergenic
1163827201 19:19530330-19530352 GGTGAAGGAGGGTGGCAGGCAGG - Intronic
1164090393 19:21946523-21946545 GATTAAGGAGTGTGGACACAAGG - Intronic
927698869 2:25254950-25254972 GAATAAGGAAGTTTGACGGCCGG - Intronic
928035130 2:27815693-27815715 GCTTAAGGAGGGTGGACAGGTGG + Intronic
931092407 2:58900216-58900238 GATGAAGGATGGTGCAGGGCAGG - Intergenic
931211371 2:60199380-60199402 AATTAAGGATGGTGGATGGTGGG + Intergenic
938340920 2:130535944-130535966 GATTACGGAGGTTGGCAGGCAGG - Intergenic
938348910 2:130584765-130584787 GATTACGGAGGTTGGCAGGCAGG + Intergenic
941222831 2:162806074-162806096 GACTAAGGAGGGGGCACGGTGGG + Intronic
941326214 2:164118161-164118183 GTTTGAGGTGGGTGGAAGGCTGG + Intergenic
942299308 2:174546930-174546952 GCCGAAGGAGGGTGGAGGGCTGG - Intergenic
944499504 2:200344215-200344237 GAGTATGGAGGGTGGAAGGAGGG - Intronic
946236982 2:218330199-218330221 TAGGAAGGAGGGTGGAAGGCAGG - Intronic
946574826 2:221063694-221063716 GAGTAAGGGGGATGAACGGCTGG - Intergenic
948759357 2:240181056-240181078 GATCAAGGAGGGTGGATGGAGGG - Intergenic
1170848508 20:19982454-19982476 GGCTGAGGAGGGTGGAAGGCAGG - Intronic
1171849174 20:30295926-30295948 GATTAATGGGGGTGAACGGAGGG - Intergenic
1173004663 20:39130651-39130673 GATTTTGGAGGGTGGGCGACAGG + Intergenic
1174509663 20:51041546-51041568 GATGAGTGAGGATGGACGGCTGG - Intergenic
1175335483 20:58193247-58193269 GAGCAAGGAGGGTGGAAGACAGG + Intergenic
1179514462 21:41897274-41897296 GAATGAGGAGGGCGGACGGGGGG + Intronic
1182707411 22:32294558-32294580 GATTAAGGAGGGGGTGGGGCAGG - Intergenic
1184395752 22:44238011-44238033 GATTAAGGAGGGGGTGGGGCAGG - Intergenic
1184878112 22:47288353-47288375 GATGAAGGTGGGTGGATGGAGGG - Intergenic
951540239 3:23775578-23775600 GATTAGGGAAGGTGGACGGAAGG - Intergenic
953069063 3:39502150-39502172 AATTGAGGAAGGTGAACGGCGGG - Exonic
954709433 3:52498026-52498048 GATCAGGGAGGGTGCAGGGCTGG - Intronic
962035515 3:131647461-131647483 GATTAGAGACGGTGGAGGGCAGG - Intronic
966634496 3:182116856-182116878 GCTTGAGGTGGGTGGAGGGCCGG - Intergenic
979464391 4:121019751-121019773 GATTACAGATGGTGGAAGGCAGG - Intergenic
983566868 4:169162774-169162796 GAATAAGGAGGGGGGCTGGCTGG - Intronic
988914296 5:35876781-35876803 GATTGAGGAGTGAGGAAGGCAGG + Exonic
990544919 5:56814188-56814210 GATTAAGGAGGGGGGAGGTTGGG - Intergenic
997028819 5:130098211-130098233 GATTAAGGAGGGGGTAAGGCAGG - Intronic
997138355 5:131351183-131351205 GACCAAGGAGGGTGGATTGCTGG - Intronic
999234020 5:150079752-150079774 GAATAAGGAGTGTGTAGGGCGGG - Intronic
1001049365 5:168402211-168402233 GGCTAAGGAGTGTGGGCGGCTGG - Intronic
1002435349 5:179227877-179227899 CAGGAAGGAGGGTGGAAGGCAGG + Intronic
1004773205 6:18810493-18810515 GATTCAGGAGGGTGGAAAGAAGG + Intergenic
1006027648 6:31157805-31157827 GATTAATGAGGGTGGGAGGGTGG - Intronic
1006906614 6:37537328-37537350 GGTGAAGGAGGGTGGACTTCTGG + Intergenic
1008340710 6:50360541-50360563 GATGAGGGAGGGTGGAAGGAAGG + Intergenic
1014853239 6:126367479-126367501 GATAAAGGAGGGTTGACAACTGG + Intergenic
1018471360 6:164101164-164101186 GATGGAGGAGGGTGGCCTGCAGG - Intergenic
1018471389 6:164101246-164101268 GATGGAGGAGGGTGGCCTGCAGG - Intergenic
1018844671 6:167547367-167547389 GATTGAGGAGGGAGGAGGGGTGG - Intergenic
1022889147 7:34677858-34677880 GCTAAAGGAGTGTGGACAGCTGG + Intronic
1029730698 7:102436023-102436045 GATGGAGGAGGGAGGACGGAGGG + Intronic
1030138719 7:106284611-106284633 GCTTGAGGAGGATGGAGGGCTGG - Intronic
1031896343 7:127352858-127352880 GTTTAAAGAAGGTGGACAGCAGG - Intronic
1037154727 8:15685334-15685356 GATTAAAGAGGGAGGAAGCCAGG - Intronic
1037291030 8:17349585-17349607 GATTTGGGAAGGTGGAGGGCAGG - Intronic
1038336162 8:26647366-26647388 GGTTAGGGAGGGTGGAGGGGAGG - Intronic
1041698947 8:60766478-60766500 GATTAACCAGGGTAGACGGTAGG + Intronic
1041840137 8:62259878-62259900 GGTGAAGGTGGGTGGGCGGCAGG + Intronic
1049252174 8:141595160-141595182 GGTTTAGGAGGGTACACGGCAGG - Intergenic
1049405171 8:142449186-142449208 GATGATGGATGGTGGACGGCAGG - Intergenic
1053416727 9:37951625-37951647 GCTCAGGGAGGGTGGATGGCAGG - Intronic
1053786895 9:41658645-41658667 GATTAATGGGGGTGAACGGAGGG - Intergenic
1054158167 9:61655550-61655572 GATTAATGGGGGTGAACGGAGGG + Intergenic
1054454326 9:65421791-65421813 CATTAAGGTGGGTGGATGGATGG + Intergenic
1054477940 9:65586555-65586577 GATTAATGGGGGTGAACGGAGGG + Intergenic
1056069113 9:82967561-82967583 GAGTAAGGAGAGTGGAAGTCTGG - Intergenic
1056910808 9:90698432-90698454 GATGGTGGAGGGTGGACGGAGGG + Intergenic
1057210392 9:93198161-93198183 GCTTGAGGAGGGTGGACTGCAGG + Intronic
1059715290 9:116907605-116907627 GATTAAGAAAGATGGATGGCGGG + Intronic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1187461412 X:19490646-19490668 GGCTAAGGTGGGTGGATGGCTGG + Intronic
1188004948 X:25010834-25010856 GATGATGGAGGGAGGAAGGCGGG - Intronic
1190202852 X:48378918-48378940 GGTTAGGGATGGTGGACGGGAGG + Intergenic
1190207686 X:48416495-48416517 GGTTAGGGATGGTGGACGGGAGG - Intergenic
1190210809 X:48445861-48445883 GATTAGGGATGGTGGATGGGAGG + Intergenic
1191639456 X:63414473-63414495 GATTAAGGACTGAGGACTGCTGG + Intergenic
1193717561 X:84950227-84950249 GATTAAGGACTGAGGACTGCTGG + Intergenic
1195292629 X:103443933-103443955 GATGAAGCAGGGTGGGCGGCAGG - Intergenic
1201587326 Y:15575507-15575529 GATAAAGGAGGATGGAGGACAGG - Intergenic